ID: 975985942

View in Genome Browser
Species Human (GRCh38)
Location 4:80202027-80202049
Sequence CCCCAAGACGAACAAGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975985937_975985942 7 Left 975985937 4:80201997-80202019 CCCAAGAGACTTCACAGCGCTGA 0: 1
1: 0
2: 0
3: 14
4: 104
Right 975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
975985936_975985942 8 Left 975985936 4:80201996-80202018 CCCCAAGAGACTTCACAGCGCTG 0: 1
1: 0
2: 0
3: 10
4: 180
Right 975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
975985935_975985942 14 Left 975985935 4:80201990-80202012 CCGCTGCCCCAAGAGACTTCACA 0: 1
1: 0
2: 1
3: 18
4: 243
Right 975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
975985938_975985942 6 Left 975985938 4:80201998-80202020 CCAAGAGACTTCACAGCGCTGAT 0: 1
1: 0
2: 1
3: 8
4: 141
Right 975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975985942 Original CRISPR CCCCAAGACGAACAAGGCGG CGG Exonic
901798708 1:11694781-11694803 CCCCAAGAAGAAGAAGGTTGTGG + Intronic
911682092 1:100728600-100728622 CCTCAAGAAGAAAAAGGAGGGGG + Intronic
913681197 1:121187772-121187794 CCCCAAGCCGGACAGGGTGGGGG + Intronic
920468512 1:206206297-206206319 CCCCAAGCCGGACAGGGTGGGGG + Intronic
1064521591 10:16208946-16208968 CCCCAAAACCAACAATGCTGTGG + Intergenic
1072547357 10:96449893-96449915 CCCCAAGAGGAGCAGGGGGGCGG - Intronic
1076034823 10:127190725-127190747 ACCCAAGGCCAGCAAGGCGGTGG - Intronic
1076987947 11:252969-252991 CCACAAGAAGAACAAAGCAGAGG - Exonic
1082822918 11:57556796-57556818 CCCCAAGACCTACGTGGCGGTGG + Intronic
1083740211 11:64705939-64705961 CCCCAAGACAACCAAGGCTCAGG + Intronic
1087083628 11:94195638-94195660 CCTCAAGACGAGCAAGGAGGTGG - Intergenic
1088167706 11:106957507-106957529 CCCCAAGCCAAAGGAGGCGGTGG - Intronic
1097145145 12:56934843-56934865 CCCCAAGAGAAACAAGTCGCAGG + Intergenic
1103341412 12:120223072-120223094 TCCCAAGGAGAACAAGGCAGAGG + Intronic
1104954031 12:132455063-132455085 CCCCAAGACGAAGTGGGCCGTGG + Intergenic
1108962045 13:56246703-56246725 CCCCAAGACCAATAATGCTGTGG + Intergenic
1121118322 14:91359090-91359112 TCCCAGGAGGAACAAGGCGGTGG + Intronic
1127575425 15:60287139-60287161 CCCCAAGACCGACCAGGCAGAGG + Intergenic
1135295855 16:21278474-21278496 CCCCAAGATGGACATCGCGGTGG + Intronic
1137749076 16:50845360-50845382 CCCCAAGGCAAGCAAGGCAGAGG - Intergenic
1142140673 16:88471429-88471451 CCCCAAGATGACCATGGCTGCGG + Intronic
1142140701 16:88471536-88471558 CCCCAAGATGACCATGGCTGCGG + Intronic
1142957727 17:3532656-3532678 CGCCAAGATGGGCAAGGCGGAGG - Exonic
1143783085 17:9239656-9239678 CCTGAAGGCGGACAAGGCGGGGG + Exonic
1146744927 17:35320014-35320036 CCCCAAGCCCAACAATGCTGTGG + Intergenic
1148910456 17:50939801-50939823 CCCCATGCAGAGCAAGGCGGGGG - Intergenic
1154383022 18:13869468-13869490 CGCAAAGAAGAAAAAGGCGGCGG - Intergenic
