ID: 975934105

View in Genome Browser
Species Human (GRCh38)
Location 4:79558732-79558754
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975934105_975934116 5 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934116 4:79558760-79558782 AGGGTGAAGGAGAAGGGGTTGGG 0: 101
1: 67
2: 22
3: 79
4: 880
975934105_975934112 -2 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934112 4:79558753-79558775 GCTGCTAAGGGTGAAGGAGAAGG 0: 79
1: 242
2: 300
3: 160
4: 390
975934105_975934113 -1 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934113 4:79558754-79558776 CTGCTAAGGGTGAAGGAGAAGGG 0: 79
1: 253
2: 407
3: 473
4: 586
975934105_975934118 25 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934118 4:79558780-79558802 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
975934105_975934115 4 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934115 4:79558759-79558781 AAGGGTGAAGGAGAAGGGGTTGG 0: 93
1: 75
2: 30
3: 120
4: 1220
975934105_975934117 6 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934117 4:79558761-79558783 GGGTGAAGGAGAAGGGGTTGGGG 0: 458
1: 207
2: 56
3: 137
4: 1396
975934105_975934114 0 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934114 4:79558755-79558777 TGCTAAGGGTGAAGGAGAAGGGG 0: 83
1: 247
2: 292
3: 140
4: 509
975934105_975934111 -8 Left 975934105 4:79558732-79558754 CCCCCTAGAAAAGCAGGACTTGC No data
Right 975934111 4:79558747-79558769 GGACTTGCTGCTAAGGGTGAAGG 0: 140
1: 558
2: 479
3: 208
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975934105 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr