ID: 975966544

View in Genome Browser
Species Human (GRCh38)
Location 4:79979297-79979319
Sequence GACATCACCAAAAATGGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975966540_975966544 -8 Left 975966540 4:79979282-79979304 CCTACAAAAACCAAGGACATCAC 0: 1
1: 0
2: 0
3: 13
4: 208
Right 975966544 4:79979297-79979319 GACATCACCAAAAATGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 98
975966537_975966544 10 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966544 4:79979297-79979319 GACATCACCAAAAATGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 98
975966536_975966544 14 Left 975966536 4:79979260-79979282 CCAACCAGGAGTAGTGGAAAGCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 975966544 4:79979297-79979319 GACATCACCAAAAATGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 98
975966539_975966544 -7 Left 975966539 4:79979281-79979303 CCCTACAAAAACCAAGGACATCA 0: 1
1: 0
2: 2
3: 14
4: 228
Right 975966544 4:79979297-79979319 GACATCACCAAAAATGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975966544 Original CRISPR GACATCACCAAAAATGGGCG AGG Intronic