ID: 975984560

View in Genome Browser
Species Human (GRCh38)
Location 4:80190325-80190347
Sequence GGGAGGAAATGCAGTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975984560_975984562 -9 Left 975984560 4:80190325-80190347 CCTTGGGAACTGCATTTCCTCCC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 975984562 4:80190339-80190361 TTTCCTCCCTGCTTCGCCCAGGG No data
975984560_975984566 0 Left 975984560 4:80190325-80190347 CCTTGGGAACTGCATTTCCTCCC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 975984566 4:80190348-80190370 TGCTTCGCCCAGGGCTCATTTGG 0: 1
1: 0
2: 0
3: 8
4: 70
975984560_975984561 -10 Left 975984560 4:80190325-80190347 CCTTGGGAACTGCATTTCCTCCC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 975984561 4:80190338-80190360 ATTTCCTCCCTGCTTCGCCCAGG No data
975984560_975984569 23 Left 975984560 4:80190325-80190347 CCTTGGGAACTGCATTTCCTCCC 0: 1
1: 0
2: 1
3: 27
4: 242
Right 975984569 4:80190371-80190393 AGCGTACCAAGCGCACCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975984560 Original CRISPR GGGAGGAAATGCAGTTCCCA AGG (reversed) Intronic
902123539 1:14188706-14188728 GGGAAGAAATGCTTTGCCCATGG - Intergenic
903361934 1:22782443-22782465 TGGGGGGAATGCAGTTCCCTGGG - Intronic
904040850 1:27584145-27584167 GAGAGGGAAAGCAGCTCCCAGGG + Intronic
904435223 1:30490603-30490625 GGCAGGAAATGGACTTCCCCAGG + Intergenic
904877671 1:33669096-33669118 TGGAGGAACTGAAGTTCCAAGGG + Intronic
906191723 1:43903407-43903429 GGGTTGGAAGGCAGTTCCCAGGG - Intronic
906840373 1:49132003-49132025 TGGAGTAGATGCATTTCCCAGGG + Intronic
907475298 1:54701379-54701401 AGGTGGAAATGCAGCCCCCAAGG - Intronic
907723419 1:56995771-56995793 GGTAAGATAGGCAGTTCCCATGG - Exonic
909397675 1:75188556-75188578 TGGAGGACAGGCAGTTCCAAGGG - Intergenic
910341875 1:86197791-86197813 GGGAGAAAATGGAGTGCACATGG - Intergenic
911264637 1:95728340-95728362 GGGAGTAAATACAGTTACAAAGG + Intergenic
911832275 1:102566793-102566815 GTTGGGAAAAGCAGTTCCCAAGG + Intergenic
912472263 1:109913781-109913803 GGGAGGAAATGCTGGGCCCAGGG + Intronic
912502806 1:110133377-110133399 GGGAGGGGATGCCTTTCCCACGG + Intergenic
915109401 1:153553480-153553502 GGGAGGCGGTGCAGTTTCCAAGG - Intergenic
915972002 1:160361744-160361766 GGGAGGAAATGCCCTTTCCAAGG - Intergenic
917160698 1:172054270-172054292 GGGAAGAAATGCATTTCCCCAGG - Intronic
920072007 1:203308717-203308739 GGGAGAAAAAACAGTGCCCAAGG - Exonic
920229294 1:204459995-204460017 GGGAGAAAATGGGTTTCCCAGGG - Intronic
922112485 1:222574880-222574902 GGGAGGAAATGCAGTCAGGAAGG + Intronic
923071117 1:230565316-230565338 GGGAGGAATTGGAGTTGACATGG - Intergenic
1062801584 10:385102-385124 GGGAGGAGAAGCAGCTCTCATGG + Intronic
1064378638 10:14820279-14820301 GGGAAGAATTCCAGTTTCCATGG + Intronic
1064944517 10:20772753-20772775 GGGAGGAACTGAACTTCCAATGG + Intergenic
1065749979 10:28876919-28876941 GGGAGGAAGTTCAGTACCTAAGG - Intronic
1066069527 10:31792706-31792728 AAGAGTAAATGCAGTTCCCTAGG - Intergenic
1066839179 10:39884049-39884071 AGGAGGAAATCCCGTTTCCAAGG - Intergenic
1066841825 10:39931619-39931641 AGGAGGAAATCCCGTTTCCAAGG - Intergenic
1069375446 10:67788404-67788426 GGGAGGAAAGGCATTTGCAAGGG + Intergenic
1071056741 10:81520212-81520234 GGGAGGTGATTCAGTTCACAAGG + Intergenic
1073042528 10:100617390-100617412 GGGAGGTAAGGAAGTTCCAAAGG - Intergenic
1074191914 10:111145595-111145617 GGGAGGAGATGATGCTCCCAAGG + Intergenic
1074298748 10:112214238-112214260 GAGAGGAAATGCGGTTGGCATGG + Intronic
1075372449 10:121949488-121949510 GTGAGGAAATACATTTACCATGG + Intergenic
1075392001 10:122098929-122098951 GGAAGGGAATGCATTCCCCACGG - Intronic
1075728607 10:124623283-124623305 GGGAGCAGAGGCTGTTCCCAGGG + Exonic
1076991418 11:278097-278119 GGGAGGGAAGGCAGTCTCCAGGG - Intergenic
1077174125 11:1181005-1181027 GGGGTGCAATGCAGTTCCCAGGG + Intronic
1078561416 11:12376647-12376669 AGGAGGAAACACAGTTGCCAAGG + Intergenic
1078942246 11:16020440-16020462 TGGAGGAAATGCAGTAGACATGG - Intronic
1078956259 11:16198773-16198795 GGGAGCAAATACAGATCTCAAGG + Intronic
1079524620 11:21370227-21370249 GTGTGGAAATGCTGGTCCCAAGG - Intronic
1082211538 11:49508662-49508684 GGGAAAAAATGCTGTTTCCAAGG - Intergenic
1085173151 11:74465696-74465718 GGAAGTAAATGCAGTGCTCAAGG - Intronic
1086861891 11:91934252-91934274 AGGAGGAATTGCACCTCCCAAGG + Intergenic
1087161038 11:94948355-94948377 GAGAGGAAATGCAGTTGGAATGG - Intergenic
1088169051 11:106974833-106974855 GAGAGGAAATGCACTTAGCAAGG + Intronic
1089997108 11:122918890-122918912 GGAAGAAAAAGCAGTTACCAGGG + Intronic
1090011225 11:123047510-123047532 GGAAGTAAATGCAGTTGACACGG + Intergenic
1090458532 11:126869893-126869915 GTGATGAAATTCAGTTCCCAAGG + Intronic
1090682644 11:129077732-129077754 GTGAGGCCATGGAGTTCCCAAGG - Intronic
1091144851 11:133269678-133269700 GGAATGAAATTCAGCTCCCATGG - Intronic
1091578994 12:1769336-1769358 GGTGGTAAATGCAGTTCCCTGGG - Intronic
1091596364 12:1881578-1881600 GAGAGGAAGTGCAGGTGCCAGGG + Intronic
1091780882 12:3213897-3213919 GGGAGGAAATGCAGGATGCATGG - Intronic
1093013307 12:14130844-14130866 GGGAGGGAGTCCAGTTCTCAGGG + Intergenic
1093241727 12:16684947-16684969 AGGAAGAGATGCAGTTCACAAGG - Intergenic
1094637463 12:32240303-32240325 GGCCGGAAATGCAGTTCACTGGG + Intronic
1096355546 12:50938085-50938107 GGGAGGAAGTTCAGTTTCCTAGG - Intergenic
1097179379 12:57162595-57162617 GGGAGTGAAGGCACTTCCCAGGG + Intronic
1097836115 12:64274176-64274198 GGGAGGGAAAGCATTTCCAATGG + Intronic
1098535256 12:71587065-71587087 ATGAGGACATGCAATTCCCAGGG + Intergenic
1101320705 12:103670671-103670693 GGGAGCAAAGGCAGGGCCCATGG - Intronic
1101402976 12:104404352-104404374 GGCTGGATCTGCAGTTCCCAGGG - Intergenic
1101984244 12:109433200-109433222 GGGAGGAAATGAAGTTATAAAGG + Intronic
1104565646 12:129878922-129878944 GGGAGGAGATGGTGTTTCCAGGG - Intronic
1105874261 13:24539607-24539629 AGGAGGAAGTGCAGGCCCCAAGG - Intergenic
1105954511 13:25268160-25268182 TGTAGGAGATGCAGTTCCCAGGG - Intronic
1106507181 13:30381358-30381380 GGGACCAAAAGCAGTTTCCATGG + Intergenic
1107111012 13:36698300-36698322 GGGAGCAACTGCAGTTACAAGGG - Intergenic
1108492800 13:50998479-50998501 GTGAGGAAATGCTGTTGCCTTGG + Intergenic
1109453524 13:62551156-62551178 GAAAGGAAATACAGTTCTCAAGG - Intergenic
1111331375 13:86764179-86764201 AGGAGCCACTGCAGTTCCCAGGG - Intergenic
1111606351 13:90545245-90545267 GGGAGGAACTGGAGTACACAAGG + Intergenic
1114659204 14:24334153-24334175 GGCAGGAAATGAATTCCCCAGGG + Intronic
1115002610 14:28440463-28440485 GGGGGTAAATGCAGTGCTCAAGG + Intergenic
1116206113 14:41868902-41868924 TGGAGGGAATGTAGTTTCCATGG - Intronic
1117522319 14:56563043-56563065 GGGAGGAAATGAAACTTCCAGGG + Intronic
1120807580 14:88769331-88769353 GGGAGGCAAGGCACTTCACATGG - Intronic
1121247409 14:92472012-92472034 GGGAGAAACTGCCCTTCCCAGGG + Intronic
1121691604 14:95881616-95881638 GGGAGGAAATGTAGGTCTCAAGG + Intergenic
1122762745 14:104042010-104042032 GGGATGAAATTCAGTTACGACGG + Intronic
1122893519 14:104743999-104744021 GGGAGGAAAAACAGAGCCCATGG + Intronic
1123635923 15:22358920-22358942 GGGAGGTAATGCAGTGGACAGGG - Intergenic
1127781702 15:62322032-62322054 GTGAGGAAAAGCAGTTTCTAGGG + Intergenic
1127846528 15:62875820-62875842 GGCAGGAAATGCCGTGGCCATGG - Intergenic
1128667111 15:69546749-69546771 AGGAAGAAATTCAGTTTCCAGGG - Intergenic
1129777650 15:78247210-78247232 GGAAGGAAATGCAGTTTCATAGG + Intergenic
1132695748 16:1201051-1201073 GGGAGGCTATGCACTCCCCAGGG - Intronic
1133148417 16:3808017-3808039 GGCAACCAATGCAGTTCCCATGG + Intronic
1134058948 16:11187592-11187614 GGGAGGAAAGGCAGGTGCCAAGG - Intergenic
1134393155 16:13838415-13838437 GGAAGGAACTTCAGTTCTCAGGG + Intergenic
1137595425 16:49720405-49720427 GGGTGGGATTGCAGCTCCCAGGG - Intronic
1138233949 16:55364233-55364255 GAGAGAAAATGCCTTTCCCAGGG - Intergenic
1144114029 17:12068117-12068139 GGAAGGAATGGCAGTTCACATGG + Intronic
1144955468 17:19016882-19016904 AGGAGGGCATCCAGTTCCCAGGG - Intronic
1145194233 17:20873778-20873800 GGCAGGAAATGCTGTGCCCCGGG - Intronic
1147200223 17:38796485-38796507 TGGATGAAATACAGTTCCGAGGG - Intronic
1148664864 17:49366879-49366901 GTGAGGAAATGCAGTGAGCAGGG - Intergenic
1150954298 17:69839827-69839849 AGGAGGAAATGCAACTGCCAAGG + Intergenic
1151604834 17:75129768-75129790 GGGAGAAGATGCAGTTACCAGGG - Exonic
1151828470 17:76536678-76536700 GGGAGGAAATGCAGTGGCTTGGG - Intronic
1153582818 18:6592483-6592505 TGGAGGAACTGGACTTCCCAAGG - Intergenic
1153598294 18:6751714-6751736 GGGAGCAACTGCTGTTGCCAGGG - Intronic
1154446314 18:14438578-14438600 GGGAGGATATCCCCTTCCCACGG + Intergenic
1155251934 18:23961008-23961030 GGGGGAAAATGCAGGTTCCAGGG - Intergenic
1156232840 18:35171740-35171762 GGGAGAAAATGAAGTTCAAAAGG + Intergenic
1156914258 18:42447125-42447147 GGGAGGTAATGTAGATCACAAGG - Intergenic
1157351689 18:46893763-46893785 GGGATGAAATGACTTTCCCAGGG - Intronic
1158511159 18:58091926-58091948 GGGAAGCAACACAGTTCCCAGGG - Intronic
1160402053 18:78618467-78618489 GTGAGGAAATGCAGGTACCCAGG - Intergenic
1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG + Intronic
1162654192 19:12116521-12116543 GGAGGGAAATGGAGCTCCCATGG + Intronic
1166603531 19:44119166-44119188 GGGATGAAAAGCAGATCACATGG - Intronic
1166953702 19:46447820-46447842 GGGAGGAAATGGCTTTCGCATGG + Intergenic
1167082756 19:47288500-47288522 GGGAGGATGTGCTGTTGCCAGGG - Intergenic
938627875 2:133131346-133131368 GGGAGGAAATGCAGTGATGAGGG - Intronic
938931402 2:136089408-136089430 GTGAGGAAATGGAATTCCCATGG - Intergenic
939227015 2:139377252-139377274 GGGAGGGTAGGCAGTGCCCAGGG + Intergenic
939679924 2:145117685-145117707 GGGCAAAAATTCAGTTCCCATGG + Intergenic
941047144 2:160689574-160689596 GGGAAGGAAGGCAGTTACCAGGG - Intergenic
944949098 2:204726729-204726751 GGGAGGAAATGCAATTGAAAAGG - Intronic
946136376 2:217651062-217651084 GGAATGAAATGCAGCTGCCAGGG - Intronic
946386376 2:219386851-219386873 GGGTGGAAAGGCAGGTCCCTAGG - Intronic
946800692 2:223413235-223413257 GGGAGGAAAGGCAGGTCCAGGGG - Intergenic
947036004 2:225856667-225856689 GGGAAAAAATACAGTTACCAGGG + Intergenic
947226674 2:227847392-227847414 GGGAAGAATTGCAGTGCCGAAGG - Intergenic
947276955 2:228402175-228402197 TAGAGGCAATGCAGTTACCAAGG - Intergenic
947960882 2:234236275-234236297 AGCAGGATATGCAGTTCCCCAGG + Intergenic
948201192 2:236130766-236130788 GGCAGGAAATGCATTTGCCCAGG - Exonic
948686064 2:239670393-239670415 GTAAGGAACTGCAGTTCCCCAGG + Intergenic
948945083 2:241215279-241215301 AGGAGGAAAAGGAGGTCCCAGGG + Intronic
1168807525 20:681235-681257 AGGAAGAAGGGCAGTTCCCAGGG + Intergenic
1169497440 20:6128955-6128977 GGGGGGAACTGCAGATCCCATGG - Intergenic
1170459899 20:16567635-16567657 AGGAGGAAATGCAATTGCCAAGG + Intronic
1171230351 20:23479389-23479411 GGGAGAGAATGAACTTCCCAAGG - Intergenic
1171447893 20:25217618-25217640 GGGTGGGTATGCAGCTCCCAGGG + Intronic
1171968445 20:31548418-31548440 GGGAAGAGATGCAGGTCTCAAGG - Intronic
1172485119 20:35293194-35293216 GTGATGAAATGCAGATCCCCGGG + Intergenic
1173083666 20:39893889-39893911 GGAAGAAAATCCAGTTACCAAGG - Intergenic
1174152269 20:48493880-48493902 GGGGGGAACTGCAGTGGCCAAGG - Intergenic
1175605503 20:60308995-60309017 GGGAAGAAATGCAGTGCCAGTGG - Intergenic
1175637286 20:60596473-60596495 GGGAGGAAAGGGAGTGCCGATGG - Intergenic
1176235444 20:64051517-64051539 GGAAGGATTTGCAGTTCCCTGGG + Intronic
1177249212 21:18570336-18570358 GGGAGGAACTGCTGCTGCCAGGG + Intergenic
1179665197 21:42906485-42906507 ATCAGGAAATGCAGTTCCTAAGG - Intronic
1180046905 21:45310766-45310788 GGGAGGAGAGGCAGGTGCCAGGG - Intergenic
1180057803 21:45367889-45367911 GGGAGCAAACGCAGTGCACACGG + Intergenic
1181358745 22:22318857-22318879 GGGTGATAAGGCAGTTCCCAGGG - Intergenic
1181421053 22:22799390-22799412 TGGAGGAAAGGCAGTGCCGAGGG + Intronic
950930349 3:16783204-16783226 GTGAGGAGAAGTAGTTCCCAGGG + Intergenic
952341139 3:32448654-32448676 GGGTGGAAATGCATGGCCCATGG + Intronic
952965426 3:38618138-38618160 GGGTGGGAATGCAGTGCCAAGGG - Intronic
952978977 3:38719962-38719984 GGGAGGATAAGCATTTCCCAAGG - Intronic
952996060 3:38883481-38883503 GGGAGCAACTGCAGGTCGCATGG - Intronic
953026155 3:39146441-39146463 GGCAGGTGATGGAGTTCCCAGGG + Intronic
953193729 3:40713072-40713094 GAGAGGAAATGCTGTGGCCAGGG - Intergenic
953347568 3:42188969-42188991 GGGAGGAAATGCGTCTCCCTAGG + Intronic
953408055 3:42669740-42669762 GGAAGGAAAAGCAGCTCCAAAGG + Intergenic
953528048 3:43711801-43711823 GGGAGTCAATGCTGCTCCCAAGG - Exonic
954035594 3:47849361-47849383 GGGAGGGAATGGAGTTCACCAGG + Intronic
954266437 3:49473473-49473495 AAGAGGAAATGCAGTACCCCAGG - Intronic
955503071 3:59604368-59604390 GGTAGAAAATGCAGTTGCCAAGG + Intergenic
956474731 3:69608150-69608172 GGGAAAAAAAGCTGTTCCCAGGG + Intergenic
959325649 3:104933442-104933464 GGGAGGAATTGCAGTCCCATTGG - Intergenic
960253887 3:115489493-115489515 GGGAGGAAAGGCTTTTCCCGAGG + Intergenic
961090386 3:124106257-124106279 ATGAGGAAATGCAGTTCAGATGG + Intronic
961166504 3:124767154-124767176 GTGAGGAAATGCAGTGGCAATGG + Intronic
962500729 3:135989155-135989177 AGTAGGAAATGCAGCTTCCAAGG + Intronic
963546017 3:146659055-146659077 AGGTGGAACTGCACTTCCCAAGG + Intergenic
963836451 3:150062515-150062537 GGGAGAAAAAGCTGTTCCAAAGG + Intergenic
964185522 3:153937980-153938002 GGGGGGAAATGCAACTCCAATGG + Intergenic
965925018 3:173967679-173967701 GGGATGAAATGCATTTCAGAAGG - Intronic
966885296 3:184374313-184374335 GGGAAGAAGGGCAGTTCCTATGG - Intronic
967425581 3:189323531-189323553 TGGAGGAAATGTAGTTCCCTTGG - Exonic
967872998 3:194247874-194247896 GGGAGCGTATGCATTTCCCAGGG + Intergenic
967969534 3:194988741-194988763 GGGATGAAGTGAATTTCCCAAGG - Intergenic
968074574 3:195809441-195809463 GGCAGGAAAAGCAGTCACCAAGG - Intronic
968842826 4:3020655-3020677 GGGAGGAAATGAAATTACCCAGG - Intronic
969110416 4:4840793-4840815 GGAAGGAAATGCAGCCCCAAGGG - Intergenic
969148291 4:5143498-5143520 GGGAGGATGTTCAGTTCTCAAGG + Intronic
970301037 4:14681469-14681491 GGCAGGCAATGCCGTTTCCATGG + Intergenic
975984560 4:80190325-80190347 GGGAGGAAATGCAGTTCCCAAGG - Intronic
976593558 4:86873223-86873245 GGGAGAAAAAGCAGGTCTCATGG + Intergenic
977558412 4:98508034-98508056 GGGAGGAAACGGATTCCCCATGG + Intronic
981406830 4:144380949-144380971 GGGAAGAAATGGTGTTCTCAAGG - Intergenic
981750656 4:148090269-148090291 GGGAGGAGGTGCAGTTCAGAGGG + Intronic
982208360 4:153014786-153014808 AGGAGGAAAGGCAGTTCAGAAGG - Intergenic
982209386 4:153022349-153022371 GGAAGGAAATGCATTTCCAGAGG - Intergenic
982215113 4:153075990-153076012 TTGAAGAACTGCAGTTCCCAGGG - Intergenic
983955913 4:173698667-173698689 GGGAGGACATGCACTGCTCAGGG + Intergenic
984781249 4:183527816-183527838 GGTAGGAAATCCACTTCTCAGGG + Intergenic
985034436 4:185824049-185824071 GGGAGCAAATGCAGTAACCATGG - Intronic
985244153 4:187962765-187962787 GGAAGGGAGTGCAGTTCCCAGGG - Intergenic
986430225 5:7674009-7674031 AGGAGGAAAGGCTGTTCCCTGGG + Intronic
986559246 5:9044259-9044281 GGGAGAAAATTCAGTTTCAAAGG + Intronic
988692751 5:33588885-33588907 GGGCAGAAATGCAGATCACAGGG + Intronic
989457635 5:41661693-41661715 GGTAGGCAATTCAGTTCACATGG + Intergenic
989523987 5:42431788-42431810 GGGAAGAAGTGCACTTCACAGGG + Intronic
990037897 5:51345217-51345239 GGGAGGAAATCCAGGCCACAGGG + Intergenic
992340251 5:75815652-75815674 AGGTGGAAATTCAGTTTCCATGG - Intergenic
992397895 5:76384415-76384437 GGGGAGAAATGCAGTTTGCAAGG + Intergenic
993662396 5:90653894-90653916 GGATGGAAATGCAATGCCCAGGG + Exonic
998097772 5:139406579-139406601 GGGAGGAAGTGCAGTTCTTGGGG - Intergenic
999380794 5:151119584-151119606 GGAAGGCAAAGCAGTTCACATGG - Intronic
1000310059 5:160033865-160033887 GGGAGGAAATACAGTTAGCAGGG - Intronic
1001412214 5:171519799-171519821 GGGAGGAAATGATGTCCCCAAGG + Intergenic
1002156234 5:177282655-177282677 GGCATGTAACGCAGTTCCCAAGG + Intronic
1002885005 6:1285756-1285778 CGGAGGAAATGCAGCTTCCCTGG - Intergenic
1003300892 6:4882118-4882140 GGGAGCAAGCGCAGTACCCAGGG - Intronic
1003497044 6:6673313-6673335 GGGAGGAAATCGATTTCCCAAGG - Intergenic
1005990425 6:30898697-30898719 GAGAGGAAAGGCAGAGCCCAAGG + Intronic
1006975233 6:38094303-38094325 TGGATTAAATGCAGTACCCATGG - Intronic
1007195340 6:40055612-40055634 GGGATGGAATGGAGTTCCCGGGG + Intergenic
1007688901 6:43685144-43685166 ATGAGGAAATGCCGTTCCAAGGG - Intronic
1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG + Intergenic
1010210859 6:73362274-73362296 GGGAGGAAACGTAGTGGCCAGGG + Intergenic
1014583663 6:123170245-123170267 AGGAGGAAATTCAGTTAACATGG + Intergenic
1015552125 6:134422567-134422589 GAGAGGAAATGCATTTTCCCTGG - Intergenic
1017324487 6:153130615-153130637 GGGAGGAAACACAGCACCCAAGG + Intronic
1017384389 6:153866765-153866787 GGTAGGAAACACAGTTACCAAGG - Intergenic
1018906728 6:168079976-168079998 GTCAGGAGAGGCAGTTCCCACGG + Intronic
1019516990 7:1444522-1444544 TGGGGGAAGTGCAGTCCCCAAGG + Intronic
1021491411 7:21223309-21223331 GGGAGGAAGTCCAGTCTCCAAGG - Intergenic
1022489448 7:30805400-30805422 GGGCAGAAACGCAGATCCCAGGG + Intronic
1022879048 7:34566849-34566871 GGGTGGAAAGCCACTTCCCATGG - Intergenic
1023137181 7:37064349-37064371 CAGAGGATATGCAGATCCCAGGG - Intronic
1024594103 7:50917688-50917710 GGGAGGAACTGATGTTCACAGGG - Intergenic
1025998247 7:66541993-66542015 CCCAGGAGATGCAGTTCCCAAGG + Intergenic
1026991203 7:74586790-74586812 GCCAGGAGATGCAGTTCCCAAGG + Intronic
1027711376 7:81605703-81605725 GTGGGGAATTGCAGTGCCCATGG - Intergenic
1028193058 7:87874911-87874933 GGGAGGAAATGAAATTGCCAAGG - Intronic
1029604432 7:101590176-101590198 GTGAGGAAATGCAGTTGCACAGG + Intergenic
1029640882 7:101817812-101817834 GGGAGTAGCTGCAGTTCCCCAGG - Intronic
1031187666 7:118503323-118503345 GAGAGAAAATGGAGTTCACAAGG + Intergenic
1034460152 7:151193590-151193612 GGGAGGAGGTGCAGATCACAGGG + Intronic
1035443336 7:158922045-158922067 GGGAGGTAATGCAGTGCGCCTGG - Intronic
1035782571 8:2239995-2240017 GGTAGGAAATGCATTTCCTTCGG - Intergenic
1035809549 8:2479593-2479615 GGTAGGAAATGCATTTCCTTTGG + Intergenic
1035980045 8:4360312-4360334 AGGAGGATTTGCACTTCCCATGG - Intronic
1036084171 8:5595314-5595336 TCTAGGAAATGAAGTTCCCAGGG + Intergenic
1036824719 8:11967123-11967145 GGGAGCACATGCTGCTCCCAGGG - Intergenic
1037532007 8:19785979-19786001 TGGAGGAAAAACATTTCCCAGGG + Intergenic
1041623366 8:59999041-59999063 GGGATGGGATGTAGTTCCCAGGG + Intergenic
1041627774 8:60050274-60050296 GGGAGTAAATGCAGGTCCCATGG - Intergenic
1042487334 8:69361118-69361140 GAGAGGAATTCCAGTTTCCATGG - Intergenic
1045056576 8:98373325-98373347 GGGAGGAAATGCACTTTACATGG - Intergenic
1045057375 8:98381326-98381348 GGGTGGAAATGCAGATCTCAGGG - Intergenic
1045494985 8:102700562-102700584 GGGATGGAATGCAGAGCCCACGG + Intergenic
1045830604 8:106455688-106455710 GGGCAGAAATGCAGTTACCTGGG + Intronic
1048574767 8:135681777-135681799 GGGAGGAACAGTAGATCCCATGG + Intergenic
1049209412 8:141378666-141378688 GTGAGGAAGTGCAGAGCCCATGG - Intergenic
1049706618 8:144046098-144046120 GGGAGGAAAGGGAGTCCCCTAGG + Intronic
1051336581 9:16071145-16071167 GAGAGGAGATGGAGTTCCGATGG + Intergenic
1052182795 9:25551021-25551043 GGCAGGAAATACAGTAGCCAAGG - Intergenic
1061780990 9:132995982-132996004 GGATGGAAATGCATCTCCCAGGG + Intergenic
1062713047 9:137987094-137987116 GGGAGCAAGTGTAGTTCCCGGGG + Intronic
1186189361 X:7053735-7053757 GGAGGGAAATGCAGGCCCCATGG + Intronic
1187877301 X:23815017-23815039 GTGAGGAAATGCAGGCCCCATGG - Intergenic
1188076847 X:25787589-25787611 TGAAGGAAATCCAGTTACCAAGG + Intergenic
1188225487 X:27592280-27592302 GGCAGCACATGCAGTTCCCCAGG - Intronic
1189241994 X:39532434-39532456 GGGAGGAATGGCAATTCTCATGG + Intergenic
1189355838 X:40309341-40309363 GGGAGGAAACCCAGGTCACATGG + Intergenic
1189437092 X:41002513-41002535 AGGAGGAAAAGCGATTCCCAGGG - Intergenic
1191939358 X:66461677-66461699 GGGAGGAAATTTAGCTCCTAAGG + Intergenic
1192210362 X:69123852-69123874 TGGAGGTAATGCAGGTCCCAGGG + Intergenic
1192736846 X:73857167-73857189 GGGAGGAATTTTATTTCCCAAGG + Intergenic
1195994898 X:110721979-110722001 GGGAGGGAATAAAGTTACCAGGG - Intronic
1197435745 X:126425836-126425858 GAGAGGAATAGCAGATCCCAAGG - Intergenic
1197952076 X:131908318-131908340 GGGAGGAAATGCATGCCCAATGG - Intergenic