ID: 975931394

View in Genome Browser
Species Human (GRCh38)
Location 4:79527922-79527944
Sequence TCTGAGATTTAGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975931394_975931396 -2 Left 975931394 4:79527922-79527944 CCTTCCACAGTCTAAATCTCAGA No data
Right 975931396 4:79527943-79527965 GAACTATCTAGTTACTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975931394 Original CRISPR TCTGAGATTTAGACTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr