ID: 975922444

View in Genome Browser
Species Human (GRCh38)
Location 4:79408237-79408259
Sequence TTCCCAGGCCACGGCGGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975922436_975922444 17 Left 975922436 4:79408197-79408219 CCATGACACCAGTAGGTCGGCTC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 112
975922437_975922444 9 Left 975922437 4:79408205-79408227 CCAGTAGGTCGGCTCAGCAGCTC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG 0: 1
1: 0
2: 0
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975922444 Original CRISPR TTCCCAGGCCACGGCGGTGT TGG Exonic
901703724 1:11059066-11059088 TTCCGAGGCCGCGTCAGTGTCGG + Intronic
905328009 1:37171618-37171640 TGCCCATCCCACGGGGGTGTGGG + Intergenic
905660713 1:39721901-39721923 TTGCCAGGCCAGGCCAGTGTGGG + Intronic
905816243 1:40953162-40953184 TGCACAGGCCACTGCGGAGTGGG + Intergenic
907411754 1:54288179-54288201 TCCCCAGGCCCAGGCGGTGGTGG - Intronic
911508487 1:98783863-98783885 ATGCCAGGCCCCGGTGGTGTGGG - Intergenic
916963392 1:169911316-169911338 TTCTCAGGCCACTGCACTGTGGG - Intergenic
921045618 1:211475617-211475639 TTCGGAGGCCATGGCGGGGTGGG - Intergenic
921606819 1:217165602-217165624 TGCCCAGGCCAGGGATGTGTTGG + Intergenic
921728283 1:218548661-218548683 TTTTCAGGCCACTGCCGTGTGGG + Intergenic
1063024618 10:2165697-2165719 ATCCCAGGCCTCGGAGGTGCTGG + Intergenic
1063372889 10:5533249-5533271 AAGCCAGGCCAAGGCGGTGTCGG + Intergenic
1064626969 10:17271355-17271377 ATCCAAGGCCAAGGCGGTGGTGG + Intergenic
1069078467 10:64063396-64063418 TTCCCAGGGCACTTCTGTGTGGG + Intergenic
1069873130 10:71545246-71545268 CTCCCAGGCCACGGCAGGGGAGG + Intronic
1069973140 10:72190465-72190487 TTCCAAGGCCACGGCTCTTTCGG - Intronic
1074599718 10:114901233-114901255 TTCCAAGGCCACGGCTCTTTTGG - Intergenic
1080628341 11:34051555-34051577 TCCCCCGGCCCCGGCGCTGTGGG - Intergenic
1081664101 11:44906497-44906519 TTCCCAGGCCTCTGCTGGGTGGG + Intronic
1084153127 11:67300414-67300436 CTCCCAGGCCACGTCGCTGGGGG - Intronic
1084435461 11:69136773-69136795 GTCCCAGGGCAGGGCCGTGTCGG - Intergenic
1084666557 11:70579532-70579554 CTCCCAGGCCTGGGCGGTGATGG + Intronic
1090647429 11:128777142-128777164 TTCTCAGGCCAAGGCGGGGAAGG + Intronic
1091222774 11:133939031-133939053 TTCTCAGGGCAGGGCTGTGTGGG - Intronic
1091743684 12:2977406-2977428 TTCCCAGGCTAAGGAGATGTTGG - Intronic
1091978892 12:4849991-4850013 TGCCCAGGCCACGGCAGAGGCGG + Intronic
1092727683 12:11500722-11500744 TTCCTGGGCCCCGGCGGTGGCGG - Intronic
1097679366 12:62634150-62634172 TTCCCAGGTCACGGAGGAGGAGG - Intergenic
1098461930 12:70741792-70741814 TTCCCAGGGCTCAGCGGTGAAGG - Intronic
1101354740 12:103966214-103966236 TTCCCTGGCTGCGGCGGTGGTGG + Intronic
1102971149 12:117167839-117167861 TTCCCAGCCCAAGGCTGTGATGG - Intronic
1113255187 13:108497743-108497765 TTCTCAGGCCAGGGGGGTGGAGG - Intergenic
1118818204 14:69327462-69327484 TTCCCAAGCCACTGGGCTGTAGG + Intronic
1121551047 14:94800937-94800959 TTCCAAGGCCACGGCTCTTTCGG + Intergenic
1123002624 14:105304076-105304098 CTCCCAGGCCACAGCGGTGCAGG + Exonic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1132538550 16:496156-496178 TTCCCAGGCCCCAGGGGTGAGGG + Intronic
1134410558 16:14000274-14000296 TTCCCAGCCCCCGGCGGGGGAGG + Intergenic
1141649552 16:85385740-85385762 TTCCGAGGCCTCGGCGGTAATGG + Intergenic
1142637056 17:1264267-1264289 TTCCAGGTCCAGGGCGGTGTGGG - Intergenic
1142712038 17:1728632-1728654 TTCCCAGGTCTGGGAGGTGTTGG + Intronic
1146062311 17:29613760-29613782 TTCCCAGGCCAGGGCCCTGGAGG + Exonic
1146652117 17:34613416-34613438 TTCCCAGGCCAGGGCTGTGCAGG + Intronic
1150272607 17:63876390-63876412 ATCCTAGGCCACAGGGGTGTGGG - Intronic
1150273948 17:63884139-63884161 ATCCTAGGCCACAGGGGTGTGGG - Intergenic
1150276106 17:63898938-63898960 ATCCTAGGCCACAGGGGTGTGGG - Intergenic
1150278256 17:63913667-63913689 ATCCTAGGCCACAGGGGTGTGGG - Intronic
1151503702 17:74512146-74512168 CTGCCAGGCCATGGAGGTGTTGG - Intergenic
1151999806 17:77638071-77638093 TTCCCACCCCAAGGCTGTGTCGG - Intergenic
1152610892 17:81314566-81314588 CTCCCAGGCCACCCCGGTGCTGG - Intronic
1152615186 17:81334590-81334612 TTCCCAGGCCACAGCCCTGGGGG - Intergenic
1152888617 17:82867160-82867182 ACCCCAGGCCACGGAGGTGCTGG - Intronic
1154451003 18:14474833-14474855 ATTCCAGGGCACGGCGGAGTGGG - Intergenic
1154980686 18:21500110-21500132 CACCCAGGCCACGTCGGCGTGGG - Exonic
1156507845 18:37609802-37609824 TTTCCAGGCCACGGCAGCCTCGG - Intergenic
1159576792 18:70188640-70188662 TTCCCAGGCAACTCCTGTGTGGG - Intronic
1161048848 19:2151453-2151475 CTCCCAGGCCAGGGCGGCGGCGG + Exonic
1161709764 19:5841468-5841490 TTCCCTGGCCAGGGCTGGGTGGG + Intergenic
1162351033 19:10149641-10149663 TTCCAGGGTCACGGCGCTGTGGG - Exonic
1166161122 19:40954156-40954178 TTCCCAGGCCAAGCTGGTGTGGG + Intergenic
1167459052 19:49614799-49614821 GGCCCAGGGCACGGGGGTGTTGG + Intronic
1167590621 19:50402545-50402567 TTCCCAGGGCAGGGCTGGGTGGG + Intronic
926062668 2:9813888-9813910 TTCCCAGGCCATGGCAGTGCTGG - Intergenic
931753488 2:65351098-65351120 TTCCCTGGCCACTGAGGAGTGGG + Intronic
938056038 2:128215430-128215452 TTCCATGGCCAGGGCGGGGTGGG - Intergenic
940530766 2:154873581-154873603 GTCCAAGGCCTCGGCGGTTTTGG - Intergenic
942491080 2:176490399-176490421 TCCCCAGGCAACGGCTGCGTTGG - Intergenic
947384271 2:229575636-229575658 TTCCCAGGCTGCGGTGGTGTTGG - Intronic
1172275018 20:33674545-33674567 TTCCGCGGCCACGGCGGAGGGGG + Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1174307858 20:49627298-49627320 TCCCCAGGCCATGGAGTTGTTGG + Intergenic
1176021978 20:62966709-62966731 TGCCAAGGCCCCGGCTGTGTTGG - Exonic
1176241599 20:64078178-64078200 TGCCCAGGCCTCGGGGGTATTGG - Intronic
1176256077 20:64153990-64154012 TTCCCAGGCCAGAGCAGCGTGGG - Intronic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1180693837 22:17739550-17739572 TTCCCGGGGCAGGGTGGTGTGGG - Intronic
1181582095 22:23834158-23834180 TTACCAGGCCGGGGCCGTGTTGG - Exonic
1184369720 22:44074736-44074758 GTCCCAGGCCAGGCCAGTGTGGG + Intronic
951555808 3:23919390-23919412 TTCCAAGGCCACGGCTCTTTCGG - Exonic
967019357 3:185508862-185508884 TTCCCAGGCCTCAGCTGTGTCGG - Exonic
968066995 3:195764243-195764265 TTGGCAGGGCAGGGCGGTGTTGG + Intronic
968067003 3:195764274-195764296 TTGGCAGGGCAGGGCGGTGTTGG + Intronic
968067011 3:195764305-195764327 TTGGCAGGGCAGGGCGGTGTTGG + Intronic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
