ID: 975992223

View in Genome Browser
Species Human (GRCh38)
Location 4:80268563-80268585
Sequence AAGTGGGTAAGGCGGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975992214_975992223 10 Left 975992214 4:80268530-80268552 CCAGCAGTCTCCAGAGGGGGGTC 0: 1
1: 0
2: 2
3: 13
4: 138
Right 975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 146
975992217_975992223 0 Left 975992217 4:80268540-80268562 CCAGAGGGGGGTCGGAGGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975992223 Original CRISPR AAGTGGGTAAGGCGGTAGGC TGG Intronic
900845926 1:5100664-5100686 AATTAGGTAAGACTGTAGGCAGG + Intergenic
901915453 1:12495994-12496016 AAGTGGGGAGGGCGGTAGAGGGG - Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
917591441 1:176480558-176480580 AGGTGGGGAAGGGGATAGGCAGG + Intronic
918543524 1:185657556-185657578 AAGAAAGAAAGGCGGTAGGCAGG - Intergenic
919187383 1:194170077-194170099 AAGGGGGGAAGGTGGTAGGAGGG - Intergenic
920949355 1:210557858-210557880 AAGTGGGCAAGGCACTTGGCTGG + Intronic
924357845 1:243202298-243202320 AAGTGGGGAAGCCGGAAGGCGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1067200974 10:44171873-44171895 AAATGGGTAAGCAGGGAGGCAGG + Intergenic
1067805931 10:49393953-49393975 AAGTGGGTAAGGCAGAAGTTTGG - Intronic
1072123912 10:92428993-92429015 AAATGGGAAAGGCTTTAGGCAGG + Intergenic
1074384592 10:113006891-113006913 AAGTGGGAAGGGCAGGAGGCTGG - Intronic
1075185460 10:120252091-120252113 AAGTGGGGAAGGGGGTGGGAAGG + Intergenic
1076614752 10:131748039-131748061 AAGGGGCTAAAGCGGGAGGCTGG - Intergenic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1080649105 11:34208922-34208944 AAGGGGGTAAGCCTGGAGGCAGG - Intronic
1081711389 11:45218705-45218727 AGGTGGGTAGGGTGGTGGGCTGG + Intronic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1084935970 11:72586824-72586846 AAGTGGGGAAGGGCTTAGGCAGG - Intronic
1085216680 11:74839145-74839167 AAGGGGGGAAGGCAGTAAGCTGG - Exonic
1085721346 11:78914897-78914919 AAGCGGGTGAGCCGGCAGGCTGG - Intronic
1086143079 11:83520569-83520591 AGGTAGGTAAGTAGGTAGGCAGG + Intronic
1089703894 11:120263284-120263306 AAATGGTTAAGATGGTAGGCTGG - Intronic
1090905429 11:131070552-131070574 AAGTGGCTAAGGCTGCAGGGAGG - Intergenic
1094768236 12:33622380-33622402 AAGTAGGTAATGAGGTAGGAGGG - Intergenic
1096786169 12:54018359-54018381 AAATGGGGAAGGCCCTAGGCTGG + Intronic
1097312300 12:58133378-58133400 GAGTGGGCAAGACGGTAGTCAGG - Intergenic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1101873951 12:108586823-108586845 AAGTGTGTAAGGCTGAAGGAGGG - Intergenic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1107631069 13:42343466-42343488 AAATGGGTGAGGCGTTAGGGTGG - Intergenic
1108620429 13:52177762-52177784 AAGTGTGTAAACAGGTAGGCTGG - Intergenic
1110290680 13:73803468-73803490 CAGTGTGGAAGGTGGTAGGCAGG - Intronic
1111149770 13:84235150-84235172 AAGTGGGTAAAGCGGGACACTGG + Intergenic
1113192284 13:107762561-107762583 ATGGAGGTAAGGCGGAAGGCAGG + Intronic
1114663553 14:24366202-24366224 GAGAGGGGAAGGCGGTTGGCTGG + Intronic
1118816586 14:69318382-69318404 AAGTGGGGAAGGCAGCAGGCTGG + Intronic
1119227663 14:72956413-72956435 AAGTGCGTAAGGCAGTACGAAGG + Exonic
1122029332 14:98901194-98901216 AAGAGGGAAAGGAGGCAGGCAGG - Intergenic
1122540101 14:102493333-102493355 GAGTGGGGAAGGCGGGAGCCTGG + Intronic
1124228858 15:27923209-27923231 AAGTGGATAAAGTGGTAGACTGG - Intronic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1127968716 15:63942801-63942823 AACTGGGGAGGGTGGTAGGCAGG - Intronic
