ID: 975966541

View in Genome Browser
Species Human (GRCh38)
Location 4:79979291-79979313
Sequence ACCAAGGACATCACCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975966533_975966541 25 Left 975966533 4:79979243-79979265 CCTGGAGAAGAGCTTGTCCAACC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244
975966537_975966541 4 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244
975966536_975966541 8 Left 975966536 4:79979260-79979282 CCAACCAGGAGTAGTGGAAAGCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244
975966532_975966541 26 Left 975966532 4:79979242-79979264 CCCTGGAGAAGAGCTTGTCCAAC No data
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244
975966531_975966541 27 Left 975966531 4:79979241-79979263 CCCCTGGAGAAGAGCTTGTCCAA No data
Right 975966541 4:79979291-79979313 ACCAAGGACATCACCAAAAATGG 0: 1
1: 0
2: 3
3: 27
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975966541 Original CRISPR ACCAAGGACATCACCAAAAA TGG Intronic