ID: 975949006

View in Genome Browser
Species Human (GRCh38)
Location 4:79745293-79745315
Sequence ATGCTTAAACAGCTCTCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975949003_975949006 1 Left 975949003 4:79745269-79745291 CCCAGCACAGTTATTGTCCAGCT No data
Right 975949006 4:79745293-79745315 ATGCTTAAACAGCTCTCGCAAGG No data
975949004_975949006 0 Left 975949004 4:79745270-79745292 CCAGCACAGTTATTGTCCAGCTT No data
Right 975949006 4:79745293-79745315 ATGCTTAAACAGCTCTCGCAAGG No data
975949002_975949006 13 Left 975949002 4:79745257-79745279 CCTCTATAATTTCCCAGCACAGT No data
Right 975949006 4:79745293-79745315 ATGCTTAAACAGCTCTCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975949006 Original CRISPR ATGCTTAAACAGCTCTCGCA AGG Intergenic
No off target data available for this crispr