1130685138 15:86030692-86030714 AAGTTGGGCAGGGGGTAGGCGGG - Intergenic
1136118432 16:28111771-28111793 AGCTGGGGAAGGAGGTAGGCAGG - Intronic
1137509768 16:49089002-49089024 GAGAGGGTAAGGGGGTAGGAGGG + Intergenic
1141606861 16:85158812-85158834 CAGAGGGTAAGGAGGTGGGCAGG - Intergenic
1144341934 17:14317364-14317386 GAATGGGTCAGGTGGTAGGCAGG + Intronic
1147996537 17:44363084-44363106 GAGTGGGTGAGGCTGTGGGCGGG - Intronic
1149889288 17:60372068-60372090 AAGTGGCTAAGGTGGAAGGAAGG + Intronic
1153900704 18:9614739-9614761 CAGCGGGAAAGGCGGGAGGCGGG - Intronic
1156394904 18:36690627-36690649 GAGTGGTGAAGGCGGTGGGCTGG - Intronic
1156419276 18:36933509-36933531 AAATGTGCAAGGTGGTAGGCTGG - Intronic
1162998520 19:14351409-14351431 AAGGGGGTTAGGAGGAAGGCAGG - Intergenic
1163315075 19:16535951-16535973 AGGTGGGTGAGGAGGTGGGCAGG - Intronic
1163645521 19:18486929-18486951 ATGTGGGTGAGGTGGCAGGCAGG - Intronic
1164474433 19:28564242-28564264 AAGTGGGAGAGGAGGTAGACAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165064333 19:33220216-33220238 AAGTGGGTTAGGCTGGAGTCGGG - Intronic
1165162523 19:33826084-33826106 AAGAAGGTAAGGCAGGAGGCTGG + Intergenic
1166226577 19:41399409-41399431 AAGTGGGGCAGGAGGTGGGCAGG + Intronic
927968363 2:27286890-27286912 AAGTGGTTGAGGAGGCAGGCTGG - Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG + Intronic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
933705982 2:85290749-85290771 AAGAGGGTAAGCTGGCAGGCTGG + Intronic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
936844290 2:116812311-116812333 AAGTGGGCAAGGAGTTAGGGTGG + Intergenic
937004325 2:118497374-118497396 AAGTGGGACAGGCGGTTGGCAGG - Intergenic
937515566 2:122651203-122651225 AAGAGGGTAAGGTGGCAGGTCGG + Intergenic
944131574 2:196353097-196353119 AAGGGGGTAAGGAGCGAGGCGGG - Intronic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
947592569 2:231393992-231394014 AAGTGGGGAACTCGGAAGGCTGG + Intergenic
947933218 2:233981408-233981430 AAGTGGTTATGGGGGTGGGCTGG + Intronic
1169540992 20:6599649-6599671 AATGGGGTAAGGCAGGAGGCAGG - Intergenic
1170673184 20:18454050-18454072 AAGTGGCCAAGGCAGGAGGCAGG + Intronic
1173371630 20:42441594-42441616 AAGTGTGGAAGGGGGTGGGCAGG + Intronic
1173980086 20:47217125-47217147 AGCTGGGTAAGGAGGTAGGAAGG + Intronic
1176061771 20:63175702-63175724 GGGTGGGTAAGGTGGAAGGCTGG - Intergenic
1178427407 21:32490098-32490120 AAATGGTCAAGGTGGTAGGCCGG - Intronic
1178444597 21:32627329-32627351 AAGTGGGTAAAGGGGTACACGGG + Intergenic
1179370811 21:40804611-40804633 AAGTGGGCAGGGCAGGAGGCAGG - Intronic
1181379068 22:22485120-22485142 AAGAGAGGAAGGAGGTAGGCAGG + Exonic
1183033557 22:35123515-35123537 AGGTGGAGAAGGCGGCAGGCTGG - Intergenic
954305197 3:49721948-49721970 CAGTGGGTAAGCCTGTGGGCTGG - Exonic
955933027 3:64077023-64077045 AAGTGGGAAAGGAGGAAGGTGGG + Intergenic
957131133 3:76223379-76223401 AAGTAGGTAGGGGGGTAGGGAGG + Intronic
961062282 3:123840266-123840288 AAATTGGTAAGCCTGTAGGCAGG + Intronic
962168487 3:133076075-133076097 ATTTGGGTAAGGAGGAAGGCAGG + Intronic
962979573 3:140475566-140475588 AAGTGGGTAAGACGGCAGCAGGG - Intronic
969002253 4:3991806-3991828 AACTGGGTTAGGAGGGAGGCTGG + Intergenic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
979243963 4:118477182-118477204 AAGTGGGGAAGCCGGAAGGTGGG - Intergenic
979736825 4:124096916-124096938 AAAGGGGTAAGGTGGCAGGCAGG - Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
