ID: 975922448

View in Genome Browser
Species Human (GRCh38)
Location 4:79408240-79408262
Sequence CCCCCAACACCGCCGTGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975922448_975922456 13 Left 975922448 4:79408240-79408262 CCAGGCCACGGCGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 127
Right 975922456 4:79408276-79408298 CAGTCAGGAGCACAAGGCGCAGG 0: 1
1: 0
2: 2
3: 12
4: 149
975922448_975922453 -2 Left 975922448 4:79408240-79408262 CCAGGCCACGGCGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 127
Right 975922453 4:79408261-79408283 GGCAGGGAGCGCAGCCAGTCAGG 0: 1
1: 0
2: 3
3: 23
4: 270
975922448_975922454 7 Left 975922448 4:79408240-79408262 CCAGGCCACGGCGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 127
Right 975922454 4:79408270-79408292 CGCAGCCAGTCAGGAGCACAAGG 0: 1
1: 0
2: 4
3: 18
4: 238
975922448_975922457 20 Left 975922448 4:79408240-79408262 CCAGGCCACGGCGGTGTTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 127
Right 975922457 4:79408283-79408305 GAGCACAAGGCGCAGGCGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975922448 Original CRISPR CCCCCAACACCGCCGTGGCC TGG (reversed) Exonic
900561205 1:3307928-3307950 CCCCCAAGACTGCCTTTGCCAGG + Intronic
901815123 1:11789388-11789410 CCCCCAACCCCGCGGTGCTCTGG - Exonic
905132137 1:35769452-35769474 CCCCCCGCACCGCTGCGGCCGGG + Intronic
906284860 1:44580626-44580648 GCCCAAACACCTCCGAGGCCAGG - Intronic
907410633 1:54281135-54281157 CCCCCACCACCTCCCTGGCCAGG + Intronic
912993243 1:114510169-114510191 CCCTCAACACCTCGCTGGCCCGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922826930 1:228528146-228528168 CCCCCAGCACCACTGTGCCCAGG - Intergenic
924606909 1:245543007-245543029 ACCCCAATACCGCCCTGTCCAGG + Intronic
1063372891 10:5533252-5533274 CACCCGACACCGCCTTGGCCTGG - Intergenic
1066337055 10:34488670-34488692 AGCCCAGCACCGCTGTGGCCGGG + Intronic
1069873134 10:71545249-71545271 CCCCCTCCCCTGCCGTGGCCTGG - Intronic
1071598130 10:86942696-86942718 CCGCCACCACCGCCCTGGCCGGG - Exonic
1074814610 10:117134726-117134748 CCCCCAGCAGCGCCCCGGCCCGG - Intronic
1075438377 10:122461376-122461398 CCGCCAGCACCGCCGTGCCCGGG + Intergenic
1076675616 10:132146142-132146164 CCCCCACCCCCACCCTGGCCCGG + Intronic
1077093843 11:791126-791148 CCCCCCTTCCCGCCGTGGCCAGG - Exonic
1080628337 11:34051552-34051574 CGCCCCACAGCGCCGGGGCCGGG + Intergenic
1082847936 11:57741425-57741447 CCCGCAGCACCCACGTGGCCTGG - Intronic
1083758373 11:64803134-64803156 CCCGCAGCAGCGCCATGGCCCGG + Exonic
1084185432 11:67468705-67468727 CCCCCAACCCAGCGGGGGCCAGG + Intronic
1096472607 12:51888865-51888887 CCCACCACACCGTCCTGGCCTGG + Intronic
1101354742 12:103966217-103966239 CCACCACCACCGCCGCAGCCAGG - Intronic
1101371885 12:104138028-104138050 CCGCCAACGCCGCCGCGGCCGGG - Intronic
1103010757 12:117456541-117456563 TCCCCAACACAGCCCTGCCCAGG - Exonic
1103964776 12:124631881-124631903 GCCCCCACACCGCCCTGGGCTGG + Intergenic
1104601423 12:130156414-130156436 CCCCCAGTAGCCCCGTGGCCTGG + Intergenic
1104841473 12:131828083-131828105 CCCCCCACGGCGCCGAGGCCCGG - Intergenic
1104880724 12:132068654-132068676 CCACCAGCTCCGCCGTGGCCGGG + Intronic
1104929427 12:132329931-132329953 CCGGCGACACCGCCCTGGCCAGG - Intergenic
1106512390 13:30422372-30422394 CCACCACCGCCGCCGCGGCCAGG - Intergenic
1108484320 13:50909610-50909632 CCCGCCACACCCCCGGGGCCGGG - Intergenic
1113085707 13:106567719-106567741 CCACCAACACGGCCGTGTCCCGG - Exonic
1113931468 13:113971186-113971208 CCCACAACACCCCCTTGGCCCGG + Intergenic
1122402833 14:101477368-101477390 CCCCCTACTCCGCCCTGGTCAGG + Intergenic
1122418538 14:101561505-101561527 CCACCAACCGCGACGTGGCCTGG - Exonic
1122632442 14:103113119-103113141 CCCCCAGTGCCACCGTGGCCTGG + Intergenic
1126134637 15:45378444-45378466 CCCGCAGCATCGCCCTGGCCCGG + Exonic
1127788950 15:62381182-62381204 CCACCAACACCCCAGTGGCTGGG + Intergenic
1129458371 15:75687707-75687729 CCTCCAGCAGCGCAGTGGCCTGG + Exonic
1130148703 15:81294613-81294635 CCCCCAACAGCACCGTCTCCTGG + Intronic
1132398301 15:101489781-101489803 CCGCCAACACCGCCGCGGGCGGG + Exonic
1132886511 16:2184666-2184688 CCCCCGACCCCGCCGCTGCCAGG + Intronic
1132934929 16:2475311-2475333 CCCCCAACCCGCGCGTGGCCGGG - Intronic
1134828693 16:17305866-17305888 CCCCTGACACCGCCGTGGTGGGG + Intronic
1137618199 16:49858852-49858874 CCCCCACCCCCGCCGGCGCCTGG + Intergenic
1140135933 16:72205521-72205543 ACCCCAACACAGCCCAGGCCTGG + Intergenic
1141957718 16:87383669-87383691 CCGCCAGCAGCGCCGGGGCCCGG - Exonic
1146005025 17:29155593-29155615 CCCGCAACACCTTCGGGGCCTGG - Intronic
1148082982 17:44977688-44977710 CCTCCATCCCCGCCCTGGCCAGG - Intergenic
1149772385 17:59331927-59331949 CCCCCAACCCCGCGCAGGCCCGG - Intronic
1151503701 17:74512143-74512165 CTGCCAACACCTCCATGGCCTGG + Intergenic
1151719562 17:75847537-75847559 CCCCCACCACCGCCCTACCCTGG - Exonic
1151938937 17:77281146-77281168 CCCCCACCCCCGGCCTGGCCTGG + Intronic
1152237766 17:79147442-79147464 CCCCCAACCCCTCCGGAGCCTGG + Intronic
1152610888 17:81314563-81314585 CCCCCAGCACCGGGGTGGCCTGG + Intronic
1152641982 17:81453059-81453081 CTCCCAGCACCACCCTGGCCCGG + Intronic
1152781429 17:82228863-82228885 CCCGCAACCCCGCCGGGCCCAGG - Intronic
1152888612 17:82867157-82867179 CCCCCAGCACCTCCGTGGCCTGG + Intronic
1152900230 17:82936951-82936973 TCCCCAACACAGCGGCGGCCAGG - Intronic
1154451000 18:14474830-14474852 TCCCCCACTCCGCCGTGCCCTGG + Intergenic
1160356585 18:78232360-78232382 CCTCCAATACGGCCCTGGCCAGG + Intergenic
1160497811 18:79385383-79385405 CCGGCCACACCGCCGGGGCCAGG + Intergenic
1160734450 19:655870-655892 CCCTCCCCCCCGCCGTGGCCTGG - Intronic
1160821733 19:1062159-1062181 CCCCCATCCCCAGCGTGGCCCGG + Exonic
1162716863 19:12639836-12639858 CCCCCTACACAGCTGGGGCCAGG - Intronic
1163529942 19:17843157-17843179 CCCCCAGCACCGCAGTGACCTGG - Exonic
1165071962 19:33260970-33260992 CCCCCAGCAGCCCGGTGGCCAGG - Intergenic
1166361864 19:42255820-42255842 CCCCCACCACCACCGTCCCCAGG + Intergenic
1166932994 19:46312582-46312604 CCCCTGACACCACTGTGGCCTGG - Exonic
1167146031 19:47681159-47681181 CCCCCAGCCCAGCCCTGGCCTGG + Exonic
1167792611 19:51690890-51690912 CCCCCCACACCAACCTGGCCCGG - Intergenic
1168010180 19:53523917-53523939 CCCCCAACTCCGACGGGCCCTGG + Intronic
925000765 2:401153-401175 CCCCTACCTCCGACGTGGCCTGG - Intergenic
925350138 2:3195273-3195295 TCCCCAGCACTGCCGTGGGCGGG + Intronic
926052127 2:9752012-9752034 CCGCCTCCACTGCCGTGGCCCGG + Intergenic
926062664 2:9813885-9813907 GCCCCAGCACTGCCATGGCCTGG + Intergenic
927156470 2:20224240-20224262 CCCCCCACGCAGCCCTGGCCCGG + Intronic
927542791 2:23927402-23927424 CCACCGTCACCCCCGTGGCCTGG + Intronic
931387318 2:61809283-61809305 CCGTCAACACTGCAGTGGCCTGG + Intergenic
931693808 2:64857752-64857774 TCACCAACACCTCAGTGGCCAGG - Intergenic
937284105 2:120739063-120739085 CCCCCAAGACCCCCGCAGCCAGG - Intronic
943820591 2:192315402-192315424 ACCCCAACACTTCCGTGGCTGGG - Intergenic
944293968 2:198040974-198040996 CCCCCAACCCCCCATTGGCCAGG - Intronic
1168802672 20:653297-653319 CCCCCGACCCCGCCGCGGTCCGG + Exonic
1171411754 20:24952598-24952620 CCCCCAACACCCCAGTGCTCAGG + Intronic
1174354081 20:49987020-49987042 TTCCCAACACAGCCTTGGCCAGG + Intronic
1176062846 20:63179775-63179797 CCCCCACCACCGCCGCTGCAGGG + Intergenic
1176097202 20:63349624-63349646 CGCCCAACACAGCCATGGGCGGG + Intronic
1176241595 20:64078175-64078197 CCCCCAATACCCCCGAGGCCTGG + Intronic
1181496265 22:23288963-23288985 CCCCCAATGCCACCGTGGCCTGG + Intronic
1181694973 22:24588481-24588503 CCCCCAACCCGGCTGTGGCCTGG + Intronic
1182708569 22:32305992-32306014 CCCCTAACACCACCTTGGCTGGG + Intergenic
1183584133 22:38742404-38742426 CCACCACCACCTCCCTGGCCAGG + Exonic
1184640409 22:45867330-45867352 CCCCCAGCACCTCCGCCGCCCGG + Intergenic
1185322603 22:50208904-50208926 CCCCCAACACCACGGAGCCCAGG - Intronic
950065493 3:10108336-10108358 CCCCCATCCCCGCCGCGGCTCGG - Intergenic
953404872 3:42655081-42655103 CCTCCCACACCCCCTTGGCCCGG - Intronic
953627149 3:44580515-44580537 CCCCCCACACCGCAGGAGCCTGG - Intronic
953848206 3:46445342-46445364 CCTGCCACACCGCCGTGGACAGG - Exonic
961665248 3:128490186-128490208 CCTCCACTACCGCAGTGGCCGGG - Intronic
968477424 4:818598-818620 CCGTCCACACCGCCGAGGCCAGG + Intronic
968850619 4:3075129-3075151 CCGCCATCCCCGCCGTAGCCTGG - Intronic
969691577 4:8706906-8706928 CCTCCAGCCCCGCCGGGGCCCGG + Intergenic
975922448 4:79408240-79408262 CCCCCAACACCGCCGTGGCCTGG - Exonic
983679031 4:170330765-170330787 CCCCCACCACCACCATGGCCGGG - Intergenic
984734570 4:183098327-183098349 ACCGCAGCCCCGCCGTGGCCAGG - Intergenic
985873528 5:2577753-2577775 TCCCCAACACCGGCCTGGGCAGG - Intergenic
985924334 5:3004276-3004298 TCCCCAACATTGCTGTGGCCTGG - Intergenic
985936709 5:3103012-3103034 CCGGCAACACCCCTGTGGCCTGG - Intergenic
991565787 5:68003042-68003064 GCCCCGACACCCCCATGGCCTGG - Intergenic
999365418 5:151020641-151020663 GCCCCCACCCCGCCATGGCCCGG + Exonic
1001293838 5:170485257-170485279 CCCCCTACACAACCCTGGCCTGG + Intronic
1002498512 5:179632369-179632391 CCCCCTCCCCCGCCGCGGCCAGG + Intronic
1003640591 6:7871995-7872017 CCCCCACCACCCCCGCCGCCAGG - Intronic
1004660582 6:17706247-17706269 ACCCCGACGCCGCGGTGGCCTGG - Intronic
1010898203 6:81392385-81392407 CACCCAACACCGCCAAGGCTTGG - Intergenic
1018915099 6:168128237-168128259 CCCCCAGCACCGCCAAGGCCGGG - Intergenic
1019299302 7:295523-295545 CCCAGAAAGCCGCCGTGGCCTGG - Intergenic
1019485500 7:1287509-1287531 CTCCCCACACCTCCCTGGCCTGG - Intergenic
1019884802 7:3894433-3894455 CCCCCACCACCCCCGGAGCCTGG - Intronic
1021451398 7:20785954-20785976 CCCCCAACAGCCCCGGCGCCCGG + Intronic
1022183037 7:27940276-27940298 ACCACCACACCGCCGTGACCCGG - Intronic
1023990175 7:45124090-45124112 TCCCCACCACCCCCCTGGCCGGG - Intergenic
1028922339 7:96322037-96322059 CCCCCACCGCCGCCGCCGCCGGG - Exonic
1032724026 7:134574828-134574850 CCCCACACAACTCCGTGGCCGGG + Intronic
1033211017 7:139460260-139460282 CCACCAACAACGTCGGGGCCAGG - Intronic
1033250919 7:139758476-139758498 CTCCCCACCCCGCCCTGGCCCGG + Intronic
1035301823 7:157902305-157902327 CCGCCAACCCTGCAGTGGCCTGG + Intronic
1036659115 8:10696360-10696382 CCACCAGCACAGCAGTGGCCTGG + Intronic
1038310242 8:26440931-26440953 CCCCCCTCACCGCAGTGGCCTGG + Intronic
1039956925 8:42214896-42214918 CCCCAGACACAGCCATGGCCTGG - Intergenic
1040668533 8:49658921-49658943 CCCCCACCACAGCAGTGGCAGGG - Intergenic
1049597024 8:143489478-143489500 CCCCGCCCACCGCCCTGGCCAGG + Intronic
1049693752 8:143973738-143973760 CCGCCGACACCGCGGTCGCCCGG + Intronic
1052799563 9:32955683-32955705 GCCCCCACACTGCCCTGGCCTGG + Intergenic
1053011795 9:34637796-34637818 CCCCCGCCACCGCCGTGGTACGG + Intronic
1057245755 9:93452469-93452491 CCCCCAGCGCCGCCACGGCCGGG - Exonic
1060485748 9:124045377-124045399 CTCCCAACCCCTCCGGGGCCCGG - Intergenic
1062110782 9:134781000-134781022 CCCCGCAGGCCGCCGTGGCCAGG - Intronic
1062533520 9:137011780-137011802 CCCCCATCCCCGCCCTGCCCCGG - Intronic
1062640265 9:137515123-137515145 CCCCCACCACCGCCAGGGCTGGG - Intronic
1186660892 X:11666115-11666137 CCCCCCACCCCGCCCTGTCCCGG + Intergenic
1188003677 X:25003413-25003435 CCCACCCCACCTCCGTGGCCCGG + Intergenic
1192166701 X:68831183-68831205 CCCCCAGCCCCGCCCTGCCCCGG + Intronic
1195031165 X:100928966-100928988 CCCCCAAGACCGCCTGGCCCGGG + Intronic