ID: 975951050

View in Genome Browser
Species Human (GRCh38)
Location 4:79771829-79771851
Sequence CTACCACAGCTGAGGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975951043_975951050 8 Left 975951043 4:79771798-79771820 CCATGTTAGGGCAAGCTTGAATC No data
Right 975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG No data
975951039_975951050 27 Left 975951039 4:79771779-79771801 CCCAAATACTTAACACAGGCCAT No data
Right 975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG No data
975951040_975951050 26 Left 975951040 4:79771780-79771802 CCAAATACTTAACACAGGCCATG No data
Right 975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975951050 Original CRISPR CTACCACAGCTGAGGCTCTC TGG Intergenic
No off target data available for this crispr