ID: 975966546

View in Genome Browser
Species Human (GRCh38)
Location 4:79979304-79979326
Sequence CCAAAAATGGGCGAGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975966537_975966546 17 Left 975966537 4:79979264-79979286 CCAGGAGTAGTGGAAAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 975966546 4:79979304-79979326 CCAAAAATGGGCGAGGTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 101
975966539_975966546 0 Left 975966539 4:79979281-79979303 CCCTACAAAAACCAAGGACATCA 0: 1
1: 0
2: 2
3: 14
4: 228
Right 975966546 4:79979304-79979326 CCAAAAATGGGCGAGGTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 101
975966536_975966546 21 Left 975966536 4:79979260-79979282 CCAACCAGGAGTAGTGGAAAGCC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 975966546 4:79979304-79979326 CCAAAAATGGGCGAGGTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 101
975966540_975966546 -1 Left 975966540 4:79979282-79979304 CCTACAAAAACCAAGGACATCAC 0: 1
1: 0
2: 0
3: 13
4: 208
Right 975966546 4:79979304-79979326 CCAAAAATGGGCGAGGTCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975966546 Original CRISPR CCAAAAATGGGCGAGGTCAG AGG Intronic