ID: 975986195

View in Genome Browser
Species Human (GRCh38)
Location 4:80203001-80203023
Sequence GCTGGTGCTGGGCCAGAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 1, 2: 8, 3: 60, 4: 517}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975986188_975986195 6 Left 975986188 4:80202972-80202994 CCAGCACGCTCTTTCTCGCAGCT 0: 1
1: 0
2: 0
3: 11
4: 83
Right 975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG 0: 1
1: 1
2: 8
3: 60
4: 517
975986187_975986195 17 Left 975986187 4:80202961-80202983 CCTTCTCGCAGCCAGCACGCTCT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG 0: 1
1: 1
2: 8
3: 60
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975986195 Original CRISPR GCTGGTGCTGGGCCAGAAGC TGG Exonic
900117193 1:1033798-1033820 GCTGGGGCTGGGCCCGGGGCCGG - Intronic
900307769 1:2019438-2019460 GCAGGAGCGGGGCCAGCAGCCGG - Exonic
901136475 1:7000072-7000094 GCTGGTGCTGGGTGAGGGGCTGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901644706 1:10710186-10710208 GCTGGTGCTGAGCCAGCCTCAGG - Intronic
902152485 1:14454966-14454988 GCTTGACCAGGGCCAGAAGCAGG + Intergenic
902393908 1:16122046-16122068 GCTGATTCTGGGGCTGAAGCAGG - Intergenic
902437866 1:16409733-16409755 GCAGGTTCTGGCCCAGGAGCTGG + Exonic
902561898 1:17282854-17282876 GCTGGTGCTGGGGAAGCACCTGG + Exonic
902569699 1:17339269-17339291 GCTGGTCCTGAGCAAGAAGTGGG - Intronic
902604495 1:17561327-17561349 GCTGGAGATGGGGCAGAAGCGGG + Intronic
902631163 1:17705526-17705548 GCTGGGGCTGGGCCATGAGCTGG + Intergenic
902761136 1:18581459-18581481 GCTGGAGGTGGCCCAGGAGCAGG - Intergenic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
902878060 1:19352913-19352935 GCTGGTGGTAGGCCAGTGGCCGG - Intronic
903385225 1:22921625-22921647 GCTAGGGCTGGGCCTGGAGCTGG + Intergenic
904422964 1:30405851-30405873 TCGGGAGCTGGGCCAGTAGCGGG - Intergenic
904675614 1:32197552-32197574 CCAGGTCCTGGGCCAGATGCAGG + Exonic
904882523 1:33711773-33711795 GCTCGTGCTGGGGCAGAGGTGGG - Intronic
905389918 1:37629741-37629763 TCTGGGGCTGGGTCAGCAGCAGG + Exonic
906052439 1:42886748-42886770 GGTGGTGCTGGACCAGAGGAAGG - Intergenic
907270920 1:53290718-53290740 GCTGCTGCTTGGGAAGAAGCTGG - Intronic
907517886 1:55004858-55004880 GCTGGTGCTGTGCCCCAAGTAGG + Intronic
907789515 1:57648277-57648299 GGTGGTGGTGGGGCAGAAGGAGG + Intronic
908089188 1:60668785-60668807 GCCGGCGCTGTGCCAGCAGCAGG - Intergenic
910220130 1:84881261-84881283 GCTGGACCTGGGTCAGATGCAGG + Intronic
911176148 1:94820331-94820353 GCTGGGGCTGGGGCTGGAGCCGG - Exonic
911870903 1:103097268-103097290 GATGGTGCTGGGGAAGAAGGCGG - Intronic
912505137 1:110150938-110150960 GCTGGGGCGGGGCCAGAACAGGG - Intronic
913442290 1:118910488-118910510 GGTGGTTCTGTGCCAGAATCAGG - Intronic
915066004 1:153224558-153224580 TCTGGTGCTGGGACAGAAAAGGG - Intergenic
915467838 1:156107675-156107697 GGTGGTGCCGGGTGAGAAGCGGG - Intronic
915509322 1:156377968-156377990 GCTGGGGATGGGGCAGAAGTGGG - Exonic
917135478 1:171784561-171784583 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
917139814 1:171824726-171824748 GCTGGTGCTGCACCAGCAGGAGG - Intergenic
917639686 1:176970953-176970975 GCTGAATGTGGGCCAGAAGCAGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921217548 1:212950653-212950675 GCTGCTGCTGGGCCTGGGGCTGG - Exonic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
922167346 1:223127263-223127285 GCAGGTGCTGGGCCCAAACCTGG + Intronic
922677594 1:227562049-227562071 GCTTGGGCTGGGCCAGAACAGGG - Intergenic
923087532 1:230712881-230712903 GCAGGTGCTGGCCAAGAGGCAGG - Intronic
923567635 1:235088333-235088355 GCTAGTGCTGGGCTTGGAGCTGG + Intergenic
923822119 1:237456669-237456691 GATGTTGCTGGGCGAGAAGCAGG + Exonic
1063299752 10:4840923-4840945 CCAGGTGCTGAGCTAGAAGCTGG - Intronic
1065122312 10:22542029-22542051 GCTTCAGCTGGGCCAGAAACTGG + Exonic
1066431615 10:35357179-35357201 GCTGGGGCTGGGGCAGGGGCAGG - Intronic
1066759517 10:38739094-38739116 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1066760056 10:38741340-38741362 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067247338 10:44557902-44557924 GCTGGAGCAGGGCCAGACCCAGG - Intergenic
1067576957 10:47415099-47415121 GCTCGTGCTGGGCCTGAGCCTGG - Intergenic
1067839757 10:49666250-49666272 GCTGGAGCTGGGGCTGGAGCTGG - Intergenic
1067839762 10:49666268-49666290 GCTGGAGCTGGGGCTGGAGCTGG - Intergenic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1069755915 10:70774410-70774432 CCTGTGGCGGGGCCAGAAGCAGG + Intronic
1070540174 10:77410031-77410053 TCTGGTTCTGGGCAGGAAGCAGG + Intronic
1070783600 10:79150834-79150856 CAGGGAGCTGGGCCAGAAGCAGG + Intronic
1070806262 10:79272878-79272900 GCTGGGGCTGGGACAGCAGCAGG - Intronic
1073176324 10:101559716-101559738 GCTGGTACTGGGCAAGGGGCTGG - Intergenic
1073295853 10:102438251-102438273 GCTGGGGCAGGGCCAGGAGGAGG + Intergenic
1073349527 10:102809966-102809988 GCCGCTGCTGGGCCTGAAGGCGG - Exonic
1075567102 10:123512730-123512752 ACTGGTGCTGGCCCAGATGCTGG + Intergenic
1075688028 10:124377479-124377501 GCAGGTGCTGGACCTGCAGCCGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076216121 10:128694749-128694771 GCTGGGGCCGGGGCAGACGCAGG - Intergenic
1076726171 10:132414451-132414473 GCTGGTGCTGTGGCACAAGTGGG - Intronic
1076910424 10:133385388-133385410 GGTGGGGCTGGGCCTGGAGCAGG - Intronic
1077112943 11:869920-869942 GCTGGAGCTGGCCCGGGAGCTGG - Exonic
1077208104 11:1353688-1353710 GGAGGTGCTGGGGCAGAGGCAGG - Intergenic
1077356462 11:2121125-2121147 GGTGGTGCTGGGCCGGGCGCAGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077562573 11:3273087-3273109 GCTGGTGCTGGTGCAGGTGCAGG + Intergenic
1077568466 11:3318906-3318928 GCTGGTGCTGGTGCAGGTGCAGG + Intergenic
1077886893 11:6393411-6393433 GGTGGTGCTGGGGGACAAGCAGG + Intronic
1079085570 11:17442621-17442643 GGGGGTGCAGGGACAGAAGCAGG - Intronic
1079659580 11:23021521-23021543 GCTGAGGCTGGGGCAAAAGCTGG - Intergenic
1080239405 11:30109470-30109492 GCTAGTGCAGGGCCAGAAGCAGG - Intergenic
1080642479 11:34165902-34165924 GCAGGTGGTGGGGCTGAAGCAGG + Intronic
1080651366 11:34225283-34225305 CCTGGTCCTGGGCCAAAAGCCGG + Intronic
1081778608 11:45694397-45694419 GCTGGTGATGGGCAGGAAGGTGG - Intergenic
1083181554 11:60989031-60989053 CCTGGAGGTGGGACAGAAGCTGG - Intronic
1083281395 11:61629224-61629246 GCTGGTGCTGGGCATTGAGCGGG + Intergenic
1083313122 11:61796000-61796022 GCAGGAGCTGGGCCTGAACCAGG + Exonic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1083858151 11:65404133-65404155 GGTGGGGCTGGGTCAGATGCTGG - Intronic
1083934456 11:65863086-65863108 CCTGGAGCTGGCCCAGAAGTTGG + Exonic
1084876745 11:72138983-72139005 GCTGGTGCTGGCCGTGCAGCAGG - Exonic
1085044335 11:73344444-73344466 GCTGGCGCTGTGCCTGATGCCGG - Intronic
1085394675 11:76201257-76201279 GCTGACGCTGGGACAGGAGCAGG + Intronic
1085522979 11:77149149-77149171 GATGGGGCTGGGTCAGAAGCAGG - Intronic
1085782547 11:79422772-79422794 GCTGGTTCTGGGCCTGGGGCAGG + Intronic
1088382287 11:109206791-109206813 ACTGGTGCTGGACAAGAAACTGG + Intergenic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1089147848 11:116343336-116343358 GGCGGTGATGGGCCAGAAGGAGG + Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089249006 11:117144299-117144321 GCTGGTGCTGGGGCCGGAGGAGG + Exonic
1089366665 11:117924837-117924859 GCTGGTGCTGGGTGAGGAGGTGG - Intronic
1090839076 11:130473743-130473765 ACTGGTCCCGGGCCAGCAGCCGG - Exonic
1091189660 11:133680509-133680531 GCTGGTGATGAGACAGAGGCAGG - Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091286105 11:134409416-134409438 GCTGGGGCAGGGCCAGAAGATGG + Intronic
1091299851 11:134500676-134500698 GCTGGTGCTTGGCCAGGTCCTGG - Intergenic
1091758529 12:3072049-3072071 GGTACTGCTGGGCCAGAAGGTGG - Intergenic
1091779285 12:3203906-3203928 GCTGGTGCTTGGCCTGATACTGG + Intronic
1092196938 12:6555442-6555464 GATGGTGCCGGGCATGAAGCGGG + Exonic
1092582454 12:9858323-9858345 GCTGGGGCTGTGCTACAAGCTGG - Intronic
1093170855 12:15858840-15858862 GCTGGTGGTGGTCCTGAGGCTGG - Intronic
1093430573 12:19080672-19080694 GATGGTGCTGGGGGAGAAGTAGG - Intergenic
1093548014 12:20369893-20369915 GCTGGTGCTGAGGCTGAGGCTGG + Exonic
1094439027 12:30454490-30454512 GCTGGTGCTGGGAGAGATTCTGG - Intergenic
1094813264 12:34162333-34162355 GCAGCTGCTTGGCCAGATGCAGG - Intergenic
1095038625 12:37420021-37420043 GCTGGGGCTGGGGCTGGAGCTGG - Intergenic
1095952637 12:47790110-47790132 GCTGGTGCTGGGACTTAAGCTGG - Intronic
1096073792 12:48789569-48789591 GCTGGGGCTGGGGCAGGGGCAGG - Intergenic
1097088697 12:56488268-56488290 GCTGGGGCTGGGGCAGGAGAAGG + Exonic
1097255949 12:57674742-57674764 GGTGCTGCTGGGCCGGAAGGTGG + Intergenic
1098465722 12:70783925-70783947 GCTGGGGCTGTGACAGAACCTGG + Intronic
1098465843 12:70784388-70784410 GCTGGGCCTGGGCTAGTAGCGGG + Intronic
1098588526 12:72184391-72184413 GCTTGGGCTGGGGAAGAAGCGGG - Intronic
1099491161 12:83290316-83290338 GCTAGATCTGGGCCTGAAGCGGG + Intergenic
1102186699 12:110953925-110953947 GCTGGTGCTGGGCTAGCAGGGGG + Intergenic
1103713541 12:122929982-122930004 GCTGGTGCAGCGGCAGATGCTGG - Exonic
1103908142 12:124337800-124337822 GCTGGGGCTGGAACAGGAGCCGG + Intronic
1104637671 12:130448254-130448276 GCTGGTGTGGCTCCAGAAGCGGG - Intronic
1104860190 12:131919484-131919506 GCTGGTGCTGTACCTGAAGGTGG + Exonic
1104884328 12:132096559-132096581 CCTGGGGCTGGGCCTGAGGCGGG - Intronic
1105512584 13:21062501-21062523 TCTGGTACAGGGACAGAAGCAGG + Intergenic
1105743796 13:23357151-23357173 GCAGGTGCTGGGCAATTAGCTGG + Intronic
1105794548 13:23838017-23838039 AATGATGCTGTGCCAGAAGCTGG + Intronic
1105865383 13:24454311-24454333 GCTGTTGCTGGGACAGAGGTCGG - Intronic
1106340091 13:28819748-28819770 GCTGGGGCTGGGGCTGAGGCGGG + Intergenic
1109319264 13:60789891-60789913 GCAGGAGCTGGGGTAGAAGCTGG + Intergenic
1112300212 13:98223126-98223148 GCAGCTGATGGGACAGAAGCAGG + Intronic
1113255547 13:108500884-108500906 GCTGGAGCTGGGCAGGGAGCGGG - Intergenic
1113508213 13:110831596-110831618 GCAGGGGCTGGGCCACAGGCTGG - Intergenic
1113769446 13:112898896-112898918 GTGGGTGCAGGGCCTGAAGCAGG - Intronic
1113941747 13:114022010-114022032 GCTGGTGCTGGGCCTGTTGTGGG - Intronic
1117313461 14:54551178-54551200 GGTGCTGCTGGGCCTGGAGCTGG - Intergenic
1118246213 14:64113538-64113560 GCAGGTGCTGGAACAGCAGCTGG + Exonic
1119196478 14:72720505-72720527 GCTGCTGCTTGGCCAGTATCTGG + Intronic
1119389123 14:74278488-74278510 GCTGGTGCTAGAGCAGGAGCAGG - Intergenic
1119465385 14:74853890-74853912 AATTGTGCTGGGCCAGCAGCAGG + Exonic
1119733923 14:76968896-76968918 GCTGGTGCTGCACCAGCAGGAGG + Intergenic
1119772827 14:77231745-77231767 GCTGGCCCTGGGGCAGCAGCTGG + Intronic
1121016929 14:90554535-90554557 CCTGGTGCTGTGCCAGGTGCGGG + Intronic
1121248865 14:92484613-92484635 CCTGGGGCTGGGGCAGATGCTGG - Intronic
1122206285 14:100149624-100149646 GCTGGTGCTGGTGCAGATGCTGG - Exonic
1122278889 14:100609875-100609897 GCTGGGGCTGGGGCAGCAGCAGG + Intergenic
1122347265 14:101068225-101068247 GCAGGTGCTGGGCACAAAGCAGG + Intergenic
1122425303 14:101602158-101602180 GCCGGGGCTGGGCTGGAAGCAGG + Intergenic
1123056064 14:105571425-105571447 GCGGGTGCTGGGCCAGAGTCGGG + Intergenic
1123057319 14:105577518-105577540 GCGGGTGCTGGGCCAGAGCCGGG - Intergenic
1123057863 14:105580371-105580393 GCGGGTGCTGGGCCAGAGTCGGG - Intergenic
1123080495 14:105691556-105691578 GCGGGTGCTGGGCCAGAGTCGGG + Intergenic
1123082146 14:105700304-105700326 GCGGGCGCTGGGCCAGAGTCGGG - Intergenic
1123099354 14:105785780-105785802 GCTGCTGCAGGCCGAGAAGCAGG - Intergenic
1202904041 14_GL000194v1_random:58453-58475 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1202930250 14_KI270725v1_random:28681-28703 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1202930770 14_KI270725v1_random:30847-30869 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1123421586 15:20140565-20140587 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
1123443468 15:20305950-20305972 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1123530812 15:21147105-21147127 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1124973676 15:34514528-34514550 GCCGGGGCTGGGCCAGTTGCGGG + Intergenic
1127287792 15:57546024-57546046 GCTGGGGCTGGGCCATCAGCCGG + Intronic
1127791915 15:62405715-62405737 GCTGGTGGGGAACCAGAAGCTGG + Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128639211 15:69323457-69323479 GGTGCTCCTGGGCCAGAGGCAGG + Intronic
1128655140 15:69455236-69455258 GCTGGTGCTGCACCAGCAGGAGG + Exonic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129769460 15:78194005-78194027 CCTGGAGCTCGGCCTGAAGCAGG - Exonic
1131507381 15:93030257-93030279 GCTGGTCCTGCTCCAGGAGCTGG + Intergenic
1132092647 15:98958387-98958409 GCTGGGGCTGGGAGAGAAGCAGG - Exonic
1132513195 16:353926-353948 GCTGGTGCTGGGGCTGCTGCTGG - Intergenic
1132932465 16:2465924-2465946 GCTGGTGCTGGGGCAGGTGTGGG + Intergenic
1132993719 16:2811774-2811796 GCTGGAGCTGGCCCAGAGGGCGG + Intergenic
1133046175 16:3089558-3089580 GCTGGTGGCGGGCCAGATCCTGG + Exonic
1133303234 16:4795606-4795628 GCTGGCGCTGGGCCAGGAGCGGG + Intronic
1133532097 16:6664851-6664873 GCTGGTGAAGGGGCAGAACCGGG - Intronic
1133764340 16:8826082-8826104 ACTGATGCAGGGCCAGAATCTGG - Intronic
1134362327 16:13543093-13543115 CCAGGTGCTGGGCAAGATGCTGG + Intergenic
1134466986 16:14487723-14487745 GCTGGTGCTGGGGCTGGAACGGG + Intronic
1135400986 16:22166039-22166061 GTAGGAGCTGGGCCAGGAGCTGG + Intergenic
1135517577 16:23148784-23148806 CCTGGCGCTGGGCCAGTACCGGG - Exonic
1136722747 16:32337936-32337958 TCTGGGGCAGGGCCAGAAGCAGG + Intergenic
1136841069 16:33543935-33543957 TCTGGGGCAGGGCCAGAAGCAGG + Intergenic
1136862712 16:33712856-33712878 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1137262428 16:46842711-46842733 GGTGGTGCTGGTGCAGATGCGGG - Intergenic
1137440922 16:48497996-48498018 GCTGCTGCTGGGCTAGAAGAGGG - Intergenic
1138336882 16:56260429-56260451 CCGGCTGCTGGGCCAGAAGCAGG + Intronic
1139106036 16:63827746-63827768 ACTGATGCAGGGCCAGAATCTGG + Intergenic
1139298349 16:65922437-65922459 CCTGGTGCTGGGCTAGAGGCTGG - Intergenic
1139440891 16:66966324-66966346 GCTGGTCCTTAGCAAGAAGCTGG + Exonic
1139594106 16:67948222-67948244 GCTGGGCCTGGCCCAGAAACGGG + Intronic
1139691166 16:68642951-68642973 GCTGGGGCTGGGACTGAGGCTGG - Intronic
1141054437 16:80803506-80803528 GCTGGTGCGGGGGCAGCAGGTGG + Intronic
1141480714 16:84304856-84304878 GCTGGGGCTGGGCCACAGGAGGG + Intronic
1141667463 16:85473314-85473336 GCAGGGGCAGGGCCAGGAGCTGG + Intergenic
1142135365 16:88449518-88449540 GAGGGTGCAGGGGCAGAAGCTGG - Intergenic
1203003684 16_KI270728v1_random:179828-179850 TCTGGGGCAGGGCCAGAAGCAGG - Intergenic
1203124188 16_KI270728v1_random:1560998-1561020 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1203135292 16_KI270728v1_random:1716235-1716257 TCTGGGGCAGGGCCAGAAGCAGG - Intergenic
1203151234 16_KI270728v1_random:1844232-1844254 TCTGGGGCAGGGCCAGAAGCAGG + Intergenic
1142480116 17:213877-213899 GCTGGAGCTGCGTCAGCAGCGGG + Exonic
1142767691 17:2074958-2074980 GATGGTGCTGGAGCAAAAGCTGG + Intronic
1142807433 17:2378903-2378925 GCTGGGGCTGGGGCTGATGCTGG - Intronic
1142903243 17:3026388-3026410 GCTGGTGCTGGAGGAGGAGCGGG - Exonic
1142967021 17:3588106-3588128 GCTGGAGCTGGACCAGGGGCTGG + Intronic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1143121098 17:4607403-4607425 GATGGTGATGGGCCGCAAGCCGG + Exonic
1143171341 17:4932376-4932398 GTTGGTGCTGGGGCAGGAGAGGG + Intronic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1144650412 17:17003520-17003542 GCTGGTGCGGGGCAAGAGGGAGG - Intergenic
1144675864 17:17161239-17161261 GCTGGAGCAGAGCCAGAAGGAGG + Exonic
1145810251 17:27760080-27760102 GCTGGAGATGGCCCAGAAGGGGG - Exonic
1146729689 17:35183014-35183036 GCAGGGACTGGGGCAGAAGCAGG - Intronic
1146774059 17:35596683-35596705 GCTGGAGCTGGACGTGAAGCTGG - Intronic
1147374963 17:40017842-40017864 GCTGGTGCCTGGCCAGGGGCTGG + Intergenic
1147508714 17:41046974-41046996 GCAGGTGGTGGCCCAGCAGCAGG + Exonic
1147509453 17:41054918-41054940 GCAGGTGGTGGCCCAGCAGCAGG + Exonic
1147509961 17:41059757-41059779 GCAGGTGGTGGCCCAGCAGCAGG + Exonic
1147510554 17:41065552-41065574 GCAGGTGGTGGCCCAGCAGCAGG + Exonic
1147647488 17:42042659-42042681 CCTGGTCCTGGGCCAGCTGCAGG - Intronic
1147722597 17:42548117-42548139 GCCGGTGCTGGGGCAGGAGATGG + Intergenic
1147746611 17:42698812-42698834 GCTGGGGCTGGGGCTGAGGCTGG - Exonic
1147845265 17:43400122-43400144 GCTGGTGCTGGCCAACAAGCAGG + Exonic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148382388 17:47209477-47209499 GCTGGTGCAGGGGCTGGAGCTGG - Exonic
1148818282 17:50346167-50346189 GCTGGTGCGGCGCTACAAGCTGG + Exonic
1148835871 17:50465458-50465480 GCTGGGGCTGGGGAAGAAGGTGG + Intronic
1149560927 17:57607509-57607531 CCTGGTGCTTGGCCACACGCTGG + Intronic
1149579207 17:57736646-57736668 CCTGTTCCTGGGCCAGAATCAGG - Intergenic
1149664754 17:58357865-58357887 GCTGGTACTGGGGCAGATGCTGG + Exonic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150271833 17:63871858-63871880 GCTGTTCCTGGGCCAGAAAAAGG - Intergenic
1150277511 17:63909448-63909470 GCTGTTCCTGGGCCAGAAAAAGG - Intergenic
1150440736 17:65189490-65189512 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
1150653545 17:67025018-67025040 GCTGGTGCTGGGCCGGGAGCTGG + Intronic
1151481975 17:74374947-74374969 GCTGGGTCTAGGCCAGAGGCAGG + Intergenic
1151598355 17:75091374-75091396 CCTGGAGCTGGGCCAGGAGGAGG + Intronic
1151678093 17:75610214-75610236 GCAGGGGCTGGGCCACCAGCAGG - Intergenic
1151703541 17:75755411-75755433 GCTGGGGCTGGGGCAGGAGAGGG + Intronic
1152013620 17:77735635-77735657 CCAGGGACTGGGCCAGAAGCAGG - Intergenic
1152294465 17:79458677-79458699 GCTGGGGCGGGGGCAGCAGCTGG + Intronic
1152466925 17:80471731-80471753 GCTGGTGCTGGGCCAGGAGCAGG - Exonic
1152649132 17:81483869-81483891 CCTGGTGCTGCCCAAGAAGCAGG - Intergenic
1152757992 17:82095044-82095066 GCTGGTGCTGGGGCCGGGGCCGG - Intronic
1152825048 17:82459213-82459235 GCCGGTGCAGGGGCGGAAGCGGG + Intronic
1152937689 17:83150047-83150069 TCTGGAGCTGGGCCACCAGCAGG - Intergenic
1154001038 18:10482555-10482577 GGTGGTGCTGAGCCAGGGGCCGG + Intronic
1154176494 18:12089317-12089339 GCAGGGCCAGGGCCAGAAGCAGG - Intergenic
1156417933 18:36917930-36917952 GCTGGAGATGAGCCAGAAACAGG - Intronic
1157294578 18:46433422-46433444 GCTGGTGCAGGGCCTGAGGTAGG - Exonic
1157486365 18:48090201-48090223 GCAGGTGCTGGGCCAGTCACAGG + Intronic
1157568950 18:48699421-48699443 GCTGGGGCTGGGGCTGGAGCCGG + Intronic
1159767068 18:72503167-72503189 GCTGGACCTGGGCCAGCATCTGG + Intergenic
1159957542 18:74530330-74530352 GCAGATGCTGGGGCAGATGCTGG - Intergenic
1160034172 18:75285937-75285959 GCTGGTGCTGGAGCTGCAGCTGG - Exonic
1160249579 18:77189962-77189984 GCTGGTGCTGGCCCGTAAGTGGG - Intergenic
1160536443 18:79597035-79597057 GCTGGAGCCGGGTCAGGAGCTGG - Intergenic
1160660040 19:293655-293677 GCCAGTGCTGGGCAAGAGGCGGG - Intergenic
1161168974 19:2803731-2803753 GCTGGTGCTGGGGTACAAACGGG + Intronic
1161719883 19:5896853-5896875 GCTGGGGCTGTGCCAGGAGAGGG + Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161723148 19:5914641-5914663 GCTGGTGCTGGACCAGGCGGAGG + Exonic
1162244210 19:9385756-9385778 GCTGGTGCTGGGCACTAACCAGG + Intergenic
1162385658 19:10359195-10359217 GATGGTGGTGGCCCAGCAGCTGG - Exonic
1162480436 19:10924112-10924134 GCTGGTGCTGGCCCAGAGGAGGG - Exonic
1162591968 19:11597764-11597786 GGTGGGGCTGGGCCAGGAGCTGG + Intronic
1162615737 19:11798888-11798910 GGTGGGGCTGGGCCCGCAGCTGG + Intronic
1162617599 19:11814580-11814602 GGTGGGGCTGGGCCGGCAGCCGG + Intronic
1162646270 19:12052619-12052641 GGTGGAGCTGGGCCGGCAGCCGG - Intronic
1162660295 19:12163364-12163386 GGTGGGGCTGGGCCGGCAGCCGG + Intronic
1162668712 19:12237290-12237312 GGTGGGGCTGGGCCAGCAGCCGG - Intronic
1162675346 19:12294511-12294533 GGTGGGGCTGGGCCGGCAGCCGG - Intronic
1162697005 19:12484471-12484493 GATGGGGCTGGGCCGGCAGCCGG - Intronic
1162904944 19:13817819-13817841 GCTGGGGCTGGGGCAGCAGCGGG + Exonic
1162985191 19:14265345-14265367 GCTGGGGCTGGGCCAGCCCCGGG - Intergenic
1163000391 19:14363360-14363382 GAGGGTGCTGGGACGGAAGCGGG - Intergenic
1163210528 19:15836752-15836774 GGTGGGGCTGGGCCGGCAGCTGG - Intergenic
1163243190 19:16076707-16076729 GCGGGTGCGGGGCCCGAGGCCGG - Intronic
1163428979 19:17255552-17255574 GCTGGTGCGGCGTGAGAAGCGGG - Exonic
1163533824 19:17865863-17865885 CCTTGAGCTGGGCCTGAAGCAGG + Intergenic
1163606869 19:18280455-18280477 CCTGGTGCTGGGGCAGCAGCTGG + Exonic
1163850951 19:19663388-19663410 GCTGGGGCTGGGGCAGCAGTTGG - Exonic
1164145292 19:22509246-22509268 GCTGGGACTAGGCCAGAGGCAGG + Intronic
1164521458 19:28983187-28983209 GCTTGTGCAGGACCAGAGGCTGG - Intergenic
1164675038 19:30095236-30095258 GCTGGGGCTGGGCCTGCATCAGG - Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1164996376 19:32722390-32722412 GCTGGTTGAGGGCCAGAAGTGGG - Intronic
1165020732 19:32922076-32922098 GCTGTTGCTGTGCTAGATGCGGG + Intronic
1165351673 19:35279193-35279215 GCTGCAGCTGGGCTCGAAGCAGG - Exonic
1165699851 19:37929191-37929213 GCTGGGGCTGGGGCTGGAGCCGG + Intronic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167125478 19:47545645-47545667 GCCGGGGCTGGGCCAGGAGAAGG + Exonic
1167233225 19:48298046-48298068 CCTAGTGCTGGGCCAGAGCCTGG - Exonic
1167272596 19:48514256-48514278 GCAGGCGCTGGGCCAGAAGCTGG + Intergenic
1167594186 19:50418686-50418708 GCTGGAGATGGGACAGGAGCTGG - Intronic
1167797111 19:51716724-51716746 GCTGGGGCTGGGGAAGAAGATGG - Intronic
1167904646 19:52648976-52648998 GCTGGAGCTGGGCAAGAGGGTGG - Intronic
1167994286 19:53390163-53390185 GCTTGGGCGGGGCCAGAAGGTGG + Intronic
1168337102 19:55602959-55602981 GCTGGTGCTGGGCCTGAGCCAGG + Exonic
925148152 2:1594772-1594794 CCTGGTGCAGGGCCTGAGGCTGG - Intergenic
925159765 2:1675912-1675934 GCTGGGGCTGGGCCGGCAGGAGG + Intronic
926132351 2:10311722-10311744 GTTTGTGCTGGGCCAGTTGCTGG + Intronic
926173231 2:10566929-10566951 CGTGGGGCTGGGGCAGAAGCAGG - Intergenic
926892406 2:17649759-17649781 GCTGCAGCGGGGACAGAAGCAGG - Intronic
927156663 2:20224810-20224832 GCTGGCGCTGAGCCTGCAGCCGG - Exonic
927894929 2:26775558-26775580 GCTGGTGCTGAGCCAGTGGCTGG + Exonic
927963482 2:27255151-27255173 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
928103755 2:28454239-28454261 GCAGGGGCTGGGTGAGAAGCAGG - Intergenic
928424872 2:31169515-31169537 GGTGGTCCTGGGCCAGACCCAGG - Intergenic
929545087 2:42850534-42850556 GCAGGGGCTGGGCCAGGGGCTGG - Intergenic
929777720 2:44939077-44939099 GCAGGCGCTGGGGCAGAGGCTGG + Intergenic
931035771 2:58241253-58241275 ACCGGTTCTGGGGCAGAAGCAGG + Exonic
931637643 2:64355142-64355164 GCTGGAGCGGGAGCAGAAGCTGG + Intergenic
932263380 2:70345568-70345590 GGTGGTCCTGGGCCAGATGAAGG - Intergenic
932461199 2:71883067-71883089 GCTGGGGCTGGGCTGGAAGAGGG + Intergenic
932596895 2:73099565-73099587 CCTGGTGAAGGGCAAGAAGCTGG + Intronic
932716214 2:74101975-74101997 GCTGGGCCTGGGCCAGCAGGAGG + Exonic
933244345 2:79958492-79958514 GCTGTTGCTGGGCTTGAAGATGG + Intronic
933955070 2:87356919-87356941 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
934273925 2:91563565-91563587 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
934559692 2:95306760-95306782 CTTGGTGCTGGGAGAGAAGCTGG - Intronic
935192998 2:100793357-100793379 GCTGGTGCGGAGCCAGAGCCGGG - Intergenic
935305938 2:101736354-101736376 GCAGGAGATGGGCAAGAAGCAGG - Intronic
936076345 2:109404115-109404137 GCTGGTGGTGGGTAAGAAGTGGG + Intronic
938313982 2:130314071-130314093 GCTGCTTCTGGACCAGCAGCAGG + Intergenic
938781010 2:134584927-134584949 ACTGGTGCTGGGTCTGGAGCTGG - Intronic
940777878 2:157903564-157903586 GCTTCTGCTGGGCTAGCAGCAGG + Intronic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
944114662 2:196173233-196173255 GCTGGAGCTAAGGCAGAAGCAGG - Intronic
945572418 2:211485464-211485486 ACTTGAGCTGGGCCAGAAGGAGG - Intronic
946347133 2:219119588-219119610 ACTTGTGCTGGGCCAGGGGCAGG - Intronic
946402949 2:219478016-219478038 GCTGGAGCCTGGCCAGCAGCCGG - Exonic
946413857 2:219529532-219529554 GATGGGGCTGGGGCAGGAGCTGG + Intronic
947528383 2:230893431-230893453 GCTGGGGCTGGGGCTGGAGCTGG - Intergenic
947913963 2:233819985-233820007 GGTGGTGGTGCGCCAGCAGCAGG - Exonic
948438807 2:237972301-237972323 GTTGGTGATGGGCCAGAACCTGG + Intronic
1168775257 20:441897-441919 GCTGGTGGTAGGCGAGAGGCTGG - Exonic
1169508753 20:6241776-6241798 CCTGGTACTGAGCCAGGAGCTGG - Intergenic
1170494826 20:16914806-16914828 GCTGGGCCTGGGCCAGCATCTGG - Intergenic
1170782505 20:19438378-19438400 GCAGGTGATGGGCCAGGAGCCGG - Intronic
1171176279 20:23052478-23052500 GAGGGTGCTGGGCCAGGAACTGG - Intergenic
1171297928 20:24034927-24034949 GCTGGTGCCAGCCCTGAAGCTGG + Intergenic
1172482216 20:35277806-35277828 GCTGGGGCTGGGGCGGATGCCGG + Intergenic
1172484686 20:35291187-35291209 TCTGCAGCTGGGCCTGAAGCAGG - Intronic
1173062972 20:39679869-39679891 GCAGGGTCTGGGCCAGAAGTGGG - Intergenic
1173477561 20:43372190-43372212 GCTGGAACTGGGCCAGACACTGG - Intergenic
1173662851 20:44746024-44746046 GCGACTGCTGGTCCAGAAGCGGG + Exonic
1173725978 20:45298122-45298144 GCTGGGGTTGGGTCAGACGCTGG - Intronic
1175370417 20:58484679-58484701 GATGATGCAGGGGCAGAAGCAGG + Intronic
1175518986 20:59587733-59587755 GCTGGAGCTGGGGCTGGAGCCGG + Intronic
1175893291 20:62324725-62324747 GCTGGAGGTGGGCCAGCACCTGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176050986 20:63119687-63119709 GCCAGTGCTGGGCCAGCTGCTGG + Intergenic
1176111879 20:63414580-63414602 GCGGGTGCTGGGGCTGAGGCGGG + Intronic
1176117411 20:63439139-63439161 GCTGGTGCACGGCAAGAGGCTGG - Intronic
1176132614 20:63502684-63502706 GCTGGGGCTGGGCTGGCAGCGGG + Intergenic
1176592262 21:8657263-8657285 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1176623413 21:9073220-9073242 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1177230916 21:18318358-18318380 GCTGGCATTTGGCCAGAAGCTGG + Intronic
1177824967 21:26072688-26072710 TCTGGTGCTAGTCCAGAATCAGG + Intronic
1178696979 21:34801687-34801709 GCCAGTGGTGGGCCAGAAGGTGG + Intronic
1179209389 21:39313083-39313105 GCAGGTGCTGGTGCAGGAGCTGG - Exonic
1179812038 21:43877954-43877976 GCTGGTGGTGGGGCAGGAGGCGG - Intronic
1179831607 21:44000541-44000563 GCTGGTGCAGGGACAGCAGTGGG - Intergenic
1180275113 22:10634392-10634414 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1180550124 22:16531552-16531574 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1180693597 22:17738127-17738149 GCTGGTGCTGGCCCTGCTGCTGG - Exonic
1180920152 22:19517413-19517435 GCTGGTGCTGGGGAAGCAGTGGG - Intronic
1181031421 22:20150301-20150323 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181031441 22:20150344-20150366 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181273446 22:21674071-21674093 CCTGGGGCTGGGCCCTAAGCTGG - Intronic
1181354550 22:22290269-22290291 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
1181595016 22:23908474-23908496 CCTGTTGCTGTGCCAGAGGCTGG - Intergenic
1182834729 22:33332797-33332819 GCTGGGGCTGGGGCTGGAGCTGG - Intronic
1183353126 22:37344530-37344552 GCTGGCACTGGGCCAGGACCAGG - Intergenic
1183387811 22:37525177-37525199 CCTTGGGCTGGGCAAGAAGCTGG + Intergenic
1183391817 22:37549703-37549725 GTGGGTGCTGGGACAGATGCTGG - Intergenic
1183472581 22:38017381-38017403 GCTGGGCCTGGTCCAGATGCGGG + Intronic
1183943058 22:41307259-41307281 GCCCGTGCTGGGCCTGAAGTCGG + Intronic
1184594787 22:45507155-45507177 GCTGGGGCTGGGCCTAGAGCTGG + Intronic
1184754060 22:46506513-46506535 GCTGGGGCTGGGGCTGAGGCTGG - Intronic
1185080505 22:48707118-48707140 GCTGGTGCTGGGCCGGCCCCAGG + Intronic
1185203661 22:49523873-49523895 GCCGGTGCTGGGCCTGGAGCAGG - Intronic
1185349411 22:50326814-50326836 CCTGGAGCTGGGCCAGGCGCTGG - Exonic
949749387 3:7333274-7333296 GCAGGTGCTGGACCTGAAGAGGG + Intronic
950534515 3:13571331-13571353 GCTGGGGCAAGGGCAGAAGCTGG + Exonic
953388797 3:42522748-42522770 GGTGGTGCTGGGGAAGAAGCTGG + Intronic
953626843 3:44578967-44578989 GCTGGAGCAGAGCCAGAAGGAGG - Intronic
953890691 3:46750026-46750048 GCTGGCCCTGCACCAGAAGCAGG + Intronic
954431341 3:50472438-50472460 GCCAGAGCTGGGCTAGAAGCAGG - Intronic
955196738 3:56811365-56811387 GCTGGGGCTGGGGCAGATGGTGG + Intronic
955938594 3:64127014-64127036 GCTGGTGTTGCCCCAGCAGCTGG - Intronic
958988455 3:100811793-100811815 GCTGGTGCTAGGGAAGAAACGGG + Intronic
960977929 3:123194645-123194667 GCTGGGGCTGGGATGGAAGCAGG - Intronic
961373624 3:126448300-126448322 GCAGGTGCTCGGCCAGATGGTGG + Intronic
961509479 3:127392128-127392150 GCTGGGGCTGGGGCTGGAGCTGG + Intergenic
961645730 3:128391878-128391900 GCTTGTGCTGTGCCAGAGGGAGG + Intronic
963573419 3:147027236-147027258 GTTGATACTGGGCCAGAAGATGG - Intergenic
963798899 3:149657961-149657983 GCTAGTGCTGGGCGAAAAGGAGG + Intronic
964010680 3:151887892-151887914 GCTGGGGCTGGGTCTGAGGCTGG + Intergenic
964011577 3:151898479-151898501 GCTGGGGCTGGGTCTGAGGCTGG - Intergenic
965117307 3:164507271-164507293 GATGTTGCCTGGCCAGAAGCTGG - Intergenic
965590488 3:170357163-170357185 TGTGGTGATGGGCCAGACGCGGG - Intergenic
967099280 3:186202679-186202701 CCTGGGGCTGGGACAGAAGTTGG + Intronic
967437468 3:189466065-189466087 GCTGATGCTGTGACAGATGCTGG - Intergenic
968084211 3:195867386-195867408 CCTGGCGATGGGCCAGAGGCGGG - Exonic
968662533 4:1804736-1804758 GTCAGTGCTGGGCCAGAAGGGGG - Intronic
968669920 4:1843735-1843757 GCTGGGGCTGGGCCAGCGCCTGG - Intronic
968870685 4:3240543-3240565 GCCTGTGCTGGGCCAGTGGCTGG + Exonic
969344274 4:6561449-6561471 GCTGGTCCTGGGTCGGAAGGAGG + Intronic
969616459 4:8255735-8255757 GCTGGTGCTGGGTCAGGAGTAGG + Intergenic
969624844 4:8297186-8297208 GCAGGAGCAGGGCCAGGAGCAGG + Intronic
970124288 4:12791976-12791998 GCTGGAGATGGGGCAGGAGCTGG + Intergenic
970599592 4:17630970-17630992 TTTGGTGCTGGCCCAGAAGGTGG - Exonic
973260428 4:48158136-48158158 GTTTTTGCTGGGCCAAAAGCAGG - Intronic
975772312 4:77739588-77739610 TCTGGTACTGGGACAGAAGGTGG + Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977795348 4:101158237-101158259 GCTGGTGATGCACCAGGAGCAGG - Intronic
978508958 4:109494671-109494693 GCTGGAGCTGGAGCAGAAGCAGG - Exonic
980970032 4:139558790-139558812 GCTGGCTCTGGGCCCAAAGCTGG + Intronic
984102018 4:175498715-175498737 GCTCATGCTGTGGCAGAAGCTGG - Intergenic
984140739 4:176001770-176001792 GCTGGTGCAGGGCCAGACTGGGG - Intronic
984785882 4:183566919-183566941 GCTGGTGGTGGGGAAGCAGCTGG - Intergenic
985445272 4:190018258-190018280 GCTTGGGCTGGGCCAGAACAGGG - Intergenic
985565297 5:612382-612404 GCTGGTGCTGAGCGAGGAGGCGG + Exonic
985647241 5:1090749-1090771 GCTGGTTCTCGGCCAAAGGCGGG + Intronic
985682294 5:1262769-1262791 ACTGATGCTGTGCCAGAGGCTGG + Intronic
985682402 5:1263321-1263343 ACTGGTGCTGTGCTAGAGGCCGG - Intronic
991464144 5:66892401-66892423 GCTGGTGCTGTGCCAGACACTGG - Intronic
991945105 5:71892045-71892067 GCTCGTGCCTGGCCAGAGGCAGG + Intergenic
992151554 5:73909573-73909595 GCTGGAGCTGGTGCTGAAGCTGG - Exonic
992372925 5:76163581-76163603 GGTGGTGCTGGGGCAGAGTCAGG - Intronic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
997283848 5:132664749-132664771 GCTGGTGCTGGTCCAGCCGGGGG - Intergenic
997952288 5:138252160-138252182 GCTGGAGCTGGGACAGATCCCGG + Intergenic
998148616 5:139744681-139744703 GCTGGGTCTGGGGCAGGAGCGGG - Intergenic
998252362 5:140561716-140561738 GATGGGGCTGGGGTAGAAGCTGG + Exonic
998349170 5:141489819-141489841 GCTGGTGCTAGAGCAGCAGCTGG + Exonic
999315647 5:150582348-150582370 GCTGGTGCTGGGAGAAGAGCCGG - Intergenic
999393872 5:151214237-151214259 AGTGGTGCTGGGCCAGACACCGG - Intronic
999462038 5:151766005-151766027 GCTGGTGCTGCACCAGCAGGAGG - Intronic
999498035 5:152119435-152119457 GCAGGTGCTGTGTCAGGAGCAGG + Intergenic
1000358266 5:160421959-160421981 GCTGCGGCTGGGGCTGAAGCTGG + Exonic
1001101856 5:168820928-168820950 GCTGGTGGTGGTGGAGAAGCGGG - Intronic
1001280863 5:170385414-170385436 GCTGGTGATGGCCCAGAAGCGGG - Exonic
1001297098 5:170505751-170505773 CTGGGAGCTGGGCCAGAAGCTGG - Intronic
1001661443 5:173396511-173396533 GCAGGCGCTGGGCCTGGAGCTGG + Intergenic
1001745052 5:174086143-174086165 TCTGGGGCTGAGCCAGGAGCTGG - Intronic
1002352074 5:178590233-178590255 GGTGCTGCTGGGGCAGAGGCTGG + Exonic
1002617668 5:180465772-180465794 GCTGGGGCTGAGGCAGATGCCGG - Intergenic
1003175296 6:3749616-3749638 GCTGGGGTTGGGCCAGACGGTGG - Intronic
1005896878 6:30186071-30186093 GCTGGTGTTGGCCCAGATGCCGG + Exonic
1006258375 6:32848932-32848954 GATGGTGCTGGGCCAGAGGAAGG + Intronic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1012201188 6:96407947-96407969 GCTGATGTGGGGCCAGAATCTGG + Intergenic
1013081766 6:106819154-106819176 ACTGATGCTGGGCCAGAATCTGG + Intergenic
1014265258 6:119269618-119269640 GGTACTGCTGGGCCAGAAGGTGG - Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015732488 6:136362639-136362661 GCTGGAGCTGGGGCCGAGGCTGG + Exonic
1015732494 6:136362657-136362679 GCTGGAGCTGGGGCCGAGGCTGG + Exonic
1018299754 6:162388792-162388814 CCAGATGCTGGGCCAGATGCTGG - Intronic
1019129300 6:169861913-169861935 GCTGGTGCTGGCCCCGAGGTGGG + Intergenic
1019525719 7:1479594-1479616 GCAGGCCCTGGGCCAGGAGCTGG - Exonic
1019650626 7:2156005-2156027 GCTGATGCTGGGCAAAAAGGTGG + Intronic
1019821734 7:3248858-3248880 GATGAGGCTGGGCCAGAAGCAGG + Intergenic
1019913218 7:4114246-4114268 GGTGGTGCGGGGCCGGACGCGGG + Exonic
1021018172 7:15562055-15562077 GTGGGCGCTGGGCCAGAAACAGG + Intergenic
1021463208 7:20912289-20912311 GCTGGACCTGGCTCAGAAGCAGG + Intergenic
1022832184 7:34079044-34079066 GCTGGTGCTGGGCGAGAGCAGGG + Exonic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1023852289 7:44157228-44157250 CTTGGTGCTGGGCCTGAAGTCGG - Intronic
1023940330 7:44765276-44765298 GTGGGTGCCGGGCCAGCAGCAGG + Intronic
1024194650 7:47047227-47047249 CCTGGTGCTGAGCGTGAAGCAGG - Intergenic
1024788092 7:52931431-52931453 GCTGGTTCTGTGCCCGAGGCCGG - Intergenic
1025977242 7:66378773-66378795 GCAGGAGCTGGGCCAAAAGAGGG + Intronic
1026979556 7:74518351-74518373 GCTGGGGCTGGGCCAGGGCCGGG + Intronic
1029366882 7:100122323-100122345 GCTGGAGCTGGGGCAGGTGCTGG + Exonic
1030074927 7:105728712-105728734 GCTGATTCTGGGGCAGAGGCAGG + Intronic
1030112366 7:106037873-106037895 GCTGGAGGTGGGCTAGAGGCAGG - Intergenic
1030266639 7:107628732-107628754 GCCGATGCTGGGCCTGAAGGCGG - Intronic
1030279578 7:107758627-107758649 GCAGGTGCTGGGGCAGGAGGTGG - Exonic
1030296394 7:107932753-107932775 GCTGGTGCTGGTCCCAAAGATGG - Intronic
1031528473 7:122849932-122849954 GCTAGTACTGGGCCAGGAGCTGG - Intronic
1032084463 7:128876814-128876836 CCTGGTGCTGGGACAGAGGCTGG - Intronic
1034561269 7:151880844-151880866 GCTGGGGCTGGGGCTGGAGCCGG + Intergenic
1034840566 7:154391651-154391673 GCTGGTGAGAGGCTAGAAGCAGG - Intronic
1035013244 7:155739816-155739838 GCTGGTGCTGGGGCGGGGGCTGG - Exonic
1036217058 8:6889637-6889659 CCCGGTGCTGGGACAGATGCAGG - Intergenic
1036696544 8:10978909-10978931 GCTGAAGCTGGGCCAGTGGCAGG - Intronic
1037753746 8:21698555-21698577 GCGGGGCCAGGGCCAGAAGCAGG - Intronic
1038921680 8:32091808-32091830 GCTGGTGCAGAGCCAGAACAAGG + Intronic
1040109753 8:43562047-43562069 GCAGGTCCTGGGCCAGATCCGGG - Intergenic
1040486977 8:47882983-47883005 GCTGGTGCTGGACCTGGTGCTGG + Intronic
1041255671 8:55978116-55978138 CCTGGTGCTGTCCCTGAAGCAGG + Intronic
1041384149 8:57280465-57280487 TCTGGTGCTGGGCCGGATGGGGG + Intergenic
1041758907 8:61342565-61342587 GCTTGTGCTGGGCCTGCATCTGG + Intronic
1043285034 8:78517270-78517292 GTTGGTACAGGGCCACAAGCAGG - Intronic
1047312686 8:123705875-123705897 GCTGGTGCTGGAGCAGAAGGAGG - Intronic
1047963483 8:130028010-130028032 GCTGGAGCTGGGGCTGAAGCTGG - Intergenic
1048918438 8:139205715-139205737 CGTGGTGCTGTGCCAGGAGCTGG - Intergenic
1048969685 8:139638563-139638585 GCTACTGCAGGACCAGAAGCAGG + Intronic
1049201604 8:141343305-141343327 GCTGGGGCTGGGGCACAAGGGGG - Intergenic
1049201665 8:141343487-141343509 CCTGCTGCTGGCCAAGAAGCTGG - Intergenic
1049290014 8:141796868-141796890 GCTGGTGCCCTGCCAGAAGCCGG + Intergenic
1049385929 8:142342995-142343017 GCAGGTGCTGGGACAGGTGCAGG - Intronic
1049659374 8:143812841-143812863 GCAGGTTCTGGGACAGCAGCAGG + Exonic
1049744648 8:144258132-144258154 GCAGTGGCTGGGCCAGAAACTGG - Intronic
1050187589 9:2991465-2991487 GATGGTGCTGGGGCAGAGGAAGG - Intergenic
1052342894 9:27380665-27380687 GGTGGGGAGGGGCCAGAAGCTGG - Intronic
1053143963 9:35699455-35699477 GCAGGGTCTGGGCAAGAAGCGGG + Exonic
1053411733 9:37920191-37920213 GCTGGTTCCGGGTCAGATGCCGG - Intronic
1053692176 9:40592139-40592161 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1054272624 9:63045346-63045368 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
1054303434 9:63393105-63393127 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1054402213 9:64719615-64719637 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1054435818 9:65203930-65203952 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1054494574 9:65817757-65817779 TCCGGGGCAGGGCCAGAAGCAGG + Intergenic
1055893120 9:81144500-81144522 GGTGGTGATGGGACAGAAGAGGG - Intergenic
1056329712 9:85511316-85511338 GCTGGGGCTGGGCCAGGGCCTGG - Intergenic
1057261335 9:93586486-93586508 GCTGGGGGAGGGCCAGCAGCCGG + Intronic
1057440310 9:95078217-95078239 GCTGGTGCAGGTCCAGATGGCGG - Intronic
1057484972 9:95475684-95475706 GCAGGGGATGGCCCAGAAGCTGG + Intronic
1059480789 9:114587868-114587890 GCTGCTGCAGGCCGAGAAGCGGG + Exonic
1060155082 9:121313930-121313952 ACAGGTGCTGGGCCCCAAGCCGG + Exonic
1060544778 9:124453441-124453463 CCTGGTGCTGGGCCAGGATCAGG + Exonic
1060696209 9:125711144-125711166 GATGGTGCTGGGCCAGGGGCTGG + Intergenic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1060897107 9:127225120-127225142 GCTGGGGCGGGGCCTGAACCAGG + Intronic
1061396836 9:130348119-130348141 GCTGGTCCTGGGGAAGCAGCAGG - Intronic
1061473568 9:130846761-130846783 GCTGGTGCTGTGCCAGACGCTGG - Intronic
1061821482 9:133229320-133229342 GCTGGTGATGGGGCAGAGGCAGG + Intergenic
1061833957 9:133317043-133317065 GCTGGTGATGGGGCAGAGGCAGG - Intergenic
1062008928 9:134256764-134256786 CCTGGTGCTGGGCAGGAAGGTGG + Intergenic
1062237766 9:135520754-135520776 GCTGGTGATGGGGCAGAGGCAGG - Intergenic
1062322696 9:135998170-135998192 GGTGGGGCCGGGCCAGGAGCTGG - Intergenic
1062399898 9:136367729-136367751 GCGGGAGCTGGGCGAGAAGGCGG - Exonic
1062405791 9:136395611-136395633 CCTGCTGCTGGCCCAGAACCGGG - Exonic
1062405792 9:136395611-136395633 CCCGGTTCTGGGCCAGCAGCAGG + Exonic
1062427883 9:136514405-136514427 GCTTGAGATGGGCCAGAAACGGG - Intronic
1062440009 9:136565559-136565581 GCTGGAGCCGGCCCAGATGCAGG + Intergenic
1062444492 9:136587952-136587974 GGGGGTGCTGGGCCAGTTGCGGG + Intergenic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1062586386 9:137251753-137251775 GCTGTTGTTGGGCCCGGAGCCGG + Exonic
1203746597 Un_GL000218v1:43648-43670 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1203563512 Un_KI270744v1:75832-75854 GTTGCTTCTGGGCCAGCAGCAGG - Intergenic
1203622316 Un_KI270749v1:136110-136132 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1203622836 Un_KI270749v1:138276-138298 TCCGGGGCAGGGCCAGAAGCAGG - Intergenic
1185475729 X:414148-414170 GCCGGGGCTGGGGCAGGAGCAGG + Intergenic
1186660832 X:11665805-11665827 GCTGGGGCGGAGCCAGGAGCAGG + Intergenic
1188562561 X:31485975-31485997 GCCTGGGCTGGGCCAGAACCTGG + Intronic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1190540899 X:51477536-51477558 ACTGATGCAGGGCCAGAATCTGG - Intergenic
1192139807 X:68638071-68638093 GATGGAGCTGGGCCTGAAGGTGG - Intergenic
1192818020 X:74614535-74614557 GCAGGCGCTGGGCTAGAGGCGGG - Exonic
1193450468 X:81658629-81658651 GCTGGTACTGGGGTACAAGCTGG - Intergenic
1195095085 X:101494020-101494042 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095092 X:101494038-101494060 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095102 X:101494062-101494084 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195610781 X:106863967-106863989 GGTAGTGCTGGGCTGGAAGCTGG + Intronic
1196286819 X:113892455-113892477 GATTTTGATGGGCCAGAAGCAGG - Intergenic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1197570526 X:128145796-128145818 GCTGATACAGGGCCAGAATCTGG + Intergenic
1198082176 X:133250590-133250612 GCAGGCGCTGGCCCAGCAGCAGG + Intergenic
1199045583 X:143167446-143167468 GCAGGTGTTGGGCCAGAAGCAGG + Intergenic
1199975599 X:152893396-152893418 GCTGCTTCTGGGGCAGCAGCAGG + Intergenic
1200097886 X:153672660-153672682 GGTGGTGCTGGCCCAGGAGCGGG - Exonic
1201159924 Y:11158662-11158684 GTTGCTTCTGGGCCAGCAGCAGG + Intergenic
1201304159 Y:12536601-12536623 GCGGGCGCTGGGACAGACGCTGG - Intergenic
1202583290 Y:26403294-26403316 GCTGGGGCAGGGCCAGAGCCAGG + Intergenic
1202583462 Y:26403893-26403915 GCTGGTGCTAGGCCAGTGACAGG + Intergenic