ID: 975915026

View in Genome Browser
Species Human (GRCh38)
Location 4:79314492-79314514
Sequence GCATTTTTAACATAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975915025_975915026 -6 Left 975915025 4:79314475-79314497 CCAGAGACAAAGAAACTGCATTT 0: 1
1: 0
2: 8
3: 27
4: 364
Right 975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG 0: 1
1: 0
2: 3
3: 23
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975915026 Original CRISPR GCATTTTTAACATAGCACCC AGG Intronic
903960395 1:27053413-27053435 GTATTTTTAACATACTTCCCAGG - Intergenic
904904482 1:33884660-33884682 GCATTTTTGAAAGACCACCCTGG - Intronic
905008002 1:34726580-34726602 GCATTTTAAAATGAGCACCCTGG - Intronic
905569004 1:38989475-38989497 TCATTTTTACCCTAGCATCCAGG + Intergenic
907463175 1:54618036-54618058 GCATTTTTAACACACTCCCCAGG + Intronic
907657340 1:56357588-56357610 GCAGTTTTAAAAAATCACCCTGG + Intergenic
907980500 1:59475852-59475874 ACATTTTTAAAATATCACTCTGG - Intronic
908017530 1:59859288-59859310 GCAATTATAACATAGCACATGGG - Intronic
908614632 1:65905607-65905629 GCATTTTTAAAAGATCACACTGG + Intronic
908961723 1:69705996-69706018 GAATTTGTAACCTAGCACACAGG + Intronic
917180917 1:172296840-172296862 GCCTTTTAAACATAGCATCTTGG + Intronic
917641788 1:176990043-176990065 GCATTTTTAATAAAGGACACTGG - Intronic
921427271 1:215018831-215018853 GCATTCTTAAAAGATCACCCTGG + Intronic
922414555 1:225408754-225408776 GCAATATTAACATAGCCCCAGGG - Intronic
923059069 1:230453783-230453805 GCATTTCAAAAATAGCTCCCAGG - Intergenic
923117541 1:230957174-230957196 GCATTTTCAAAATAGCACCCTGG + Intronic
1063717820 10:8546007-8546029 GCATTTTAAACATATCACTATGG - Intergenic
1065622517 10:27598104-27598126 GCACTTTGAATATATCACCCAGG + Intergenic
1065830882 10:29612536-29612558 GCATATTTGGCAGAGCACCCTGG - Intronic
1067976794 10:51035488-51035510 GCTTTATTAACATAACACCTGGG + Intronic
1068243272 10:54333764-54333786 GCATTTTTAACAAACCTACCAGG + Intronic
1068319778 10:55397168-55397190 TCATTTTTAACATATCTCCTTGG + Intronic
1070114923 10:73519045-73519067 GCCTTTTGAACATTGAACCCAGG + Intronic
1071143373 10:82539299-82539321 GATTCTTTAACATAGCACCGTGG + Intronic
1072568177 10:96635567-96635589 TCCTTTTCAACACAGCACCCAGG + Intronic
1073523745 10:104159882-104159904 GCATTTTTAACAAATCCCCCAGG + Intronic
1073740953 10:106406364-106406386 GCATTTTTAAAATGTCACCCTGG + Intergenic
1073746477 10:106474172-106474194 GAATTTGTAACATGCCACCCAGG - Intergenic
1074330510 10:112502799-112502821 CCATTTTTAAAAAAGCACACAGG - Intronic
1075698652 10:124454032-124454054 GCAATTTAAAGATAGCACTCAGG - Intergenic
1078253821 11:9640309-9640331 TTATTTTTAAAATAACACCCAGG + Intergenic
1078813190 11:14792506-14792528 TTATTTTTATCATAGCTCCCAGG - Intronic
1079505868 11:21151152-21151174 GTATTTTTCCCAGAGCACCCAGG + Intronic
1079793001 11:24762664-24762686 CCATTTTTTACAAAGCACTCGGG + Intronic
1085198140 11:74684372-74684394 GCCTTTTTAAACAAGCACCCTGG - Intergenic
1085270943 11:75269411-75269433 GCACTTTTACAAGAGCACCCTGG - Intronic
1086516169 11:87615807-87615829 GCATTTTTAACAAGATACCCAGG + Intergenic
1086961616 11:92984248-92984270 GCATTTTTAAGCAAGCTCCCAGG - Intronic
1087140843 11:94764467-94764489 GCATTTTGATCAAAGCAGCCTGG + Intronic
1087294854 11:96359470-96359492 GCATTTTGGACATAGCATCTTGG - Intronic
1095561885 12:43575173-43575195 GCATTTTTACCATGTTACCCAGG - Intergenic
1095886050 12:47189652-47189674 GCACTTTCAGCATAGCACCATGG + Intronic
1096971609 12:55670862-55670884 GCATTTTTAACAAGACTCCCAGG - Intergenic
1098324339 12:69285550-69285572 GCATTTCTAACCTAGAACACTGG + Intergenic
1102068810 12:110000378-110000400 GCATTTTTAACAAACTCCCCAGG + Intronic
1105902679 13:24769994-24770016 GTATTTCTAATATAGCACCTAGG - Intronic
1106097791 13:26663821-26663843 GCTTTTATCACATAGCTCCCTGG - Intronic
1106367700 13:29098789-29098811 GAATTTTTAACAGAGTACCTAGG - Intronic
1106461480 13:29974118-29974140 GTAGTTTTAACATAGCAGCCAGG - Intergenic
1106667834 13:31871070-31871092 GCATGTGGAACATGGCACCCAGG + Intergenic
1108807162 13:54172728-54172750 ATATTTTTACCATAGAACCCAGG + Intergenic
1109317189 13:60764250-60764272 GAATGTTGAACATAGGACCCTGG + Intergenic
1111138967 13:84088465-84088487 GAATTTTCATCATAGCACTCAGG + Intergenic
1116148968 14:41113144-41113166 GCATTTTTAAAATTGTATCCTGG - Intergenic
1116551500 14:46245744-46245766 GCATTTTAAACAAATCACTCTGG - Intergenic
1118777335 14:68980852-68980874 GCATTTTCACCATTGCACTCCGG + Intergenic
1119833891 14:77729494-77729516 CTATTTTTAACACAGCAGCCAGG + Intronic
1119844172 14:77816116-77816138 GCATTTTTGAAATGGCATCCAGG + Intronic
1120088642 14:80305662-80305684 ACATTTTTAAAATAACACACTGG + Intronic
1121271962 14:92643625-92643647 GCATTTTAAAGATAGAACACTGG + Intronic
1121439049 14:93937269-93937291 GCATTTTTAACAGGACACTCAGG + Intronic
1121613710 14:95298768-95298790 GCATATTTAACCTAACATCCAGG + Intronic
1121734322 14:96207123-96207145 GCATTTGGATCATAGCACCGGGG + Intronic
1121834639 14:97080763-97080785 CCCATTTTAACATAGCAACCAGG + Intergenic
1125605587 15:40938089-40938111 GCATTGTTTACATTGCATCCTGG + Exonic
1127621336 15:60737467-60737489 GCATTTCTAACCTAGTTCCCAGG - Intronic
1127654144 15:61039895-61039917 GCCTTTTTAACAAAGGACCCAGG + Intronic
1128486283 15:68093162-68093184 GCATTTTTTAAATAGCAACTTGG + Intronic
1129547026 15:76406785-76406807 GCATCTTTAACAATGCCCCCAGG - Intronic
1135859346 16:26041179-26041201 GCATTTTTAAAAAATCACCCAGG + Intronic
1140802082 16:78497898-78497920 GTATTTTTAACAAAGCATCAGGG + Intronic
1142857840 17:2742291-2742313 GCATTTTTAAAGTATCACTCTGG + Intergenic
1147111918 17:38268974-38268996 GCGTTAGTAACATAGCACACTGG - Intergenic
1148515217 17:48210626-48210648 GCAATTTTAACAAACTACCCAGG + Intronic
1151050211 17:70969782-70969804 GCAATATTAACATAGCTCTCTGG - Intergenic
1151217571 17:72588100-72588122 GCATTTTCAACAAGCCACCCAGG - Intergenic
1152837874 17:82546415-82546437 GTATTTTTAATATACCACGCTGG - Intronic
1153601412 18:6784239-6784261 GCATTTCTAACAAAGCTCCCAGG - Intronic
1154165287 18:12010214-12010236 ACATTTTTAACATAACAAACTGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156798821 18:41082862-41082884 GCATTTTTAAGTAAGCATCCAGG - Intergenic
1156879795 18:42063049-42063071 GCATTTTTAACAGTTCACACTGG - Intronic
1159533209 18:69682113-69682135 GCATGTTTACCATAGCAACCAGG - Intronic
926691192 2:15735062-15735084 GCATTCTTAATATAGCACCCTGG + Intronic
932869064 2:75378456-75378478 GCATTTTAAACAGATCACACTGG + Intergenic
937087136 2:119178948-119178970 GCATGTTTGACAGAGCACTCCGG - Intergenic
937103099 2:119286682-119286704 GCATTTTTAAAAGATCACTCTGG + Intergenic
937696490 2:124813988-124814010 GAATTTTTAAAAGATCACCCTGG - Intronic
938371750 2:130773180-130773202 GCATTTTTAATAAAGCTCACTGG - Intergenic
938658243 2:133458045-133458067 GAATTTTTAACATAGCCTCCAGG - Intronic
939134743 2:138279900-138279922 GCATTTTTAACAAGACCCCCAGG + Intergenic
939249384 2:139665433-139665455 GAATTTTTAACATAGCATGTGGG + Intergenic
940348245 2:152650565-152650587 GCATTTATTAGATTGCACCCTGG - Intergenic
940486968 2:154308028-154308050 GCAGTTTTTATATAACACCCAGG + Intronic
941090970 2:161175242-161175264 GCATATTGACCATAACACCCTGG + Intronic
941651329 2:168095363-168095385 GCATTTTTAACACATGACCTAGG - Intronic
941787479 2:169514147-169514169 GCATGTTAAATATAGCACGCAGG + Intronic
944977358 2:205069996-205070018 GCATGTTTAGCAGAACACCCTGG + Intronic
946177409 2:217929934-217929956 GCATTTTAGAAATAGCTCCCTGG - Intronic
947413127 2:229864182-229864204 TTATTTTTAACATATCAGCCCGG - Intronic
948480132 2:238244008-238244030 GTATTTTTCACATAGCACAAAGG - Intergenic
948778948 2:240305135-240305157 CCATGTTTAAAATAGCCCCCCGG - Intergenic
1172115162 20:32569394-32569416 ACATTTTTAACACAGCACTTTGG + Intronic
1172769732 20:37374371-37374393 GCATTATTAAAATATCAGCCAGG - Intronic
1173985314 20:47256875-47256897 GCATTTTCAACAGAGCATCAAGG + Intronic
1174890202 20:54383633-54383655 GCATTTTTAAAAGAACACTCTGG - Intergenic
1175560800 20:59927958-59927980 GCATTTTTCACCTTCCACCCTGG - Intronic
1178715130 21:34957528-34957550 ACATTTTTTTCATGGCACCCAGG - Intronic
1178852898 21:36227989-36228011 GCATATTTGACATATCACCTGGG - Intronic
1182918251 22:34055315-34055337 GCATTTTTAACAAACCTCCCTGG - Intergenic
1184313408 22:43663928-43663950 GCAGCTTTAACAAAGTACCCTGG - Intronic
951505535 3:23440976-23440998 GGATTTTTAAAATAGCCCCTAGG - Intronic
951940217 3:28069477-28069499 GCATGTTTAACAAACCACCCTGG - Intergenic
952847049 3:37696640-37696662 TCCTTTTTAAAATAGAACCCAGG + Intronic
954975469 3:54689842-54689864 GCATTTTAAACAAATCACTCTGG - Intronic
955326907 3:58015655-58015677 GCATTTTTAACAAAGTCCCCAGG - Intronic
955779589 3:62470218-62470240 CCATTTTTAAGATCGCATCCTGG - Intronic
957376438 3:79365394-79365416 GCATTTCTATCATAGCCCCATGG + Intronic
958707086 3:97669456-97669478 GCATTTTTAAAAATGTACCCTGG - Intronic
960245457 3:115395216-115395238 GAATTCTTAACACAGCACCAAGG - Intergenic
964075509 3:152687086-152687108 TCATGTTTAAAATAACACCCAGG - Intergenic
967136310 3:186515675-186515697 GCATTTTTCACATATACCCCAGG - Intergenic
970352897 4:15222596-15222618 GCATTTTTAAGATATCACTCTGG - Intergenic
972138781 4:35928656-35928678 GCATTTTTAACAAGGTCCCCAGG - Intergenic
973154997 4:46940067-46940089 GCATTTTTAAAATAACTCACAGG - Intronic
974907399 4:68075361-68075383 GCATTTTAAAGATATCATCCTGG - Intronic
975171213 4:71233817-71233839 CCATTTTTCACATAGCAGCCAGG + Intronic
975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG + Intronic
976262100 4:83155434-83155456 GTATTTTTAACCAAGCACTCTGG - Intergenic
979557877 4:122071294-122071316 TCATTATTAACATAGCACCCTGG - Intergenic
979668819 4:123341269-123341291 GTATTTTAAACATATCAGCCTGG - Intergenic
980184527 4:129445682-129445704 GCATTTTTAACTGTGGACCCTGG - Intergenic
980478822 4:133357960-133357982 CTATTTTTAACAAAGCAGCCAGG + Intergenic
983979722 4:173980114-173980136 GCAGTTTTAACATGTCACACTGG + Intergenic
984301916 4:177930863-177930885 ACATATTTATCATAGAACCCAGG - Intronic
985921977 5:2984472-2984494 GCATTTTTAACAGAATCCCCAGG - Intergenic
986662003 5:10067526-10067548 TCCTTTTGAACATAGTACCCTGG - Intergenic
987939050 5:24508910-24508932 GCAGAGTTGACATAGCACCCTGG + Intronic
988878913 5:35478740-35478762 GCATTTTTAACATGGACCCCAGG - Intergenic
989233378 5:39114553-39114575 GCATTTGTAACCCAGCACCATGG - Intronic
991461944 5:66868105-66868127 GCATTTTTGAAAAAGCAACCAGG - Intronic
992177174 5:74161356-74161378 GCATTTTTAACATACCTCTCGGG - Intergenic
992983637 5:82203838-82203860 TCATTTTTAAGATAACACACTGG - Intronic
995806991 5:116064110-116064132 GCATTTTTAAAAGACCACACTGG + Intergenic
997100735 5:130966130-130966152 GCATTTTTAAGAGATCACTCTGG + Intergenic
999042704 5:148432853-148432875 TTAGTTTTAACAAAGCACCCTGG - Intronic
999475059 5:151890836-151890858 GCATTGTTAACATAACCCCCAGG - Intronic
999656647 5:153817116-153817138 GCATTTTTAACAAAGTCCACTGG + Intergenic
1001204472 5:169749334-169749356 GCATTTCTAACACAGCTACCCGG + Intronic
1001817422 5:174681739-174681761 GTATTTTTAACAAATAACCCAGG - Intergenic
1002837072 6:874161-874183 TCATTTTTAATATAGTTCCCAGG + Intergenic
1005642859 6:27813408-27813430 ACATTTGTAACATAACACCCAGG + Intergenic
1007225026 6:40307824-40307846 GCACTTGTAACACAGCACCTGGG - Intergenic
1010403235 6:75472287-75472309 GCACTTATATCATAGCACCCTGG - Intronic
1012296291 6:97529105-97529127 GCATTTTTAAAAGATCACTCAGG - Intergenic
1014678990 6:124404919-124404941 GCAATGTTAACATAAAACCCAGG + Intronic
1020353007 7:7243787-7243809 GCATTTCTGACATAGAACACTGG + Exonic
1020414272 7:7928313-7928335 GCATTTTAGACAAATCACCCTGG + Intronic
1021325879 7:19267038-19267060 GCATTATTAACATGTCTCCCAGG - Intergenic
1021908284 7:25358375-25358397 GCATTTGTAACCTAGAAACCTGG - Intergenic
1022284296 7:28940395-28940417 GAATTTTTAACATCGCATCATGG - Intergenic
1022526111 7:31038402-31038424 GCATTTTAAAAATATCACCCAGG - Intergenic
1023247449 7:38220244-38220266 TTATTTTTAACAGAGCACTCTGG - Intronic
1026254630 7:68699816-68699838 GCATTTTTAACAAGACCCCCAGG - Intergenic
1026348130 7:69492662-69492684 GCACTTTTAACAAATCCCCCAGG + Intergenic
1027247720 7:76378638-76378660 GAATTTTTAAAAGATCACCCTGG - Intergenic
1028514918 7:91667230-91667252 GCATTTTTAACAAAGCTTCCAGG + Intergenic
1032888559 7:136168242-136168264 GCATTGTCACCATAGCACACGGG - Intergenic
1033992136 7:147301117-147301139 GCACCTTTAAAATGGCACCCAGG - Intronic
1035561928 8:611526-611548 ACATTTTCAGCAGAGCACCCTGG + Intergenic
1035832133 8:2707983-2708005 GCATTTGTATCAAACCACCCCGG + Intergenic
1037313078 8:17576811-17576833 GCACTTTTTACAGAGCACTCAGG + Intronic
1037577396 8:20220603-20220625 GCACTTTAAACATAGCACTGAGG - Exonic
1041605087 8:59772713-59772735 GGATTTTTAAAATAGCACTATGG - Intergenic
1042229373 8:66541280-66541302 GCATTTCTAACACATCATCCTGG - Intergenic
1044537731 8:93376420-93376442 GCATTTTTAACAAACTCCCCAGG - Intergenic
1046140874 8:110089659-110089681 ACATTTTTAGCATAGCATCTTGG + Intergenic
1046482204 8:114837157-114837179 GCATTGGTAACATTGCATCCCGG - Intergenic
1046668343 8:117030569-117030591 TCATATTTAACACTGCACCCAGG - Intronic
1046839758 8:118843158-118843180 GGAATTTTACCATAGCGCCCAGG + Intergenic
1047994274 8:130318613-130318635 GCATTTTTAACAGGCCATCCTGG + Intronic
1048446520 8:134497270-134497292 GCAGTTTTCACATAGAAGCCAGG - Intronic
1051778706 9:20664778-20664800 CCATTATTAAGATATCACCCTGG - Intronic
1052464204 9:28809435-28809457 GCATTTTTAAAAGATCACCCAGG - Intergenic
1052464607 9:28814577-28814599 GCATTTTTAAAAGATCACCCAGG - Intergenic
1056330833 9:85519770-85519792 GCATTTGTATCATGGGACCCAGG - Intergenic
1058735043 9:107886403-107886425 GAATTTTTAAAATACCAACCCGG - Intergenic
1186247454 X:7629541-7629563 GCATTTTTAAAAAATCACACTGG - Intergenic
1187720942 X:22150247-22150269 GCATTTTTAACCAAGTCCCCAGG - Intronic
1189780071 X:44505596-44505618 ACATTTATAACATATCAGCCGGG - Intergenic
1190105238 X:47556021-47556043 GGATTTTTAATATACAACCCTGG - Intergenic
1190980507 X:55453098-55453120 TCATTTTCAACTTAGGACCCTGG - Exonic
1195038903 X:100995544-100995566 GCAATGTTAACAAAGCACTCAGG + Intergenic
1195881868 X:109601100-109601122 GCATATGAAATATAGCACCCGGG + Intergenic
1196891932 X:120299613-120299635 ACATTTTTAAAATGGCACCTGGG - Intronic
1198229810 X:134678124-134678146 GCATTTTCAAAATATCAGCCTGG - Intronic
1199070883 X:143474248-143474270 TCATTTTCAACACAGCAGCCAGG + Intergenic
1199533539 X:148876722-148876744 GCACTTTTACCATGGCACCCTGG + Intronic
1202140030 Y:21712023-21712045 TTATTTTTATCATTGCACCCTGG + Intergenic
1202276534 Y:23126547-23126569 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG + Intergenic
1202429527 Y:24760269-24760291 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202441264 Y:24909821-24909843 GCATTTTTAACATGTGCCCCAGG + Intergenic