985965807 5:3338219-3338241 GAGGAGGGAAGGCGGTAGGCAGG + Intergenic
990217855 5:53553634-53553656 AAGTGGGTAAGGATGAATGCAGG + Intergenic
991350743 5:65718283-65718305 AACTGGGTGAGGCGGGTGGCTGG - Intronic
992324778 5:75650081-75650103 AAGGGGGTGATGTGGTAGGCAGG + Intronic
993161605 5:84298648-84298670 AAGTGGGTGAGAAGGGAGGCTGG - Intronic
993987781 5:94618305-94618327 GAGTGGATAAGACGGTAAGCCGG + Intronic
995814912 5:116157353-116157375 AGGTGGGCAAGGCAGTTGGCTGG + Intronic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
997258614 5:132448262-132448284 AAGTGGAGAAGACTGTAGGCAGG - Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1003226514 6:4210934-4210956 CAGTGGGTGAGGCGGGGGGCGGG - Intergenic
1003234305 6:4282045-4282067 AAGTGGGTTAGGCAGGTGGCGGG + Intergenic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1006856108 6:37134439-37134461 AAGGAGGTAAGGCTGGAGGCAGG - Intergenic
1007545862 6:42694085-42694107 GAGTGGTGAAGGCAGTAGGCTGG - Intergenic
1017980560 6:159397726-159397748 TAGTGGGTAAGTGGGTAGGGAGG - Intergenic
1019478688 7:1256161-1256183 GCGTGGGGAAGGCGGGAGGCTGG - Intergenic
1019498640 7:1353122-1353144 GGGTGGGGAAGGCGGTGGGCAGG - Intergenic
1020460546 7:8425198-8425220 AGGTGGGAAAGGCTGTAGGTAGG + Intergenic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024042638 7:45567167-45567189 AAGTGGGTGTGGGGGTGGGCTGG + Intergenic
1029160512 7:98548455-98548477 AAGTAGGTAAGTAGGTAGGTAGG - Intergenic
1029160571 7:98548783-98548805 AAGTGGGTAGGTAGGTAGACAGG - Intergenic
1029160572 7:98548791-98548813 AAGTAGGTAAGTGGGTAGGTAGG - Intergenic
1029558830 7:101289266-101289288 AAGTGGGAAGGGAGGTCGGCTGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1031901578 7:127417211-127417233 AAGGGGGTACGGCGGGGGGCGGG - Intronic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1035105981 7:156441831-156441853 AAGGGGGTAAGGGGAGAGGCTGG - Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036584079 8:10106889-10106911 AGGTGGGTAGAGGGGTAGGCGGG - Intronic
1038446709 8:27609674-27609696 AAGTGGGCACGGCGGGGGGCTGG - Intronic
1047845270 8:128798890-128798912 AAGTTGGTCAGAAGGTAGGCAGG - Intergenic
1049797673 8:144504029-144504051 CAGTGGGTGAGGTGGCAGGCGGG - Intronic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061522143 9:131125128-131125150 AAGTGTGGAAGGTGGAAGGCTGG - Intergenic
1185933574 X:4230411-4230433 AGGTGGGTAAGTAGGTAGGTAGG - Intergenic
1186244121 X:7602577-7602599 AAGTAGGTAAGTAGGTAGGTAGG + Intergenic
1186446572 X:9635101-9635123 GAGTTGGTATGGCTGTAGGCAGG + Intronic
1187253864 X:17623476-17623498 AAGTGGGGATGGGGGTAGGGGGG + Intronic
1188052058 X:25499756-25499778 AGGTAGGTAAGGAGGTAGGTAGG - Intergenic
1189286704 X:39856884-39856906 AAGTGGGGAAGGCAGAAGACAGG - Intergenic
1189341522 X:40208040-40208062 AAGTAGGTAGGTAGGTAGGCAGG - Intergenic
1190260775 X:48795486-48795508 CTGTGGGTCAGGCGGCAGGCTGG + Intergenic
1191820928 X:65306996-65307018 AAGTGGGTATGGTGAGAGGCTGG + Intergenic
1192148741 X:68698808-68698830 AAGTGGGTAGGGCAGTTGGCAGG + Intronic
1194932118 X:99901226-99901248 AAGAGGAACAGGCGGTAGGCAGG + Intergenic
1195583270 X:106532434-106532456 CACTGGGCAAGGTGGTAGGCTGG - Intergenic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1196814369 X:119653328-119653350 AAGTGGGGAAGGCCGTAGGAAGG - Intronic
1200146100 X:153927116-153927138 AAATCGGGAAGGCGGGAGGCGGG + Intronic
1200758693 Y:7016162-7016184 GAGTTGGTATGGCTGTAGGCGGG + Intronic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic