ID: 975947082

View in Genome Browser
Species Human (GRCh38)
Location 4:79720059-79720081
Sequence ATGGAAAAGCATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975947082_975947088 10 Left 975947082 4:79720059-79720081 CCTTCCTCCTCATGCTTTTCCAT No data
Right 975947088 4:79720092-79720114 TGGAATATTTTGACTATTCAGGG No data
975947082_975947089 26 Left 975947082 4:79720059-79720081 CCTTCCTCCTCATGCTTTTCCAT No data
Right 975947089 4:79720108-79720130 TTCAGGGCAAGTCCAAAAAGTGG No data
975947082_975947085 -10 Left 975947082 4:79720059-79720081 CCTTCCTCCTCATGCTTTTCCAT No data
Right 975947085 4:79720072-79720094 GCTTTTCCATATCTCTAGTATGG No data
975947082_975947087 9 Left 975947082 4:79720059-79720081 CCTTCCTCCTCATGCTTTTCCAT No data
Right 975947087 4:79720091-79720113 ATGGAATATTTTGACTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975947082 Original CRISPR ATGGAAAAGCATGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr