ID: 975971761

View in Genome Browser
Species Human (GRCh38)
Location 4:80047817-80047839
Sequence CTCAGGTACAGCTGGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 44, 3: 119, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975971761_975971768 10 Left 975971761 4:80047817-80047839 CCTTGGATCCAGCTGTACCTGAG 0: 1
1: 0
2: 44
3: 119
4: 370
Right 975971768 4:80047850-80047872 TCTCTGGACCACCTAGTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 62
975971761_975971765 -6 Left 975971761 4:80047817-80047839 CCTTGGATCCAGCTGTACCTGAG 0: 1
1: 0
2: 44
3: 119
4: 370
Right 975971765 4:80047834-80047856 CCTGAGGTAATTTCCCTCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975971761 Original CRISPR CTCAGGTACAGCTGGATCCA AGG (reversed) Intronic
900778339 1:4600935-4600957 CCCAGGTCCTGCTGGTTCCAGGG + Intergenic
901508684 1:9702989-9703011 TTCAGGCATGGCTGGATCCAGGG + Intronic
901783848 1:11611758-11611780 TTCAGACACAGCTGAATCCAGGG + Intergenic
901826441 1:11864808-11864830 ATCAGGCATTGCTGGATCCAGGG - Intergenic
901840114 1:11949014-11949036 TTCAGGCATGGCTGGATCCAGGG + Intronic
901866261 1:12109026-12109048 TTCAGGCATGGCTGGATCCAGGG + Intronic
902200518 1:14830124-14830146 TTCAGGCACAGCTGGATCCAGGG + Intronic
902660015 1:17894466-17894488 GTCAGGCTCCGCTGGATCCAGGG - Intergenic
902661020 1:17903916-17903938 ATCAGGTATGGCCGGATCCAGGG - Intergenic
902669887 1:17965880-17965902 TTCAGGCACAGCCTGATCCAGGG - Intergenic
902905570 1:19554268-19554290 TTCAGGTATGGCTGGATCCAGGG - Intergenic
903060966 1:20668359-20668381 TTCAGGCACGGCTGGATCTAGGG - Intronic
903298058 1:22358397-22358419 TTCAGGCATGGCTGGATCCAGGG - Intergenic
904265524 1:29316574-29316596 TTCAGTTGTAGCTGGATCCAGGG + Intronic
904372571 1:30059147-30059169 CTCAGGCACAGCTGGACTCAGGG + Intergenic
904588238 1:31592126-31592148 TCCAGGCACAGCTGGAACCAGGG + Intergenic
906638808 1:47428691-47428713 TTCAGGCAGAGCTGGATCCAGGG + Intergenic
908896559 1:68907493-68907515 TTCAGATACAGCTGGAACCAGGG - Intergenic
911105375 1:94126450-94126472 CCCAGGGACAGCTGGAACCAGGG - Intergenic
911195164 1:94987187-94987209 TTCAGGCACAACTGGATTCATGG - Intronic
912147334 1:106809657-106809679 CCAAGGTACAGCTGGGGCCATGG - Intergenic
912221108 1:107676539-107676561 TTCAGGCAGAGATGGATCCAGGG - Intronic
912987086 1:114444495-114444517 CTAAGGTACAGCTTACTCCAGGG - Intronic
915986468 1:160470427-160470449 CTCAAGTCCAACAGGATCCATGG - Intergenic
917002500 1:170375154-170375176 CCCAGGTACAGCTTGGGCCATGG - Intergenic
918776250 1:188635166-188635188 CGCCAGTACAGCTGGAGCCAAGG + Intergenic
921259532 1:213373419-213373441 TTCAGGAACAGCTGGATCCAAGG - Intergenic
921946591 1:220890015-220890037 CTCAGATTCAGCTGAAGCCATGG + Intergenic
922926127 1:229347993-229348015 CTCAGGCAGAGCTAGAGCCAGGG - Intergenic
923204974 1:231750309-231750331 CTCAAGTGCAGCTGCATCCCAGG + Intronic
923342980 1:233023141-233023163 TGCAGGAACAGCTAGATCCAGGG - Intronic
924556226 1:245121355-245121377 TTCAGATGCAGCTTGATCCAGGG + Intronic
1062809714 10:453730-453752 AACAGGTACAGCTGGACTCAGGG + Intronic
1065242644 10:23722899-23722921 CAGAGGAACAGCTGGACCCAGGG - Intronic
1068449356 10:57165726-57165748 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1069937113 10:71925185-71925207 GCCAGGGAGAGCTGGATCCAGGG + Intergenic
1070545278 10:77447107-77447129 CTCAGCTACAGCTTCAGCCAAGG + Intronic
1070705734 10:78636647-78636669 CTCAAGAACTCCTGGATCCATGG - Intergenic
1071400455 10:85263682-85263704 TTCAGGTGCACCTGGATTCAGGG - Intergenic
1071504508 10:86224466-86224488 CCCTGCCACAGCTGGATCCATGG + Intronic
1071524006 10:86347680-86347702 TTCAGGCATGGCTGGATCCAAGG - Intronic
1071727668 10:88216334-88216356 TTCAGGCACAGCTGGATCTAGGG + Intergenic
1072247016 10:93552776-93552798 TTTAGGCACATCTGGATCCAGGG - Intergenic
1072785217 10:98274838-98274860 CTTAGGTCCTGCTTGATCCAGGG - Intergenic
1073474695 10:103745257-103745279 TTCAGGCATAGCTGGATCTAGGG - Intronic
1074368392 10:112878609-112878631 TTCAGGTACAGCTGAATCCAGGG - Intergenic
1074372357 10:112910327-112910349 TTCAGGTGTAGCTGGATCCAGGG + Intergenic
1074812765 10:117122300-117122322 CTCCCGTATAGCTGGAACCACGG + Intronic
1075015012 10:118904046-118904068 ATCAGGTAGAGCTGCCTCCAGGG - Intergenic
1075021522 10:118956054-118956076 TTGAGGCACAGCTGGATCCTAGG - Intergenic
1075453589 10:122570186-122570208 TTCTGCTACAGTTGGATCCAAGG - Exonic
1075655253 10:124156847-124156869 CTCAGCTGCAGCTGGACCCCAGG - Intergenic
1075664258 10:124219560-124219582 CCCAGGCACTGCTGGATCCAGGG + Intergenic
1076419978 10:130324436-130324458 TTCAGGCACAGCTGGATCCAGGG - Intergenic
1076543214 10:131227407-131227429 CTCAGGTCTGGCTGGTTCCAGGG + Intronic
1076882305 10:133245510-133245532 TGCAGGCACGGCTGGATCCAGGG - Intergenic
1077552357 11:3206283-3206305 CTCAGGTACACCTGGAGTCAGGG - Intergenic
1077918302 11:6625165-6625187 CCCAGGTGTAGGTGGATCCATGG + Intronic
1079490320 11:20981883-20981905 TTCAGGCAAAGCTGGATTCAGGG + Intronic
1080039599 11:27745330-27745352 TTCAGGTATAGCTGAATCCAAGG - Intergenic
1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG + Intronic
1081703449 11:45166162-45166184 TTCAGGTACAGTTGGATCCAGGG + Intronic
1083207301 11:61160520-61160542 CTGAGGTACCGCTGGAGCGAAGG + Intronic
1084409833 11:69000395-69000417 TTCAGACACAGCTGGATCCAGGG - Intergenic
1084458882 11:69285295-69285317 CTCAGGTCCTGCTGGCCCCAGGG + Intergenic
1084893326 11:72247932-72247954 CTCTGAGACAGCTGGAGCCAGGG - Intergenic
1085174762 11:74476096-74476118 TTCAGGCACAGATTGATCCAGGG - Intergenic
1085961566 11:81468480-81468502 TTCATGTCCAGCTGAATCCAGGG + Intergenic
1087026825 11:93658360-93658382 CTCAGGTATGGCTAGATCCAGGG + Intergenic
1087397670 11:97622242-97622264 CTCAGGTAGAGCTGTTTCCAGGG + Intergenic
1090235270 11:125142318-125142340 CTCAGGCACAGCTCTCTCCAAGG - Intergenic
1093142412 12:15524568-15524590 CTCAGGTACAGATGGGTCTGGGG + Intronic
1093878729 12:24379693-24379715 CTCAGGAACAGTTGGAACCCGGG - Intergenic
1094105614 12:26808220-26808242 TTTAGGTACAACTGGAACCAAGG - Intronic
1095783371 12:46084931-46084953 CTCGTGTCCAGCTGAATCCAGGG + Intergenic
1095919379 12:47514106-47514128 CTAAGGTACAGCTGAGTCCATGG + Intergenic
1095981500 12:47977110-47977132 CTCAGGACCAGCTGGAGCCCGGG - Exonic
1096440843 12:51642699-51642721 CTGAGGTACAGCTTCAACCATGG - Intronic
1098672425 12:73248149-73248171 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1100451495 12:94711186-94711208 TTCAGGTGTAGCTGGATCTAGGG - Intergenic
1101377655 12:104184676-104184698 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1101517027 12:105446341-105446363 TTCAGGTATAGCTAGATCCAGGG + Intergenic
1101574300 12:105983251-105983273 GTCAGGTATTGCTGGATTCAGGG - Intergenic
1101580724 12:106039092-106039114 TTCAGGTCTGGCTGGATCCAGGG - Intergenic
1101738498 12:107481715-107481737 CTTTGACACAGCTGGATCCAGGG + Intronic
1102006827 12:109594551-109594573 TTCAGGTATAGCTCAATCCAGGG + Intronic
1102137942 12:110590862-110590884 CTCAGGCAAAGCTGGATTCAGGG - Intergenic
1102415920 12:112762626-112762648 CTCAGATATGGCTGGATCCAGGG + Intronic
1102525178 12:113507523-113507545 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1102542574 12:113633203-113633225 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1102558500 12:113745566-113745588 TTCAGGTGCAGCTGGACCCAGGG + Intergenic
1102805742 12:115778684-115778706 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1102891549 12:116562262-116562284 TTCAGGCACAGGTGGATCCAGGG - Intergenic
1102894992 12:116591825-116591847 TTCAGGCACAACTGGATCAAGGG - Intergenic
1103036046 12:117657343-117657365 TTCAGGTATGGCTGGATCTAAGG - Intronic
1103144187 12:118580073-118580095 TTCAGGCTCAACTGGATCCAGGG + Intergenic
1103208088 12:119145851-119145873 TTCAGGTACAGCTGGATTCAGGG + Intronic
1103806195 12:123575045-123575067 TTCAGGTATAGCTGAATCCAGGG - Intergenic
1103970211 12:124666044-124666066 CTCAGGTATGGCTGAATCCAGGG + Intergenic
1103979267 12:124726022-124726044 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1103981608 12:124740407-124740429 TTCAGGTACAGCTTGATCCGGGG - Intergenic
1103982287 12:124744427-124744449 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1104051602 12:125198309-125198331 TTCAGGTATGGCTGGGTCCAGGG + Intronic
1104055867 12:125229669-125229691 TTCAGGCATAGCTGAATCCAGGG + Intronic
1104086009 12:125474736-125474758 TTTAGGCACAGCTGGATCCAGGG + Intronic
1104114756 12:125738519-125738541 TTCAGGTCTAGCTGAATCCAGGG + Intergenic
1104127858 12:125864572-125864594 GTCAGGTTCAGGTGGAGCCATGG - Intergenic
1104377416 12:128277260-128277282 TTCAGGCACAGCTGGATCCAGGG + Intronic
1104391946 12:128398193-128398215 TTCAGGCACTGCTGGATTCAGGG + Intronic
1104517977 12:129445612-129445634 TTCAGGCACAGCTGGATCCAGGG - Intronic
1104523041 12:129493065-129493087 TTCAAGTACAGCTGGATACAGGG - Intronic
1104551603 12:129762113-129762135 ATCAGGAACAGATTGATCCAGGG - Intronic
1104664343 12:130636796-130636818 TTCAGTTACAGCTTGATCCAGGG - Intronic
1104746758 12:131215525-131215547 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1104785809 12:131447392-131447414 TTCAGGTGCGGCTGGATCCAGGG + Intergenic
1104958709 12:132478109-132478131 TTCAGGTCTAGCTGGATCCAGGG + Intergenic
1106016321 13:25872401-25872423 TTCAGGCAGAGCTGGATCCAGGG - Intronic
1108465784 13:50714202-50714224 CTCAGGCATGGCGGGATCCAAGG - Intronic
1110006718 13:70281236-70281258 CAAAGGTACTGCTGAATCCAAGG + Intergenic
1112101689 13:96196849-96196871 TTCAGCTGCAGCTGCATCCATGG + Intronic
1112765569 13:102738391-102738413 CTCATTTACAACTGGATACAAGG - Exonic
1113812969 13:113153491-113153513 AGCAGGCACAGCTGGGTCCAGGG + Intergenic
1114397909 14:22383725-22383747 CTCAGGTAAAGCTGGGGCCAAGG - Intergenic
1117084121 14:52181424-52181446 CCAAGGTACAGCTGGGGCCATGG - Intergenic
1117215383 14:53546321-53546343 TTCGGGCACAGCTAGATCCAGGG + Intergenic
1117622122 14:57598095-57598117 CTCAGGAACACCTGGAACCAGGG + Intronic
1118702421 14:68446798-68446820 CTGAGGCACAGTTGGATCCAGGG - Intronic
1119108567 14:71948064-71948086 TTCAGGCTTAGCTGGATCCAGGG + Intronic
1119140449 14:72262818-72262840 GTCAGCCACAGCTGGATCCAGGG + Intronic
1119165063 14:72485769-72485791 CTCAGGAAAAGCTGGAGCCAGGG + Intronic
1119531432 14:75364065-75364087 TTTAGGAACAGCTGGATCCAGGG + Intergenic
1119872934 14:78032478-78032500 GTCAGGTGTGGCTGGATCCAGGG + Intergenic
1120507769 14:85374916-85374938 TACAGATACAGCTAGATCCAGGG + Intergenic
1120796256 14:88636310-88636332 CTCATGTACACCTTGTTCCATGG + Intronic
1120833797 14:89022267-89022289 CACAGGGACAGCTGAAACCAGGG - Intergenic
1121432428 14:93897296-93897318 TGCAGGTACAGCTGGCTCCAGGG - Intergenic
1122061921 14:99141620-99141642 TTCAGGTACGGCTGGATCCAGGG - Intergenic
1122652579 14:103233512-103233534 TTCAGGTAGGGCTGGATCCAGGG + Intergenic
1123042333 14:105495529-105495551 CACAGGTCCAGCTGGCACCAGGG - Intronic
1123627392 15:22237229-22237251 TTCAGGCACAACTGGATCCAGGG - Intergenic
1124690933 15:31822325-31822347 GTCAGGTGCAGCTGGGTCTAGGG - Intronic
1125761642 15:42100241-42100263 TTCAGGCAAAGCTCGATCCAAGG - Intergenic
1126474532 15:49051899-49051921 CCAAGGTACAGCTCGAGCCATGG - Intergenic
1127670850 15:61193514-61193536 TTCAGGAAGGGCTGGATCCAGGG - Intronic
1128520850 15:68373894-68373916 TGCAGGTACAGTTTGATCCAGGG - Intronic
1128786916 15:70404353-70404375 CTGAGGCACAGATGGATCCAGGG - Intergenic
1128847721 15:70916690-70916712 CCCAGGTCCACCTGGCTCCATGG - Intronic
1129055032 15:72813258-72813280 TTCAGGCATGGCTGGATCCAAGG + Intergenic
1129152090 15:73695751-73695773 TTCAGGCATAGCTGGATCCAGGG + Intronic
1129603300 15:77012541-77012563 CTCAGGTACAACTTGATGGATGG - Intronic
1130153525 15:81330500-81330522 CTCAGGCCCAACTGGAGCCAGGG - Intergenic
1130849839 15:87782173-87782195 TTCAGGCACAGCTGGAACCAGGG + Intergenic
1130914219 15:88291906-88291928 GTCAGGTACAGCTGGCTCCAGGG - Intergenic
1130996474 15:88907184-88907206 CCCAGGCATACCTGGATCCAGGG + Exonic
1131851683 15:96550394-96550416 CTCAGGTACAGATGTGACCACGG - Intergenic
1132007252 15:98239246-98239268 TTCAGGTATAGCGAGATCCAGGG - Intergenic
1132215317 15:100057877-100057899 TTCAGGCACTGCTGGATCCAGGG - Intronic
1132411301 15:101579989-101580011 TTCAGGCATAGCTGGACCCAGGG + Intergenic
1132743909 16:1428881-1428903 CTCAGCCACAGCTGGATCAGAGG + Intergenic
1133008510 16:2897643-2897665 CTCAGGGAGAGCTGGGTGCAGGG - Intronic
1133337597 16:5016096-5016118 TTCAGGTAAGGCTAGATCCAGGG + Exonic
1133661397 16:7921449-7921471 TTAAGGTACAGCTGGATCCAGGG - Intergenic
1134037385 16:11041421-11041443 TTCAGGCAAAGCTGGATCCAGGG + Intronic
1134201626 16:12204192-12204214 GCCAGGCACAGCTGGATTCAGGG - Intronic
1134276454 16:12780660-12780682 TGCAGGTACAGCTGGATCTAGGG - Intronic
1134340252 16:13338223-13338245 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1134365027 16:13569178-13569200 TTCAGGTATGGCTGAATCCAGGG - Intergenic
1134450066 16:14357842-14357864 CTCAGGTTCAGAGGGTTCCAGGG - Intergenic
1134907852 16:17996611-17996633 TTCAGGTATGGCTGGATTCAGGG - Intergenic
1135114552 16:19713901-19713923 TTCAGGTATGGCTGGATCTAGGG - Intronic
1135293210 16:21257806-21257828 TTCAGCTACAGCTGTATTCAGGG - Intronic
1135502092 16:23005094-23005116 TTCAGGTATAGGTCGATCCAGGG - Intergenic
1135598066 16:23758370-23758392 TTTAGGCACAGCTGGATCCAAGG + Exonic
1135822967 16:25701045-25701067 TTCAGGAAAAACTGGATCCAGGG + Intronic
1135841026 16:25876343-25876365 CTCAGGTATGGCTGGATTCAGGG + Intronic
1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG + Intergenic
1135958795 16:26978808-26978830 TTCAGGCACAGCTGGATCTAAGG + Intergenic
1135978753 16:27129846-27129868 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1136014229 16:27384804-27384826 TTCAGGCATAGCTGGATCAAGGG + Intergenic
1136040557 16:27575566-27575588 GTCAGGCTCAGCTGGGTCCAGGG + Intronic
1136050407 16:27646185-27646207 TTCAGGTGCAGCTGGATCCAGGG + Intronic
1136086255 16:27887417-27887439 CTCAGGCATGGCTGGATCTAGGG - Intronic
1136140181 16:28283350-28283372 TTCAGGCATAGCTGGATCAAGGG + Intergenic
1136246801 16:28980943-28980965 GTCAGGTAAAGCTGGATCCAGGG + Intronic
1137595009 16:49717609-49717631 TTCAGGTGCAGCTGAATCCAGGG - Intronic
1137667536 16:50260416-50260438 TTCAGGCATGGCTGGATCCAGGG + Intronic
1137840855 16:51639691-51639713 TTCAGGTATTGCTGGATCAAGGG + Intergenic
1138447286 16:57072100-57072122 TTCAGGCACAGCTGGATCCAGGG + Intronic
1138519954 16:57565430-57565452 TTCAGACATAGCTGGATCCAGGG + Intronic
1139466646 16:67157574-67157596 TTCAGGGACGGCTGGATCCAGGG - Intronic
1140250629 16:73291283-73291305 CTAGGGTACAGCTGGGCCCATGG + Intergenic
1140848992 16:78916914-78916936 ATCAGGTAAAGCTTGACCCAGGG + Intronic
1140855072 16:78970849-78970871 TTCAGGCACGGCTGGATCCAGGG + Intronic
1141179652 16:81743792-81743814 CACAGTCACAGCTGGATCAAGGG - Intronic
1141293942 16:82749235-82749257 TTTAGGTACAGCTGGATCCAGGG - Intronic
1141503527 16:84460577-84460599 CTCAGGCACAGCTGTTTCAAGGG + Intronic
1141536130 16:84681409-84681431 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1141879253 16:86847011-86847033 TTCAGGTAGGGCTGGATCTAGGG + Intergenic
1141906040 16:87027759-87027781 CTCAGGTGCACTTGGGTCCAGGG + Intergenic
1141976565 16:87520149-87520171 TTCAGGCGCAACTGGATCCAGGG + Intergenic
1141988235 16:87593919-87593941 TTCAGGTACTGCTGGATCCAGGG + Intergenic
1142353509 16:89590610-89590632 CTCAGGCACTGCTGGATCCAGGG + Intronic
1142722545 17:1786331-1786353 TTAAGATACAGCTTGATCCAGGG - Intronic
1142879125 17:2870798-2870820 CTCAGAAACAGCTGGATCCAGGG + Intronic
1142972714 17:3623621-3623643 CTCAAGTCCAGCTGGGTCCCTGG + Intronic
1143831861 17:9658775-9658797 TTCAGGTAGGGCTGGATCCAGGG + Intronic
1144083254 17:11783744-11783766 TTCAGGTACAGGAGGAGCCATGG + Exonic
1145851968 17:28108810-28108832 CTCAGGTAATGCTGGAATCAAGG - Intronic
1146221028 17:31020711-31020733 TTTAGGCACAGCTGGATCCCGGG + Intergenic
1146287418 17:31583220-31583242 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1149398892 17:56273889-56273911 TTCAGGTACAGTTTGATTCAGGG + Intronic
1149999042 17:61420937-61420959 TTCAGGCATAGCTGGTTCCAGGG + Intergenic
1150366725 17:64594424-64594446 TTTAGGCACAGCTGGATCCCGGG - Intronic
1152388321 17:79988348-79988370 ATCAGCCACAGCTGGAGCCAGGG - Intronic
1152569280 17:81114493-81114515 CTCAGGGTCTGCTGGATCCCCGG - Intronic
1153278006 18:3387455-3387477 TTCAGGAACAGCTGGGTTCATGG - Intergenic
1156248959 18:35332425-35332447 TTTAGGCACAGCTGGATCTAGGG + Exonic
1156495403 18:37522383-37522405 CTCAGCTCCAGCTGGGTCCTGGG - Intronic
1156979889 18:43273766-43273788 CTCATCAAAAGCTGGATCCAAGG + Exonic
1157136124 18:45057468-45057490 ATCAGGTACTGCTGTATCAATGG + Intronic
1158310942 18:56157601-56157623 TTCAGGTACAGCAGGATCTAGGG + Intergenic
1158859759 18:61581050-61581072 CTCAGGTGAGGCTGGAGCCATGG - Intergenic
1160737578 19:671019-671041 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1160926990 19:1551260-1551282 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1161316677 19:3620575-3620597 TTCAGGTAAGGCTGGATCCAGGG - Intronic
1161616378 19:5273079-5273101 TTCAGGTTCAGCTGGATCCAGGG - Intronic
1161623880 19:5314416-5314438 TTCAGGCATAGTTGGATCCAGGG - Intronic
1161859452 19:6787080-6787102 TTCAGGTCTGGCTGGATCCAGGG + Intronic
1162910659 19:13846545-13846567 ACCAGGTACACCTGGATCAAGGG + Intergenic
1162928369 19:13942224-13942246 TTCAGGCACAGCTGGATCCAGGG + Intronic
1162999001 19:14354273-14354295 TTCAGGGACAGCTGGATTCACGG + Intergenic
1163257929 19:16168794-16168816 GTCAGGTACAGCTGGAACCAGGG - Intronic
1163616014 19:18328812-18328834 TTCAACTATAGCTGGATCCAGGG - Intergenic
1163668894 19:18616238-18616260 TTCAGGCACAGCTGGATCCAGGG + Intronic
1163768517 19:19176964-19176986 GTCAGGTACAGTTGGATCCAGGG + Exonic
1164464356 19:28474994-28475016 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1164540242 19:29116543-29116565 TTCAGGCAAGGCTGGATCCAGGG - Intergenic
1164720072 19:30425471-30425493 CTCAGGTGCTGTTTGATCCAGGG + Intronic
1164877866 19:31705294-31705316 TTCAGGTAGGGCTGAATCCAGGG + Intergenic
1164916250 19:32054468-32054490 TTCAGGTATAGCTGGATCCAGGG - Intergenic
1164994004 19:32706236-32706258 CTCAGGTACAGCTTTATCCCTGG + Intronic
1165118344 19:33543132-33543154 TTCAGTTACGGCTGGATCCAGGG + Intergenic
1165370719 19:35404164-35404186 CTCACGTACAGCTGCATCATGGG + Intergenic
1165713113 19:38026131-38026153 TTCAGGCAAGGCTGGATCCAGGG + Intronic
1165725078 19:38107037-38107059 CTCAGGTCTGGTTGGATCCAGGG + Intronic
1165766665 19:38355777-38355799 TTCAGGTATGGCTGGATCCAGGG + Intronic
1166252749 19:41582670-41582692 CCAAGGTACAGCTGGGGCCATGG - Intronic
1166900602 19:46058771-46058793 CCAAGGTACAGCTGGGGCCATGG - Intronic
1167215551 19:48162092-48162114 TGCAGGCACAGCTGGATCCAGGG - Intronic
1167745829 19:51351359-51351381 TTCAGGCACAGCTTGATCCAGGG - Intronic
1168444444 19:56399682-56399704 ATCAGGTCCAGGTGGAGCCATGG + Intronic
1168510491 19:56969698-56969720 CTCATTTACAACTGGAGCCAGGG + Intergenic
925034600 2:676221-676243 CCCAGGTACAGCAGGGTCCCGGG - Intronic
925696724 2:6587966-6587988 TTCAATTATAGCTGGATCCAGGG + Intergenic
926173723 2:10570380-10570402 CTCAGGAACACCTAGATCCATGG - Intergenic
927081113 2:19631472-19631494 TTCAGGAACAGCTGGAACCAGGG - Intergenic
927790494 2:26005818-26005840 TTCAGGCACAGCTGGATCTAAGG + Intergenic
928040656 2:27873096-27873118 CTCAGGAAGAGCAGGAACCAGGG - Intronic
928364159 2:30688982-30689004 TTCAGGCACAGCTGGCACCATGG + Intergenic
928594784 2:32849504-32849526 TTCATGCACATCTGGATCCAGGG + Intergenic
929120637 2:38481277-38481299 CTCAGGAAGGGCTGAATCCAAGG - Intergenic
929237173 2:39617757-39617779 TTTAGGTACAGCTGGATCCAGGG - Intergenic
929698542 2:44141321-44141343 CTCAGGAATAACTGGCTCCAAGG + Intergenic
929703239 2:44183464-44183486 ATCAAGTACAGCTGGATACTGGG + Intronic
929934116 2:46281924-46281946 CTCAGGTATGACTGGCTCCAGGG + Intergenic
930866416 2:56126441-56126463 TCCAGGAATAGCTGGATCCAGGG - Intergenic
931233127 2:60390943-60390965 TACAGGAACAGCTGGATCCAGGG - Intergenic
931331601 2:61291526-61291548 TTCAGTCACAGCTGAATCCAGGG - Intronic
932012672 2:67993972-67993994 CTCATTTACAGCTGGATCAGGGG + Intergenic
933854250 2:86397967-86397989 AGTAGGTTCAGCTGGATCCAGGG + Intergenic
935291062 2:101611450-101611472 GTCAGGTATAGTTGGATCCTTGG + Intergenic
937067262 2:119026794-119026816 CAGAGGTCCAGCTGGATCCCAGG - Intergenic
939225000 2:139353769-139353791 CCAAGGTACAGCTTGAGCCATGG + Intergenic
941967262 2:171312476-171312498 CCAAGGTACAGCTGGGGCCATGG + Intergenic
944346663 2:198674139-198674161 AACAGGTACATCTTGATCCAAGG - Intergenic
946285041 2:218696597-218696619 CTGAGGTACAGATGGATCTTGGG + Exonic
946302983 2:218835852-218835874 TTCAGGTACAGTTTGATCCAAGG - Intergenic
946309601 2:218875952-218875974 TTCAGGTACAGCTGAACCCAGGG + Intergenic
946320364 2:218950536-218950558 ATCAGGTTTAGCTGGATCTAGGG + Intergenic
947778011 2:232730195-232730217 CTCAGGTACAGCTGATGCCATGG - Intronic
1169190731 20:3657773-3657795 TTCAGGCACAGCTGTCTCCAGGG - Intergenic
1169202650 20:3720257-3720279 TTCAGGTAAGGCTTGATCCAGGG - Intergenic
1169860486 20:10146316-10146338 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1170255796 20:14341814-14341836 TTCAGGTAAAGCTTGATACATGG + Intronic
1170321569 20:15105159-15105181 CCTAGGTGCAGCTGGATGCAGGG + Intronic
1170344904 20:15374539-15374561 CTCAGGGAAAGCTGGCACCAAGG - Intronic
1171018370 20:21561991-21562013 TTCAGGTTTGGCTGGATCCAGGG + Intergenic
1171241309 20:23569146-23569168 CTCTGGCTCAGCTGGAACCAGGG - Intergenic
1172058005 20:32167661-32167683 TTCAGGTCTGGCTGGATCCAGGG + Intergenic
1172959370 20:38787709-38787731 CTCAGGTGAGGCTGGATCCAGGG - Intergenic
1173045911 20:39511736-39511758 CTCAGGTATAGCTAGATTCAGGG - Intergenic
1173914537 20:46697142-46697164 TTTAGGTGCAGCTGGACCCAGGG + Intergenic
1173916805 20:46714120-46714142 TTCAGGTGCAGTTGGATCTAGGG + Intronic
1173917741 20:46721621-46721643 TTCAGGCACTGCTAGATCCATGG + Intronic
1174104266 20:48151034-48151056 CTCAGATGCAGCTGGATCCAGGG - Intergenic
1174107765 20:48175003-48175025 TTCAGGTATAGGTAGATCCAGGG - Intergenic
1174113668 20:48212990-48213012 TTCAGGCACAGCTGCATCCAGGG + Intergenic
1174115029 20:48220985-48221007 GTCAGGTAGAGCTTGATCTAGGG + Intergenic
1174127280 20:48316022-48316044 TCCAGGTACAGGTGGATCTAGGG - Intergenic
1174165613 20:48581596-48581618 CTGGGGTAGGGCTGGATCCAGGG - Intergenic
1174168187 20:48599551-48599573 TTCAGGCACAGCTGCATCCAGGG - Intergenic
1174187498 20:48716956-48716978 TTCAGGCATAGCTGCATCCAGGG - Intronic
1174189755 20:48731930-48731952 CTCAGGTTCAGCTAGGTCCTGGG - Intronic
1174267756 20:49344329-49344351 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1174268623 20:49350509-49350531 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1174327250 20:49789255-49789277 TTCAGGTACAGCTGGATTCAGGG - Intergenic
1174502362 20:50995020-50995042 TTCAGGAACTGCTGGATCTAGGG + Intergenic
1174515071 20:51085737-51085759 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1174657869 20:52186814-52186836 CACAGGTACAGCTGGAGCATGGG - Exonic
1175033410 20:55976952-55976974 TTCAGGTAAGGCTAGATCCAGGG - Intergenic
1175117590 20:56694049-56694071 TTCAGGCACAGATGGATCTAGGG + Intergenic
1175122323 20:56725277-56725299 TTCAGGCACGGCTGGATCCAGGG + Intergenic
1175134427 20:56812290-56812312 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1175228461 20:57459164-57459186 TTCAGGCACAGATGGATCCAGGG + Intergenic
1175678132 20:60964878-60964900 TTCAGGAACACCTGGACCCAGGG + Intergenic
1176717609 21:10366498-10366520 CTCAGGTACACTTGAATTCAAGG + Intergenic
1178470510 21:32888146-32888168 CTCAGGAACACCTGCCTCCAGGG - Intergenic
1178771298 21:35506892-35506914 GGTATGTACAGCTGGATCCAAGG + Intronic
1179288688 21:39999612-39999634 TTCAGGAGCAGCTGGATGCAGGG - Intergenic
1179552989 21:42155023-42155045 CTCAGGTGCAGCTGGACTAAAGG + Intergenic
1180037140 21:45255842-45255864 CTCAGGCACGGCTGGATCCAGGG - Intergenic
1180298836 22:11019418-11019440 CTCAGGTACACTTGAATTCAAGG + Intergenic
1181039023 22:20183289-20183311 CTGAGGTACAGATGGGACCAGGG - Intergenic
1181822204 22:25485105-25485127 TTCAGGTATGGCTTGATCCAGGG - Intergenic
1181953633 22:26572420-26572442 CTCAGGTATGGCTAGATCCAAGG - Intronic
1182323994 22:29497805-29497827 TTCAGGAATGGCTGGATCCAGGG + Intergenic
1182355745 22:29721537-29721559 CTCAGAGACCCCTGGATCCAAGG - Intronic
1182533230 22:30978763-30978785 TTCAGGCACGGTTGGATCCAGGG - Intergenic
1182884173 22:33759150-33759172 TTCAGGCAGAGTTGGATCCAGGG - Intronic
1183077756 22:35437509-35437531 TTCAGGCTTAGCTGGATCCAGGG - Intergenic
1183261736 22:36799808-36799830 TTCAGGAACAGCTGGATCAAGGG - Intergenic
1184512731 22:44942824-44942846 CTCAGGTCCAGCTGGGGCAAGGG - Intronic
949526552 3:4910342-4910364 CTCAGGAAATGCTGGACCCAGGG + Intergenic
949583121 3:5410976-5410998 TTCAGGAATAGCTGGGTCCAGGG - Intergenic
949638056 3:6005908-6005930 TTCTGGTACAGCTGGATTTAGGG - Intergenic
949843857 3:8351015-8351037 TTCAGGTATGGCTGGATCCAGGG - Intergenic
949922344 3:9013016-9013038 TTCAGGTATAGCTTGATCCAGGG - Intronic
949930135 3:9071955-9071977 CTCAGGTCTAACTGGATCCAGGG - Intronic
950047813 3:9960878-9960900 TTCAGGCACAGCTGGGTCCAGGG - Intergenic
950101856 3:10362061-10362083 CTCAGGTGGAGCTGGCTTCAGGG + Intronic
950132760 3:10558577-10558599 TTCAGGCACAGCTGGATCCAGGG - Intronic
950190971 3:10975895-10975917 ATCAGGCATGGCTGGATCCAGGG + Intergenic
950192902 3:10990634-10990656 TTCAGGTATGGCTGGATCCAGGG + Intergenic
950441035 3:13010593-13010615 TTCAGGTACAGTTGGATTCGGGG - Intronic
950471393 3:13188837-13188859 TTCAGGCATGGCTGGATCCAAGG - Intergenic
950686832 3:14624548-14624570 TTCAGGTATAGCTAGATCTAGGG - Intergenic
952755532 3:36862852-36862874 TTCAAGTACAGCTGGCTTCAGGG - Intronic
952814368 3:37434470-37434492 TTCAGGCACAGCTCAATCCAGGG - Intronic
953221979 3:40979957-40979979 CTCAGGGACACCTGGACTCAGGG + Intergenic
953350961 3:42215829-42215851 CCCAGATACAGCTGCTTCCAAGG - Intronic
953706917 3:45238109-45238131 TTCAAGTCCAGCTGGATCTAGGG - Intergenic
953812486 3:46125346-46125368 CTCAGGAAAAGCTGGGTGCAGGG - Intergenic
955003538 3:54948970-54948992 TTCAGGTACAGTTGGATCTGGGG + Intronic
955352002 3:58200493-58200515 TTCAGGCATAGCTGGATCCAGGG - Intronic
955404013 3:58613922-58613944 CCCAGGTACAGCAGGCTGCAGGG - Intronic
955409179 3:58644855-58644877 TTCAGGACCACCTGGATCCAGGG - Intronic
955463386 3:59210119-59210141 CTCAGAAACACCTGCATCCAAGG - Intergenic
955515070 3:59718323-59718345 CTCAGGTGTAGCTGGATCCAGGG + Intergenic
955522800 3:59791471-59791493 TTCAGGCGCGGCTGGATCCAGGG - Intronic
955527155 3:59832910-59832932 TTCAGGCACAGCTGGATTCAGGG - Intronic
955542436 3:59991880-59991902 TTCAGGTATGGCTTGATCCAGGG - Intronic
955674922 3:61438069-61438091 TTCAGGTATAGCTGAGTCCAGGG - Intergenic
956187582 3:66577102-66577124 CTCAGCTTCAGCTGAATCCTGGG - Intergenic
956380953 3:68663915-68663937 TTCAGGAATAGCTGAATCCAGGG - Intergenic
956654667 3:71537252-71537274 CTCAGTTCCAGCTGGATTTAGGG + Intronic
956657751 3:71568424-71568446 CTCAGGCAGAGCTGGTTTCATGG + Intronic
956722886 3:72133819-72133841 TTCAGGTATAGCTGGATCCAGGG + Intergenic
956779778 3:72594789-72594811 ATCAGGCATTGCTGGATCCAGGG + Intergenic
959654541 3:108787006-108787028 CTCAGGGCCAGGTAGATCCATGG + Intergenic
960507735 3:118513779-118513801 CTCAAGGACAATTGGATCCATGG - Intergenic
961368073 3:126413940-126413962 TTTAGGCACAGCTGGATCCAGGG + Intronic
961459317 3:127040173-127040195 CTCAGGCATGGCTGGATCCAGGG + Intergenic
961619871 3:128215692-128215714 TTTAAGCACAGCTGGATCCAGGG + Intronic
961651059 3:128416859-128416881 TCCAGGCATAGCTGGATCCAGGG - Intergenic
961741286 3:129034581-129034603 TTCAGGCACAGCTGGGTCCAGGG + Intronic
962313192 3:134340231-134340253 CTCAGAGACAGCTGGAACCAAGG + Intergenic
962608051 3:137049135-137049157 CCAAGGAACAGCTGGATCCTGGG - Intergenic
963000547 3:140677894-140677916 CTCCTCTACAGCTGGTTCCATGG + Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963055676 3:141184653-141184675 TTTAGGTACAGCTAGATCCCAGG + Intergenic
964016473 3:151953311-151953333 CTTTGGTACAGCTGGAGCAATGG - Intergenic
964045048 3:152313373-152313395 CTCAGATCCAGCTGAATCCACGG - Intronic
965136260 3:164773391-164773413 CTCAGGATCAGCTGGCTTCATGG - Intergenic
967716269 3:192765517-192765539 TTCAGGAACAGCTGGAATCAGGG + Intronic
968042661 3:195600920-195600942 CTGAGGGACAGATGGATCCAAGG - Intergenic
968447600 4:660119-660141 CACAGGCACACCTGGATACACGG - Intronic
969245151 4:5927151-5927173 TCCAGGCACAGCTGGCTCCAGGG - Intronic
969298501 4:6283453-6283475 TTCAGGCACGGCTGGATCCAGGG + Intronic
969805078 4:9601076-9601098 ATCAGGCACAGCTCGATCCGAGG + Intergenic
970053924 4:11949501-11949523 GGCAGGTACAGATGGAGCCATGG - Intergenic
970523364 4:16907904-16907926 TTCAGGTTCAGTAGGATCCAGGG + Intergenic
971370112 4:26012152-26012174 TTCAGGCACAGCTCAATCCAGGG - Intergenic
971936064 4:33149061-33149083 CTCAAGCATTGCTGGATCCAGGG - Intergenic
971948670 4:33315271-33315293 CCAAGGTACAGCTTGAGCCATGG + Intergenic
972475868 4:39448782-39448804 CTGAGATACAGCTGTAACCAAGG + Exonic
973566293 4:52191638-52191660 ATCAAGTACAGCAGCATCCATGG + Intergenic
973573527 4:52263795-52263817 CTCAGGCACAGCTAGAAGCAGGG + Intergenic
973932558 4:55807679-55807701 TTCAGGCATGGCTGGATCCAAGG + Intergenic
975856201 4:78627269-78627291 TTTAGGCACAGCTGGATTCAGGG + Intergenic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
976832223 4:89328408-89328430 TTCAGGCACAGGTTGATCCAGGG + Intergenic
977971295 4:103217413-103217435 CTCAGGTACATATGGAACCTGGG + Intergenic
978962498 4:114699994-114700016 ATCAGGTGCAGCTGGATCCAGGG - Intergenic
979625027 4:122834973-122834995 AGCAGGTCCAGCTGGAGCCATGG - Intronic
980079338 4:128327406-128327428 CTTAGGTCCAGCTGGATCCAAGG - Intergenic
980107175 4:128599276-128599298 CTCAGGTGCAGCTGGTTCGGAGG - Intergenic
981035608 4:140165423-140165445 TTTAGGCTCAGCTGGATCCAGGG - Intergenic
982137685 4:152287591-152287613 ATCAGGCATGGCTGGATCCAGGG - Intergenic
983831236 4:172330214-172330236 CTCAGGCACAGGTGGAGCCCTGG - Intronic
986757589 5:10852659-10852681 TTCAGGTACAGCTTGATCCAGGG - Intergenic
988487441 5:31678487-31678509 CTCAGGGACAGCTGGAGCCTGGG + Intronic
991582636 5:68172794-68172816 TTAAGGTATAGCTGGATGCATGG - Intergenic
992078201 5:73210591-73210613 CTCAGGACCAGATGGATTCATGG + Intergenic
992174141 5:74133261-74133283 TTCAGGTAAAGCTGGATTCAAGG + Intergenic
992358027 5:76005804-76005826 TTCAGGTTCAGCTGGATCCAGGG - Intergenic
992385894 5:76284527-76284549 TTGAGGCACAGGTGGATCCAGGG - Intronic
993103345 5:83568928-83568950 CTCAGATACAGCTGGGTGTATGG - Intronic
993225908 5:85167129-85167151 CTAAGGTACAGCTTGAGCCATGG + Intergenic
994086255 5:95762553-95762575 CTGAGGTAGAACTGGATCCTAGG + Intronic
994401424 5:99285149-99285171 CTCTGGTAAAGCTGGAGGCATGG + Intergenic
994464385 5:100108733-100108755 CTCAGGTACTGCCTGAGCCATGG + Intergenic
994969961 5:106723683-106723705 ATCAGGTATGGATGGATCCAAGG - Intergenic
995230478 5:109755839-109755861 TTCAGGTATTGCTGTATCCAGGG + Intronic
996215327 5:120858986-120859008 CTGAGCTACAACAGGATCCATGG - Intergenic
996256351 5:121409034-121409056 CTCAGGTAGTGGTGGATACAAGG + Intergenic
996937485 5:128965482-128965504 CTCAGGGCCAGCGGGTTCCAGGG - Exonic
997178472 5:131803357-131803379 TTCAGGCACAGCTTTATCCAAGG + Intergenic
997516682 5:134495013-134495035 TTCAGGCACAGTTTGATCCAGGG - Intergenic
997779276 5:136640666-136640688 CACAGAAAGAGCTGGATCCATGG + Intergenic
997945994 5:138201953-138201975 CTCAGCTATAGCTGGGTACAAGG + Intronic
998810523 5:145961895-145961917 CTCAGACCCAGCAGGATCCATGG + Intronic
999038121 5:148376244-148376266 TTCAGGCACAGCTTTATCCATGG + Intergenic
999145913 5:149393753-149393775 TTTAGGTATGGCTGGATCCAGGG - Intronic
999254050 5:150199758-150199780 TTCAGGCACAGCTGGGTCTAGGG + Intronic
1000145299 5:158447865-158447887 ATCAGGTACTGCTTGATCCGGGG - Intergenic
1000269135 5:159666598-159666620 TTCAGACACGGCTGGATCCAAGG - Intergenic
1000303300 5:159974127-159974149 GTCAGGTATGGCTGGATCCAGGG + Intergenic
1000810410 5:165854498-165854520 TTCAGGCACAGCTAGATCCAGGG - Intergenic
1001050662 5:168411525-168411547 TTCAGGCACAGCTGGATCCAGGG + Intronic
1001146624 5:169190373-169190395 TTCAGGAACAGCTGGATCCAGGG - Intronic
1001182578 5:169534304-169534326 ATCAGGTACAGTGTGATCCAGGG - Intergenic
1001253416 5:170165841-170165863 TTCAGGTTCGGCTAGATCCAGGG + Intergenic
1001436598 5:171704154-171704176 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1001438893 5:171723047-171723069 TTCAGGCACGGCTGGATCCAAGG + Intergenic
1001703512 5:173724456-173724478 CTCAGGAACAGCTGGAAGGAAGG + Intergenic
1002080630 5:176735199-176735221 TTCAGGCCCAGCTGGATCCAGGG - Intergenic
1002467638 5:179415743-179415765 TTCAAGTACAGCTGGATTTACGG + Intergenic
1005909489 6:30295709-30295731 CTCAGGTACAACTGGAACCAGGG + Intergenic
1005944273 6:30584279-30584301 TTCAGGGACAGCTGGAACAAGGG + Exonic
1006211292 6:32397133-32397155 CTCAGGTACAGAGGCATCCTGGG + Intronic
1006908386 6:37548139-37548161 CTCAGCTGCATCTGGAGCCAGGG + Intergenic
1007124181 6:39411129-39411151 TTCAGGTACAGCTGGGACCAGGG + Intronic
1007241662 6:40431022-40431044 TTCAGGTTCAGCTGGATCAAAGG - Intronic
1008045322 6:46845767-46845789 TTCAGGTACAGCTAGATTCAAGG - Intergenic
1013528886 6:111001098-111001120 CTCAGGTACAGGTGGAACAGTGG + Intronic
1014314280 6:119843819-119843841 CCCAGATACAGCTGAATCCTAGG + Intergenic
1017522496 6:155214183-155214205 CTCAGCTCCTGCTGGCTCCATGG + Intronic
1017970090 6:159304517-159304539 TTCAGGCATAGCTGGACCCAAGG - Intergenic
1018262462 6:161984210-161984232 ATCAGGCATAGCTGGATCCAGGG - Intronic
1018389739 6:163332786-163332808 CTCAGGTACAACGTGATCAAGGG + Intergenic
1019356903 7:585006-585028 TTCAGGCACGGCTGGATCCAGGG - Intronic
1019674915 7:2305143-2305165 CTCAGAAACAGCTGGAGGCAGGG + Intronic
1020077828 7:5270182-5270204 GTCAGGTAAGGCTAGATCCAGGG + Intergenic
1020254390 7:6494551-6494573 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1022909590 7:34887759-34887781 CTTAGGCCCAGCTGAATCCAGGG + Intergenic
1023414779 7:39921695-39921717 CTGAAGGGCAGCTGGATCCAAGG - Intergenic
1025201058 7:56961989-56962011 GTCAGGTAAGGCTAGATCCAGGG - Intergenic
1025213230 7:57033277-57033299 TTCAGGCACGGCTGCATCCAGGG + Intergenic
1025658723 7:63543547-63543569 TTCAGGCACGGCTGCATCCAGGG - Intergenic
1025670886 7:63614943-63614965 GTCAGGTAAGGCTAGATCCAGGG + Intergenic
1029598314 7:101549202-101549224 CCCAGGAACACCTGGATCCCAGG + Exonic
1030205707 7:106950493-106950515 CCCAGGGAGAGCTGGAGCCATGG + Intergenic
1030360419 7:108589763-108589785 TTCAGGCACAGCTGGACCTAGGG - Intergenic
1030979699 7:116171823-116171845 CTCAGACTCAGGTGGATCCAAGG + Intergenic
1031125674 7:117771096-117771118 CTCTGTTTCAGCTGGACCCATGG - Intronic
1031295195 7:119993134-119993156 CCCAGGAACAGATGGATTCATGG + Intergenic
1031476092 7:122223471-122223493 TACAGGTACAGCTGAATTCAGGG + Intergenic
1031605886 7:123767393-123767415 TTCAGGCTTAGCTGGATCCAGGG + Intergenic
1032443306 7:131959023-131959045 CTCAGGTAGAGGTGGATGCCAGG - Intergenic
1034526189 7:151664347-151664369 CCCGGGTACAGTGGGATCCAAGG + Intronic
1034641486 7:152607503-152607525 CTCAGGTGCAACAGGATCCAGGG - Intergenic
1035821629 8:2598996-2599018 TTCATGTCCAGCTGGAACCATGG + Intergenic
1039696073 8:39913230-39913252 GTCAGGTACAGTTAGATGCAAGG + Intronic
1041395720 8:57389136-57389158 GTTAGTTACAGCTGGATCCTGGG + Intergenic
1042385475 8:68169055-68169077 TTCAGGCACAGCTCTATCCAGGG + Intronic
1042589880 8:70387650-70387672 CTGAAGTACAGCTGGAATCAAGG + Intronic
1042705107 8:71658613-71658635 CTTAAGCACAGCTGGATCCAAGG + Intergenic
1043375434 8:79644245-79644267 ATCAGGAACAGCTGGATCCAGGG + Intronic
1043834504 8:85031660-85031682 TTCAGGTAAGGGTGGATCCAAGG - Intergenic
1044871866 8:96627655-96627677 TTCAGGCACAGCTGGATCTTGGG + Intergenic
1046156080 8:110291706-110291728 GTTAGGGCCAGCTGGATCCAAGG - Intergenic
1046164045 8:110405802-110405824 CTCAGGTACAATTGGATTGAAGG - Intergenic
1047728955 8:127709994-127710016 TTCAGGTACAGTTGGATCAAGGG - Intergenic
1048066847 8:130978966-130978988 TTCAGGCACAGCTTGGTCCAGGG - Intronic
1048491204 8:134895521-134895543 TCCAGGTAAGGCTGGATCCAGGG + Intergenic
1048491715 8:134900468-134900490 TTCAGGCACAGCTAGATCCAGGG + Intergenic
1048743321 8:137586263-137586285 GTCAGGTCCAGGTGGAACCATGG + Intergenic
1049256756 8:141618286-141618308 TTTAGGTATGGCTGGATCCAGGG + Intergenic
1050365138 9:4867171-4867193 TTCAGGTAAAGCTGGATCTAGGG + Intronic
1051437349 9:17047232-17047254 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1052273959 9:26657354-26657376 TTCAGGCACCACTGGATCCAGGG + Intergenic
1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG + Intronic
1056774769 9:89503211-89503233 TCCAGGTACAGTTAGATCCAGGG + Intergenic
1057152414 9:92807795-92807817 CTCAGGTCCAGCCGCCTCCAGGG + Intergenic
1057916281 9:99058022-99058044 CTCAGGAACAGCCAGAGCCAGGG + Intronic
1058292240 9:103257008-103257030 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1058652341 9:107188510-107188532 CTCATGTACAGCTGGGACGAAGG - Intergenic
1058727208 9:107815696-107815718 TTTAGGTGCAGCTGGATTCAGGG + Intergenic
1059566206 9:115385451-115385473 CTCAGGTACAGCTGCAGCCGCGG + Intronic
1059671360 9:116495496-116495518 CTCAGACACAACTGGGTCCAGGG - Intronic
1059976310 9:119721589-119721611 TTCAGGAACAACTGCATCCAGGG + Intergenic
1060377100 9:123126075-123126097 CTCAGCTCCAGCTGGAGCCATGG + Intronic
1060395876 9:123316138-123316160 TTCAGGTATGGCTGGATCTAGGG + Intergenic
1060561040 9:124543738-124543760 TTCAGGAACAGCTGGAGCCCTGG + Intronic
1061161207 9:128895486-128895508 CTCAGGCACAGGTGGATCTCAGG - Intronic
1185488254 X:499287-499309 CTCAGATGCAGCTGCATCCCGGG - Intergenic
1187006424 X:15237504-15237526 CTCAGGTACAGCTGTAGCTTGGG - Intronic
1187561470 X:20407411-20407433 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1188731185 X:33648098-33648120 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1189028842 X:37428982-37429004 CTAAGGTACAGCTTGGCCCATGG - Intronic
1189308020 X:40001923-40001945 TTCAGGTTCAACTGGATCCAGGG + Intergenic
1190063065 X:47223178-47223200 CTCAGGTACAGCTGCAGTGATGG - Exonic
1190364208 X:49676419-49676441 TGGGGGTACAGCTGGATCCAGGG + Intergenic
1192049507 X:67711123-67711145 TTCAGGCAGAGCTGGATCCAAGG + Intronic
1195154533 X:102109945-102109967 CTAAGGTACAGCTTGGGCCATGG + Intergenic
1195374608 X:104214627-104214649 CCAAGGTCCAGCTGGATTCATGG + Intergenic
1196668473 X:118341559-118341581 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1197137120 X:123074436-123074458 CTCAGGGACAGCTTCATGCAGGG + Intergenic
1198191990 X:134316237-134316259 GTCAGGTAGAGCTGGTGCCAGGG - Intergenic
1198390877 X:136172577-136172599 CCCAGGGACAGCTGCATCCATGG - Intronic
1198866623 X:141129998-141130020 CTCAGGCACAACTACATCCAGGG + Intergenic
1200972390 Y:9167049-9167071 CTCAGTTACTACTGCATCCATGG - Intergenic
1202019809 Y:20452629-20452651 AAAAGGTACAGCTTGATCCATGG + Intergenic
1202138631 Y:21697202-21697224 CTCAGTTACTACTGCATCCATGG + Intergenic