ID: 975966537

View in Genome Browser
Species Human (GRCh38)
Location 4:79979264-79979286
Sequence GTAGGGCTTTCCACTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975966537_975966541 4 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244
975966537_975966546 17 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966546 4:79979304-79979326 CCAAAAATGGGCGAGGTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 101
975966537_975966543 5 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data
975966537_975966544 10 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966544 4:79979297-79979319 GACATCACCAAAAATGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975966537 Original CRISPR GTAGGGCTTTCCACTACTCC TGG (reversed) Intronic