969099553 4:4758567-4758589 TTCCCAGGCCATGGGGATGATGG + Intergenic
971255563 4:25010567-25010589 TTCCTAGACCACGGCAGAGTTGG + Intronic
973219250 4:47706876-47706898 TTCCAAGGCCACGGCTCTTTCGG - Intronic
975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG + Exonic
976303507 4:83536791-83536813 TTCTCAGCCCGCAGCGGTGTGGG - Intronic
977995908 4:103497145-103497167 TTCCCAGGTCAAGGCTGGGTAGG + Intergenic
978727140 4:111982834-111982856 TTCTCAGGCTACGGTGGGGTAGG - Intergenic
979828178 4:125266087-125266109 TGCACAGGCAACGGCGGTGGTGG + Intergenic
980863105 4:138522314-138522336 TTCTCAGGCCAGGGCAGAGTAGG + Intergenic
984827910 4:183944248-183944270 TTCCCAGGACATGGAGGAGTAGG - Intronic
985822599 5:2170264-2170286 TTCCCAAGCCAGGGCGGCTTGGG + Intergenic
987696010 5:21333253-21333275 TTCCCAGTCCACAGTGGTGAAGG + Intergenic
988679868 5:33474463-33474485 TTCTCAGGCCACTGAGGTGGGGG + Intergenic
988756191 5:34253358-34253380 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
991744387 5:69718844-69718866 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
991753318 5:69836389-69836411 TTCCCAGTCCACAGCGGTGAAGG + Intergenic
991795959 5:70298568-70298590 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
991802935 5:70393116-70393138 TTCCCAGTCCACAGCGGTGAAGG + Intergenic
991823768 5:70594158-70594180 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
991832638 5:70711508-70711530 TTCCCAGTCCACAGCGGTGAAGG + Intergenic
991888336 5:71298128-71298150 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
992642528 5:78780411-78780433 TCCCAAGGCCACTGGGGTGTGGG - Exonic
993292120 5:86087018-86087040 CTCACAGGCCAGGGCGGTGGCGG - Intergenic
1004092157 6:12514613-12514635 TTCCAAGGCCACGGCTCTTTCGG - Intergenic
1005554776 6:26964802-26964824 TTCCCAGTCCACAGCGGTGAAGG - Intergenic
1007473473 6:42105071-42105093 TTCCCAGGCCACAGGGGCCTGGG + Exonic
1018821320 6:167375993-167376015 TTCCCAGGCCACCACGCTGCAGG - Exonic
1019315456 7:382040-382062 TTCCTAGGCCACCGCCCTGTAGG - Intergenic
1019485498 7:1287506-1287528 TCTCCAGGCCAGGGAGGTGTGGG + Intergenic
1019629469 7:2040401-2040423 TTCCCAGGTCTCATCGGTGTCGG + Intronic
1025875784 7:65478689-65478711 TTCCCAGGCCTCTGTGGTGGGGG + Intergenic
1036659117 8:10696363-10696385 TACCCAGGCCACTGCTGTGCTGG - Intronic
1038310245 8:26440934-26440956 CTGCCAGGCCACTGCGGTGAGGG - Intronic
1039614713 8:38946267-38946289 TTCCCAGGCTATGGCCTTGTTGG + Intronic
1039820441 8:41129734-41129756 GACCCAGGCCATGGTGGTGTGGG - Intergenic
1040513637 8:48117085-48117107 TTCCAAGGACACTGCTGTGTAGG + Intergenic
1042137263 8:65644493-65644515 TTCCCAGGACAGGACGGTGAAGG + Intergenic
1048998225 8:139807245-139807267 TGCCAAGGCCACAGCGGTGCAGG + Intronic
1049417743 8:142503259-142503281 TTCCGAGGTCATGGCGGTCTGGG + Intronic
1052799567 9:32955686-32955708 CGCCCAGGCCAGGGCAGTGTGGG - Intergenic
1062218079 9:135399843-135399865 TTCCCAGCCCACAGTGGTGCAGG - Intergenic
1190221338 X:48514303-48514325 TTCCGAGGCCACGGCCACGTTGG + Exonic
1193790232 X:85808246-85808268 TTCCCTTGCCACTGCGGTGGTGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic