ID: 975983264

View in Genome Browser
Species Human (GRCh38)
Location 4:80182858-80182880
Sequence CTTTGGGATGGGAGTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975983251_975983264 30 Left 975983251 4:80182805-80182827 CCATTCTGCCGGACACAAGACAG No data
Right 975983264 4:80182858-80182880 CTTTGGGATGGGAGTAGATCTGG No data
975983254_975983264 22 Left 975983254 4:80182813-80182835 CCGGACACAAGACAGCTGAGGGG No data
Right 975983264 4:80182858-80182880 CTTTGGGATGGGAGTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975983264 Original CRISPR CTTTGGGATGGGAGTAGATC TGG Intergenic
No off target data available for this crispr