ID: 975966543

View in Genome Browser
Species Human (GRCh38)
Location 4:79979292-79979314
Sequence CCAAGGACATCACCAAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975966536_975966543 9 Left 975966536 4:79979260-79979282 CCAACCAGGAGTAGTGGAAAGCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data
975966531_975966543 28 Left 975966531 4:79979241-79979263 CCCCTGGAGAAGAGCTTGTCCAA No data
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data
975966537_975966543 5 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data
975966533_975966543 26 Left 975966533 4:79979243-79979265 CCTGGAGAAGAGCTTGTCCAACC 0: 1
1: 0
2: 1
3: 14
4: 111
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data
975966532_975966543 27 Left 975966532 4:79979242-79979264 CCCTGGAGAAGAGCTTGTCCAAC No data
Right 975966543 4:79979292-79979314 CCAAGGACATCACCAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975966543 Original CRISPR CCAAGGACATCACCAAAAAT GGG Intronic