1158491936 18:57917951-57917973 CCCCATTACCAACAAGGTGGGGG + Intergenic
1162726855 19:12695077-12695099 CCCCAAGCCGACCCAGGCTGTGG + Intronic
1163366525 19:16878776-16878798 CCCCGACACGACCAAGGCCGAGG - Exonic
1166217426 19:41344681-41344703 CCCCAGGACAAACAATGGGGTGG + Intronic
1168070991 19:53951686-53951708 CCTCAAGAGGAACAGGGTGGTGG - Intergenic
935654500 2:105410193-105410215 CCCCAAAAGGAATCAGGCGGAGG + Intronic
946689212 2:222298385-222298407 CCCCAAGAAGCACCAGTCGGGGG - Intronic
947179977 2:227403186-227403208 CCAGAAAACGAACAAGGAGGAGG + Intergenic
1173017094 20:39235544-39235566 CCCAAATACGGACAAGGAGGCGG - Intergenic
1176573879 21:8433847-8433869 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1179047291 21:37857323-37857345 CCCCAGGATGAAGAAGGCTGTGG - Intronic
1179218373 21:39386167-39386189 CCCCTAGAGGAAAAAGGAGGTGG - Intronic
1203259979 22_KI270733v1_random:167981-168003 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
950867273 3:16199166-16199188 CACCAAGAGGAACAAGCCAGTGG - Intronic
955692735 3:61606319-61606341 CTCCAAGGCCAACAAGGTGGTGG + Intronic
965099718 3:164279418-164279440 CCCCAAGACTAATAATGCTGTGG - Intergenic
969299810 4:6291300-6291322 CCCCAAGAAGAAGAAGCAGGTGG + Exonic
975694744 4:77001060-77001082 CTCTAAGGTGAACAAGGCGGGGG - Intronic
975985942 4:80202027-80202049 CCCCAAGACGAACAAGGCGGCGG + Exonic
982496360 4:156098285-156098307 CCCCAAAACGAACACAGCAGTGG - Intergenic
985865350 5:2509873-2509895 CCCCAAAAAGGACAAGTCGGGGG - Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1006116007 6:31776554-31776576 CCTCAAGACGAAGAGGGGGGCGG + Exonic
1006458200 6:34143860-34143882 CCCCAGAACGGACAAGGCGAGGG + Intronic
1008099674 6:47377466-47377488 CGCCAAGAGGAATAAGGCTGGGG - Intergenic
1009853687 6:69232341-69232363 CCCCACCACGAACAAGACGTAGG + Intronic
1012003736 6:93685879-93685901 CCCCAAGTCCAACAATGCTGTGG - Intergenic
1020086547 7:5313567-5313589 CCCCAAGCCCAAGAAGGCGCGGG - Exonic
1025207766 7:57003571-57003593 CCCCAAGCCCAAGAAGGCGCGGG + Intergenic
1025664170 7:63573301-63573323 CCCCAAGCCCAAGAAGGCGCGGG - Intergenic
1035626851 8:1076989-1077011 CCCCAAGACCAAGAGGGTGGAGG + Intergenic
1035626867 8:1077031-1077053 CCCCAAGACCAAGAGGGTGGAGG + Intergenic
1036019001 8:4821040-4821062 CACCAAGAAGAACAATGTGGAGG + Intronic
1039529682 8:38249628-38249650 CCCTAAGAGGAACAAGGCCTAGG - Intronic
1042898504 8:73696200-73696222 CCCCAAGCCCAACAATGCTGTGG - Intronic
1047493111 8:125390369-125390391 CACCAAGACCACCAAGGCGAGGG - Intergenic
1203468330 Un_GL000220v1:106049-106071 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1203476151 Un_GL000220v1:150021-150043 CCCCGCGACGCAGAAGGCGGCGG - Intergenic
1186154655 X:6712613-6712635 CCCCAAGATGAACATGGTGAAGG - Intergenic
1190329727 X:49228405-49228427 CCCGAAGACGCACAGGGCGATGG + Exonic