ID: 975922370

View in Genome Browser
Species Human (GRCh38)
Location 4:79407549-79407571
Sequence CTTTATCCCATTCCAAAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975922369_975922370 7 Left 975922369 4:79407519-79407541 CCATTGGAATTTCAAAAAAGTCA 0: 1
1: 0
2: 7
3: 30
4: 453
Right 975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG 0: 1
1: 0
2: 3
3: 14
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975922370 Original CRISPR CTTTATCCCATTCCAAAGAA TGG Exonic
900490217 1:2944285-2944307 CTTTAGTCTCTTCCAAAGAAGGG + Intergenic
902912376 1:19609387-19609409 CCATTTCCCATTCCAATGAACGG - Intronic
903790148 1:25887231-25887253 CATTGTCCCTTTCCAAAGCAAGG + Intronic
903889330 1:26558964-26558986 CATTATCCTTTTCTAAAGAATGG + Intronic
905488078 1:38321037-38321059 CTTTATCCCATCCAAAAACATGG + Intergenic
908492831 1:64663631-64663653 CTCTATCTCATCCCAAACAAAGG - Intronic
910526860 1:88189014-88189036 CTCTATTCTGTTCCAAAGAAAGG - Intergenic
913296689 1:117328570-117328592 CATTGTCCCATTCCCAAGCAGGG - Intergenic
913548671 1:119895626-119895648 CATAATCCCAGTCAAAAGAATGG + Exonic
916573225 1:166045349-166045371 CTTTATCCCCTCCTACAGAAAGG - Intergenic
917771094 1:178278905-178278927 CTTTCTCCCATTACAAGGAAGGG + Intronic
918373706 1:183887220-183887242 CTTTATATCTTTCCAAATAAGGG + Intronic
918691777 1:187489470-187489492 CTAAATCCTATTACAAAGAATGG - Intergenic
920736333 1:208536288-208536310 CTTCACCCCATGCCAGAGAAAGG + Intergenic
920941792 1:210490284-210490306 CTTTAACACATTCTAAAGAGAGG + Intronic
921345653 1:214182268-214182290 CCTTCTCCCATTTCAGAGAATGG - Intergenic
1065402701 10:25324009-25324031 CTGTAACCTAATCCAAAGAAAGG - Intronic
1067909746 10:50333950-50333972 CATTATCCCATTTTACAGAAGGG + Intronic
1068681422 10:59824290-59824312 CTTCATCACATCCCAAAAAATGG + Intronic
1068991638 10:63157021-63157043 CTCTCTCCCCTTCCAAAGGATGG - Intergenic
1073194336 10:101676163-101676185 CTTTTTCACATTTTAAAGAAGGG - Intronic
1076162056 10:128252132-128252154 CTTTATTTCATTACAAATAAAGG - Intergenic
1078251098 11:9617250-9617272 CCATGTCCCACTCCAAAGAAGGG - Intergenic
1080595177 11:33766846-33766868 CTTTATCCTATTCCAACTCATGG + Intronic
1080951982 11:37044677-37044699 CTTCATCCCACTTCAATGAAGGG + Intergenic
1082129111 11:48466321-48466343 CTCAATCCCCTTCCAAAGCACGG + Intergenic
1082248302 11:49951089-49951111 CTTGATCCCCTTGCAAAGCATGG - Intergenic
1082562647 11:54637277-54637299 CTTAATCCCCTTCCAAAGCACGG + Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1083809489 11:65095829-65095851 GTTTATCCCATTCCTAAAATTGG - Intronic
1084035019 11:66504409-66504431 CTTAATCCCATTCAAGAGGAAGG + Intronic
1086856555 11:91872618-91872640 CTCTATCTCATTGCAAAGAAAGG + Intergenic
1087096591 11:94325088-94325110 TTTTATCCAAATCCAACGAAGGG - Intergenic
1089912288 11:122113240-122113262 ATTCATCCCATTTCATAGAAAGG + Intergenic
1089920834 11:122207939-122207961 CTTCATCCCATTTCAGAGGACGG + Intergenic
1094468405 12:30779204-30779226 CTTTATCCCAGTTCAAAGAAGGG + Intergenic
1095567606 12:43644656-43644678 CTTTATCCCTTTCTACAAAAGGG - Intergenic
1095746757 12:45667921-45667943 CCTAAGGCCATTCCAAAGAATGG + Intergenic
1095809832 12:46360843-46360865 TTTTATTCCATTCCAGAGAATGG - Exonic
1097391330 12:59018123-59018145 CTTTATGGCATTCTAAAAAATGG + Intergenic
1097541244 12:60946306-60946328 CCTTCTCCCTCTCCAAAGAATGG - Intergenic
1097850704 12:64407021-64407043 CTTTTTCCCATGTCATAGAAAGG + Intronic
1097981879 12:65743644-65743666 TTTTATCCCATTTAAAGGAAAGG + Intergenic
1102025195 12:109710572-109710594 ATTAATCCCATTTCAAAGATGGG + Intergenic
1107927876 13:45280942-45280964 CTTTGTAAAATTCCAAAGAATGG - Intronic
1111867545 13:93788331-93788353 CTTTATCTTATTCACAAGAAAGG + Intronic
1112374246 13:98824177-98824199 CATGATCTCTTTCCAAAGAAAGG + Intronic
1113251903 13:108462475-108462497 CCTTATCACATTATAAAGAAAGG + Intergenic
1115977006 14:39007897-39007919 CAATATTCCATGCCAAAGAATGG + Intergenic
1117490680 14:56243669-56243691 CTTTATCCAGTTCACAAGAATGG + Intronic
1117648119 14:57873876-57873898 CTTCATCACATTCCATGGAAAGG - Intronic
1118015633 14:61657639-61657661 CTTTCTCCCATTTGAAAGTAGGG - Exonic
1119547981 14:75487075-75487097 ATTTATCTCACTCCAAAGCAAGG + Intergenic
1120883322 14:89432151-89432173 CTTTATACCCTTCCACAGAGAGG - Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122194878 14:100077382-100077404 CTGTTTCCCATTTCAAGGAATGG - Intronic
1124047184 15:26161187-26161209 ATTTATCCCATTGCAAAGGCAGG - Intergenic
1124145014 15:27116720-27116742 CTTAATCCCATTCACAAGAAAGG - Intronic
1124468343 15:29960859-29960881 CTTTATTCCACACCAAACAAAGG - Intronic
1126619919 15:50628196-50628218 CTCTATCCCATGCCAATGTAAGG + Exonic
1126710315 15:51447631-51447653 CTGTATCCCATTTCCTAGAATGG + Intergenic
1131608178 15:93931907-93931929 AGTTCTCCCATTCCATAGAAAGG - Intergenic
1132040224 15:98518892-98518914 CTTTTTCCCTTTCTAAAAAAAGG - Intergenic
1132044431 15:98551344-98551366 TTTAATCCCATTCCACAGATTGG - Intergenic
1133481121 16:6171706-6171728 TTTTCTGCTATTCCAAAGAATGG - Intronic
1138768345 16:59631553-59631575 TATTATCCCATTACAAAGCAGGG + Intergenic
1139096564 16:63711545-63711567 CTTGAGCCCATTGCAAAAAAAGG - Intergenic
1140033221 16:71354662-71354684 ATTTGACCCATTCCAAAGATAGG - Intergenic
1141175467 16:81715852-81715874 CTTTACGCCTTTACAAAGAAGGG + Intergenic
1141273563 16:82563156-82563178 CTCTATCCCATTCCCACAAATGG + Intergenic
1141876085 16:86825436-86825458 CTTTATCCCCTTTCACAGAAGGG - Intergenic
1143113741 17:4568988-4569010 CTATATTCCATTCAAAAGAATGG - Intergenic
1144051575 17:11501549-11501571 CTTAATCCCATTTCTAGGAATGG + Intronic
1144067007 17:11633638-11633660 TTTGAACCAATTCCAAAGAAAGG + Intronic
1144303342 17:13944296-13944318 CTTTTTCCCATGCTAAACAAAGG - Intergenic
1145260664 17:21352579-21352601 CTTGTTCCCATTTCACAGAAGGG + Intergenic
1146555446 17:33819106-33819128 CTATATGCCTTTCCTAAGAAAGG + Intronic
1146560721 17:33867491-33867513 CTCCATCCAATTCCAAAGACTGG + Intronic
1150124004 17:62625131-62625153 CTTCATCTGCTTCCAAAGAAGGG - Intergenic
1150307622 17:64099888-64099910 CTTTCTCCCATTCCAGGGAGTGG - Intronic
1150686145 17:67322415-67322437 CTTTCTCCCTTGCCAGAGAAAGG - Intergenic
1151062687 17:71114349-71114371 TATTATCACATTCCAATGAATGG - Intergenic
1152041815 17:77908617-77908639 TTTTATCCCATTTAACAGAAAGG + Intergenic
1155042023 18:22072851-22072873 CTATATCCCAGTCCCAGGAATGG - Intergenic
1155726085 18:29085225-29085247 CTTAATCCCATTGAAAAGGAAGG - Intergenic
1156911100 18:42411986-42412008 GTATTTCCCATTCCAGAGAATGG - Intergenic
1157912240 18:51627556-51627578 TTTCATCCCACTCCGAAGAAAGG - Intergenic
1159825526 18:73204534-73204556 CTTTCTCCCATTTCAAAGTCTGG + Intronic
1160195667 18:76753207-76753229 CATCATCCCATTCCCATGAAAGG + Intergenic
1161228249 19:3158051-3158073 TTTTATTCCATTCCACAGAAGGG - Intronic
1162188880 19:8929072-8929094 TTTTATTCCATTCCACAGAGGGG + Intronic
1163271832 19:16259070-16259092 CTTTCTCCCAATGCAAAGCAGGG + Intergenic
1166654379 19:44599442-44599464 CTGTATCCACTTCCAGAGAAGGG + Intergenic
1168034655 19:53709816-53709838 CCTTGTCCCATTTCAAAGATAGG + Intergenic
1168419825 19:56194223-56194245 CCTTATCTCATTCCATAAAATGG + Intronic
927251917 2:21003525-21003547 CTTTATCACATGCCCCAGAAAGG + Intronic
928676303 2:33654918-33654940 CTTTTCCCCATTTCTAAGAATGG - Intergenic
932006246 2:67929997-67930019 CTTTATTCCTTTCAAAAGCATGG - Intergenic
932994016 2:76826669-76826691 CTTTGTGCCATTCAGAAGAAAGG + Intronic
936618376 2:114071217-114071239 CATTATCCAACTCCAAGGAATGG + Intergenic
936625108 2:114140509-114140531 CTTAATCCCATTCGTAAGAGAGG + Intergenic
937080350 2:119135902-119135924 CTTTCTCCCACCCCACAGAAAGG - Intergenic
937268923 2:120634757-120634779 CCTTAGCCCATCCCAAAGACTGG - Intergenic
937296746 2:120814063-120814085 GGTTATCCCATCCCAGAGAAAGG + Intronic
939302804 2:140368125-140368147 CTTTATGCCATTTCAAAATAAGG - Intronic
939546622 2:143562520-143562542 CTTTATTCCATTCCACAGGGTGG + Intronic
939683451 2:145168192-145168214 CTTTAGGGCATTCTAAAGAAAGG + Intergenic
941080326 2:161053383-161053405 ATTTATACCATCACAAAGAAAGG + Intergenic
941592661 2:167439000-167439022 CTTTATCCAAGGACAAAGAAAGG + Intergenic
941812685 2:169769328-169769350 CTTTATCCCATTCCTCTTAAAGG + Intronic
942439661 2:176019502-176019524 CTTTATCCCATGCCTTAGATTGG - Intergenic
942959017 2:181807384-181807406 CTTTATCCCATTCTTTAGAATGG + Intergenic
942959021 2:181807391-181807413 TTCCATCCCATTCTAAAGAATGG - Intergenic
943663238 2:190581304-190581326 TTTTTTTCCATTCCAAATAATGG - Intergenic
944384900 2:199153171-199153193 CATTTCCCCACTCCAAAGAAAGG - Intergenic
945342444 2:208673039-208673061 TTTTATCCTATTCCAAAGCTGGG - Intronic
945363073 2:208915395-208915417 CTTCATCAAATTCCAAAGCATGG - Intergenic
946357500 2:219197435-219197457 ATATAGCACATTCCAAAGAATGG - Intronic
946558112 2:220882016-220882038 CCTAATCCCATTCATAAGAAAGG - Intergenic
948113903 2:235479593-235479615 CTTTTTCCCTTTTCAAATAAGGG - Intergenic
948149693 2:235735298-235735320 AATTTTCCCATTCCAAAAAAAGG - Intronic
1169025475 20:2367101-2367123 ATTTATACCATTCCAAAAAATGG - Intergenic
1169270059 20:4192354-4192376 CATTCTCCCATTCCAAAACATGG + Intergenic
1170389885 20:15860693-15860715 CTTTATTCCTTTAGAAAGAAAGG - Intronic
1171155082 20:22864624-22864646 GTTTATCCCACTTCAAAGCAAGG - Intergenic
1173786704 20:45799003-45799025 CTTTGTCCCTTTCCAGTGAAGGG - Intronic
1174233489 20:49067502-49067524 TTTTATAACATTCCTAAGAAAGG - Intronic
1175146818 20:56903268-56903290 TTTTATTCCATTCAAGAGAATGG + Intergenic
1177831384 21:26142963-26142985 CTTTATTCCATGTCAAAGATAGG + Intronic
1178084390 21:29098201-29098223 GCTTATTTCATTCCAAAGAAAGG - Intronic
951303237 3:21024382-21024404 GCTTTTCCCATTCTAAAGAATGG - Intergenic
952309567 3:32176120-32176142 CTTTGTCCCCTTGCAGAGAAAGG - Intergenic
955402179 3:58600168-58600190 CTTTTCCCCTTTCCAAAAAAGGG - Intronic
955783074 3:62506800-62506822 CTGTATACAATTCCAGAGAAGGG - Intronic
955784237 3:62519527-62519549 CTTCATACTCTTCCAAAGAAAGG + Intronic
955914851 3:63896661-63896683 TTTTTTCCCATACTAAAGAAAGG + Intronic
956717178 3:72088641-72088663 CTTCATCCCGTGCCAAAGGAGGG + Intergenic
959865697 3:111267567-111267589 CTCTATCTCATTCCAAAGCCTGG + Intronic
960411947 3:117337843-117337865 CATTAAACCATTCCAAGGAAGGG + Intergenic
961989989 3:131179050-131179072 CTTAATCCCATTCATAAGGAGGG - Intronic
964066341 3:152584407-152584429 CTTTGTCTTATTCCAAAGACTGG + Intergenic
965372148 3:167876595-167876617 CTTTATCCCATTCCCAGAACAGG + Intergenic
965926086 3:173982195-173982217 ATTTATACCAAACCAAAGAAAGG - Intronic
967630776 3:191741223-191741245 CTTTCTACCTTTCCAGAGAAAGG + Intergenic
968598341 4:1496765-1496787 CTTCATACCATTCCCTAGAATGG + Intergenic
969914069 4:10472738-10472760 CTTTATTCCAGTCAATAGAATGG + Intergenic
971026231 4:22590794-22590816 ATTTTTTCAATTCCAAAGAATGG - Intergenic
972894176 4:43598439-43598461 CCATATCCCATTCCTAGGAAGGG - Intergenic
972968454 4:44542370-44542392 CTTGATCCCATTCACAAGAGAGG + Intergenic
974231139 4:59115443-59115465 CTTTATAGCATTCCTAAGCAAGG - Intergenic
975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG + Exonic
975997543 4:80333720-80333742 CTTTGTCCTTTTGCAAAGAATGG + Intronic
979414457 4:120418793-120418815 CTTTATAACATTGCAATGAAAGG + Intergenic
982688783 4:158525135-158525157 ATTTATCCAATTCCAAAAGATGG + Intronic
984158153 4:176217691-176217713 CTTTATCCCAGTGCAAAGCCTGG + Intronic
984807520 4:183765392-183765414 CTTCAGCACATTTCAAAGAATGG - Intergenic
986176305 5:5354838-5354860 CTTTATCCTATTCTAAACATTGG + Intergenic
987082662 5:14439499-14439521 CTTTGTCCCTTTCCAAAATACGG - Intronic
987758390 5:22126411-22126433 CTTTATCTCAAACCGAAGAAAGG - Intronic
988377613 5:30457328-30457350 CTTTATCACATTGGAAACAAAGG - Intergenic
988813965 5:34813546-34813568 AGTTATCACAGTCCAAAGAATGG - Intronic
988816311 5:34838555-34838577 CTGTATTCCATGCCAACGAAAGG + Intergenic
989040595 5:37223925-37223947 CTTTATCACAAATCAAAGAAAGG + Intronic
991604793 5:68390350-68390372 AATTATCCCTTTCCAAGGAAGGG + Intergenic
992351475 5:75933474-75933496 ATTTCTCCCCTTCCTAAGAAAGG + Intergenic
994626590 5:102228110-102228132 CATTATCAAAGTCCAAAGAAGGG - Intergenic
995973665 5:118004506-118004528 CTGTAGACCATTTCAAAGAATGG + Intergenic
997047202 5:130332277-130332299 CTTTATCCAATTCCAAATGCAGG - Intergenic
998485853 5:142501547-142501569 CTTTATGCCATGACAAATAATGG + Intergenic
998497852 5:142606260-142606282 TTTAATCCCCTTTCAAAGAAAGG + Intronic
998554198 5:143107106-143107128 CTTTATCCCAGTGCCCAGAAGGG + Intronic
1000043252 5:157500909-157500931 CTTGACCCCATTCCACAGACAGG + Intronic
1000187110 5:158869850-158869872 CTCTTTCTCATTCAAAAGAAAGG - Intronic
1000836495 5:166161173-166161195 TTTAATCCCATTTCAAAGACAGG - Intergenic
1004942980 6:20580677-20580699 CTTTAACCCATAGCTAAGAAAGG - Intronic
1007749532 6:44063394-44063416 CTGCATCCCATTCCCAAGGAGGG + Intergenic
1008579781 6:52896400-52896422 CTTTATGCCATTACCCAGAATGG + Intronic
1008922394 6:56856103-56856125 CTTTATACCATGCGAATGAATGG - Intronic
1011450424 6:87486002-87486024 CTTTATCACAGTGTAAAGAATGG - Intronic
1013415180 6:109918358-109918380 AATTATTCCATTCTAAAGAAAGG - Intergenic
1013435050 6:110095548-110095570 GTTTATACCATTCCAGATAAAGG - Intergenic
1015382735 6:132588513-132588535 CTTTATCCCTTTCCAAGTTAAGG + Intergenic
1017199666 6:151739088-151739110 CTTTATCTTATTCATAAGAAGGG + Intronic
1021054186 7:16026789-16026811 CTTTACCACATTCCCAAGGACGG + Intergenic
1021812249 7:24414477-24414499 CTTTTTCCCCTTTCAAAGGAGGG - Intergenic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1024453948 7:49581283-49581305 CTCAATGCCATTCCAAAGAATGG - Intergenic
1025158170 7:56629231-56629253 CTGTATTCCATTCCACAGAATGG + Intergenic
1026782602 7:73279664-73279686 CTTTAGTCCTTTCCAAAGGAAGG - Intergenic
1027023365 7:74832489-74832511 CTTTAGTCCTTTCCAAAGGAAGG - Intronic
1027064567 7:75112829-75112851 CTTTAGTCCTTTCCAAAGGAAGG + Intronic
1028870558 7:95767064-95767086 CTTTATCCCAATCCAGATCAAGG + Intergenic
1028958165 7:96717402-96717424 TTTTTTCCCATTCCATAGATTGG + Intergenic
1031209596 7:118805657-118805679 CCCTACCGCATTCCAAAGAAAGG - Intergenic
1031890027 7:127283178-127283200 ATATATCCCATGCCATAGAAAGG - Intergenic
1033203792 7:139398583-139398605 CTTTTTTCCCTTCCAGAGAATGG + Exonic
1033669680 7:143478970-143478992 CTTTATAACATTCCAAAGAAGGG - Intergenic
1037918185 8:22785456-22785478 CCTTACCCCATTCCAGAGATAGG - Intronic
1038534142 8:28342028-28342050 CTTTATCCCATTCCAGTGTAAGG - Intronic
1039257322 8:35733779-35733801 CTTTAACCCAATCCTTAGAATGG - Intronic
1039319735 8:36414968-36414990 TTTTATCCAATTCCTAAGGAGGG - Intergenic
1039743636 8:40404522-40404544 CTTTTTCCCATTGCAAACATTGG - Intergenic
1040414603 8:47185045-47185067 CTTTTTCCCAATACAAACAAAGG + Intergenic
1041218616 8:55626699-55626721 CTTTGCCCCATTCCAGAGATTGG + Intergenic
1043871991 8:85443347-85443369 CTTTATTCTTTTCCAAAGATAGG + Intronic
1045740017 8:105346753-105346775 CCTTAACCCATTCCAAATATTGG - Intronic
1045825982 8:106398697-106398719 CTTGAACACATTCCCAAGAAGGG - Intronic
1046417025 8:113930549-113930571 CTTTATCACATTTTAAAAAAAGG + Intergenic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1048617438 8:136092756-136092778 AGATATCCCATTCCAATGAAAGG + Intergenic
1049193649 8:141303580-141303602 ATTTTTCCTATTTCAAAGAAAGG - Intronic
1050757030 9:9017253-9017275 CTTTATGCCAATGAAAAGAAAGG + Intronic
1050874398 9:10616170-10616192 CTTTATTCCATTCCACACTATGG - Intergenic
1051039469 9:12789399-12789421 TTTTATCCTATTTCATAGAAGGG + Intronic
1051147940 9:14048929-14048951 TTTTCTCCCATTCCAAACAATGG + Intergenic
1052283244 9:26756291-26756313 CTTAATCCCATTCCTGAGAGAGG + Intergenic
1056911907 9:90708631-90708653 CTTTACCCCAGCCCAAAGCAAGG + Intergenic
1057293647 9:93822941-93822963 CTGGATCCCATTCCCAAGGATGG + Intergenic
1058783596 9:108364281-108364303 CTTTATCACATTGCATAGCAAGG + Intergenic
1059276710 9:113103889-113103911 TTTTATCCCATTAAAAATAAAGG + Intergenic
1060888498 9:127173202-127173224 CTGTATCCCATTCCAGAAAGAGG + Intronic
1062564511 9:137158209-137158231 CCTTGTCCCAGTCCCAAGAACGG - Intronic
1188177474 X:27009632-27009654 CTTTATCAAATCCCAAAGCATGG - Intergenic
1189192668 X:39123883-39123905 ATTTATCCTAGTCCAATGAATGG + Intergenic
1189364353 X:40376817-40376839 GTATAACCCCTTCCAAAGAAGGG - Intergenic
1191097600 X:56689886-56689908 CTTTATTCCAGTCGAAAGAGTGG - Intergenic
1194936872 X:99960820-99960842 CTTCAACCCCCTCCAAAGAAGGG + Intergenic
1196509436 X:116489825-116489847 CTAAATCCCCTTCTAAAGAAGGG - Intergenic
1197866891 X:131028561-131028583 CTTTATCCCATACCCAAGCCAGG - Intergenic
1198753366 X:139957590-139957612 AAATATCCCATTCCAAAGACTGG - Intronic
1199432143 X:147773646-147773668 CTTTGTCCCAGTGCATAGAATGG + Intergenic
1201850422 Y:18473840-18473862 CATTATCCCATTCAAAAGCCTGG - Intergenic
1201882896 Y:18846537-18846559 CATTATCCCATTCAAAAGCCTGG + Intergenic