ID: 975935379

View in Genome Browser
Species Human (GRCh38)
Location 4:79573188-79573210
Sequence GTATAGCCCAGGCCAGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975935379_975935384 25 Left 975935379 4:79573188-79573210 CCTCATACTGGCCTGGGCTATAC No data
Right 975935384 4:79573236-79573258 ATGACCTCACATTGGTGGCTTGG No data
975935379_975935382 17 Left 975935379 4:79573188-79573210 CCTCATACTGGCCTGGGCTATAC No data
Right 975935382 4:79573228-79573250 TGAGTTTAATGACCTCACATTGG No data
975935379_975935383 20 Left 975935379 4:79573188-79573210 CCTCATACTGGCCTGGGCTATAC No data
Right 975935383 4:79573231-79573253 GTTTAATGACCTCACATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975935379 Original CRISPR GTATAGCCCAGGCCAGTATG AGG (reversed) Intergenic
No off target data available for this crispr