ID: 975994296

View in Genome Browser
Species Human (GRCh38)
Location 4:80296647-80296669
Sequence CTGAGTTATGAGCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975994296_975994297 2 Left 975994296 4:80296647-80296669 CCTTTTCAGTGCTCATAACTCAG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 975994297 4:80296672-80296694 GCTGAATATGCAGCTGCTCAAGG 0: 1
1: 0
2: 0
3: 18
4: 163
975994296_975994298 21 Left 975994296 4:80296647-80296669 CCTTTTCAGTGCTCATAACTCAG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 975994298 4:80296691-80296713 AAGGCCGTGCCTCTTACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975994296 Original CRISPR CTGAGTTATGAGCACTGAAA AGG (reversed) Intronic
900249215 1:1658487-1658509 CTGAGTTAAGAGCCTTTAAACGG - Intronic
900260163 1:1723831-1723853 CTGAGTTAAGAGCCTTTAAACGG - Intronic
901094266 1:6665769-6665791 CTGTGTTAGGAGCAGTGAAAGGG - Intronic
902577152 1:17385553-17385575 CTGGGTTATGATCATTGTAATGG + Intronic
908514436 1:64877770-64877792 CTGTGTGATCAGCATTGAAATGG - Intronic
910990511 1:93051267-93051289 CTGAGAACTGAGAACTGAAAGGG + Intergenic
911227408 1:95321502-95321524 CTCAGATCTGAGAACTGAAAGGG + Intergenic
913303701 1:117400305-117400327 AAGAGTTATTAGCACTGAAAAGG - Intronic
915027770 1:152848749-152848771 CTAAGACATGAGTACTGAAAGGG - Intergenic
915899111 1:159833813-159833835 CTGAATTCTGAGCCCTTAAAAGG + Intronic
916240411 1:162633453-162633475 CAGAGTTAAGAGTCCTGAAAAGG + Intronic
916572728 1:166041438-166041460 CAGAGTTATCAACACTGACATGG - Intergenic
917681089 1:177368411-177368433 CTGAGTAATGAGAACAGAGAGGG - Intergenic
919191022 1:194219108-194219130 CTGAGTTATCAGTGCTCAAAAGG + Intergenic
920953746 1:210598497-210598519 CTAAGTTCTGACCACTGGAATGG + Intronic
921182231 1:212640557-212640579 CTGAGTTCTGGCCACTGAAATGG + Intergenic
921536532 1:216355587-216355609 CTGAGCTACAAGCAATGAAAAGG + Intronic
1064611064 10:17103130-17103152 CTGGGTTATCAAAACTGAAATGG - Exonic
1064853939 10:19743608-19743630 ATAAGTTATAAGGACTGAAAAGG + Intronic
1069285891 10:66714912-66714934 CTGAAATATGAGAACAGAAAGGG - Intronic
1070018708 10:72562019-72562041 ATGAGTGATGAACAATGAAAAGG - Intronic
1070442426 10:76459936-76459958 CTGGGTGATGAGCCCTGAATGGG + Intronic
1071952284 10:90717451-90717473 CTGAGTTCTGGGCAATGGAATGG - Intergenic
1073357021 10:102863715-102863737 CTGAGTTACTAGAACAGAAAAGG - Exonic
1074281920 10:112060162-112060184 CAGTGTTATGAGCACTGATTAGG - Intergenic
1076212777 10:128662267-128662289 CTCAGGTATAAGCACTGAGATGG - Intergenic
1077738291 11:4815861-4815883 CTGACTCATTAGGACTGAAATGG - Intronic
1078782581 11:14453766-14453788 CTGAGGTAGGAGGACTGATAAGG - Intronic
1079469403 11:20763938-20763960 CTGAGTGATGTGCACTGGCAAGG + Intronic
1079937967 11:26641456-26641478 TTAGGTTATGAGCAATGAAAGGG + Intronic
1080326304 11:31077393-31077415 CAGAGTTATGATTACTCAAATGG - Intronic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1082853068 11:57782584-57782606 CTGAGTTTTGGCCACTCAAAGGG - Intronic
1086401772 11:86466597-86466619 GGGAGTGAGGAGCACTGAAATGG + Intronic
1087798308 11:102477412-102477434 CTGAGTTATGGGGCCTGATAGGG + Intronic
1088352700 11:108908080-108908102 CTGAATTATGAACACAAAAAAGG - Intronic
1089049401 11:115533436-115533458 CTGAGTTTCGAACAATGAAATGG - Intergenic
1089274980 11:117328495-117328517 CTGAGTTAGGAGAACGGACAGGG - Intronic
1089724033 11:120457526-120457548 TTCAGTTATGAGTTCTGAAATGG - Intronic
1091500144 12:1008876-1008898 CTGAGTGCTGAGCACTTGAAAGG - Intronic
1098256109 12:68617154-68617176 CTCAGTTAATAGAACTGAAAGGG + Intronic
1098303523 12:69078717-69078739 CTGAGTTGTGAGGACTGGGAAGG + Intergenic
1101565950 12:105905481-105905503 CTGAGTTTTGACCACTAAAATGG - Intergenic
1102061815 12:109938323-109938345 ATGAGTTATGCGCCCAGAAAGGG - Intronic
1102996575 12:117356074-117356096 CTTTGTTATGATCACTGAGATGG + Intronic
1103875720 12:124125743-124125765 CTGAGGTGTGAGCTCTGAAATGG + Intronic
1106002461 13:25737148-25737170 CAGAGTTATGATCTCTGAATGGG - Intronic
1107782476 13:43918955-43918977 CTGAGGCCTGAGCACTGGAACGG + Intergenic
1110640740 13:77820842-77820864 CTGATTTATGAGTCCTGAAGAGG + Intergenic
1111159597 13:84377145-84377167 CAGAGTTCTGAGCACTCAAAGGG - Intergenic
1111986382 13:95070650-95070672 CTGATTTCTGAGCACTGATGGGG + Intronic
1112930181 13:104725260-104725282 CTTAGTCATGAAGACTGAAATGG - Intergenic
1114419832 14:22572345-22572367 CTGAGTTAGAAGCACATAAAAGG + Intronic
1115681804 14:35747632-35747654 CTGAATAAAGAGCACTGACATGG + Intronic
1117267275 14:54102999-54103021 CTGACTTAAGTGCCCTGAAAAGG + Intergenic
1117432609 14:55683778-55683800 GTGAGTGAGTAGCACTGAAAAGG - Intronic
1117435487 14:55711996-55712018 ATGAGTAATGAGGCCTGAAAAGG - Intergenic
1119477868 14:74941561-74941583 GAGAGTTAAGAGCACTGAAGCGG - Intergenic
1121670935 14:95710277-95710299 CTGAGTCCTGAGCACAGATAAGG + Exonic
1122665955 14:103329737-103329759 CTGAGCTGTGAGCTCTCAAATGG - Intergenic
1124156542 15:27230416-27230438 CTGAGGTCTGAGCACATAAAGGG - Intronic
1124452664 15:29810579-29810601 GTGAGTTAACAGCATTGAAAAGG + Intronic
1126536375 15:49769900-49769922 CAGTTTTATGATCACTGAAATGG + Intergenic
1126676501 15:51163304-51163326 ATGAGTCATGAGCTCTTAAACGG - Intergenic
1126901446 15:53318825-53318847 CTCAGCTCTGAGCACTGACAGGG + Intergenic
1127959806 15:63882394-63882416 CTGAGTTATTTGGACTGGAAGGG - Intergenic
1129392395 15:75226874-75226896 CTGAGTTCTGGGCACTTCAAGGG - Intergenic
1130372773 15:83300377-83300399 CTGAGATAAGAGCAATAAAAAGG - Intergenic
1132337761 15:101059710-101059732 CTCAGTTCTGCTCACTGAAAAGG + Intronic
1138257384 16:55578140-55578162 CTGAGGTATGAGTAGTGAAGAGG - Intronic
1138414644 16:56864733-56864755 TAGAGTTGTGAGCCCTGAAAAGG + Intergenic
1138571703 16:57878254-57878276 CTGATGTAGGAGCAGTGAAATGG - Intergenic
1139204201 16:65010337-65010359 CTGAGTGATGAGATCTGAACGGG - Intronic
1140951838 16:79825766-79825788 CTGAGATATGAACAGTGAAAAGG + Intergenic
1141610443 16:85178229-85178251 CTGAGTCCTGAAGACTGAAAAGG + Intronic
1143352334 17:6297956-6297978 CTGAGGAATGAGCACTAAATTGG + Intergenic
1144709794 17:17394076-17394098 CTGTGTTATTAGCTGTGAAAAGG - Intergenic
1146424610 17:32724751-32724773 CTGAATTATGGGCTCTGTAAAGG - Intronic
1149088047 17:52743283-52743305 GGGAGCTAGGAGCACTGAAATGG - Intergenic
1150731079 17:67694465-67694487 CAGAGTGCTGAGCACTGAGAGGG - Intronic
1151194026 17:72419298-72419320 CACAGTGCTGAGCACTGAAAAGG + Intergenic
1152089454 17:78238740-78238762 CTGAGGTTTGAGGACTGAATTGG + Intronic
1153488194 18:5623322-5623344 CTGAGTTATGAGAAATTGAATGG - Intronic
1154321264 18:13355246-13355268 CTAAGTTATAAGCACTGTCAGGG - Intronic
1154491390 18:14924987-14925009 GGCAGTTATGAGCACTGAATGGG + Intergenic
1156952371 18:42917964-42917986 CACAGTTCTGAGCAGTGAAAAGG - Intronic
1156998674 18:43498489-43498511 CTGAGTAATGACCACAGAACAGG - Intergenic
1157454340 18:47812686-47812708 TTAAGTTATGAGCTCTGATATGG - Exonic
1157773583 18:50373018-50373040 CTGAGTTATGGCCGATGAAAGGG - Intergenic
1159190562 18:65036310-65036332 CTGAGATCTGTGCAATGAAAGGG - Intergenic
1159377674 18:67614855-67614877 CTGATTTATGACCACTGTCAGGG + Intergenic
1159706426 18:71694944-71694966 CTGAGATATTATCACTTAAATGG - Intergenic
1166398710 19:42461960-42461982 CTGAGTGGTGACCACAGAAAGGG + Intergenic
1166586884 19:43957067-43957089 CTGAGTTTTGACCAATCAAAGGG - Intronic
1166867421 19:45848423-45848445 TTGGGTTATGAGCACTGTGAAGG + Intronic
925225126 2:2177383-2177405 CTGACCTATAAGCACTGACAAGG + Intronic
925578670 2:5386804-5386826 ATTAGTTATGAGCACTGACCTGG + Intergenic
928024665 2:27729749-27729771 CTGGGTCATGAGCACAGCAAAGG - Intergenic
928255061 2:29715028-29715050 CTGTCCTATGAGCAGTGAAAGGG + Intronic
928303965 2:30150342-30150364 CTGAGTTATGAGAAATTAAGTGG - Intronic
929087046 2:38178630-38178652 CTGACTTTTGAGCAATGAGATGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930257487 2:49108948-49108970 CTGAACTATGAGCACCAAAAAGG - Intronic
930812105 2:55553481-55553503 CTGAATTATATGCTCTGAAATGG - Intronic
931433934 2:62231306-62231328 CAGAGCTAAGAGCACTTAAAAGG - Intergenic
931968562 2:67560751-67560773 CTGAGTTATAAGCCCTCCAAAGG + Intergenic
932026660 2:68140528-68140550 CTAAGTTACAAGCACTGAGAAGG - Intronic
932587113 2:73037186-73037208 CTGAGATATGAGGGCTGACAGGG - Intronic
933138446 2:78763555-78763577 TAGAGTTATGAGCCCTTAAAAGG + Intergenic
934615860 2:95770342-95770364 GTGCCTGATGAGCACTGAAAAGG + Intergenic
934645035 2:96054216-96054238 GTGCCTGATGAGCACTGAAAAGG - Intergenic
934838442 2:97610305-97610327 GTGCCTGATGAGCACTGAAAAGG - Intergenic
936402148 2:112173234-112173256 CTTAATTATGAGTAATGAAAAGG + Intronic
936919711 2:117675363-117675385 CAGAGTTGTGAGCAGAGAAAGGG - Intergenic
937168235 2:119841719-119841741 CTGAGTAATGAGCATGGGAAGGG - Intronic
937447526 2:121971430-121971452 CTGACTTATGCCCACTGACAAGG + Intergenic
948672480 2:239577433-239577455 GTGAGCTGTGAGCACTGAGATGG + Intergenic
1170373452 20:15674541-15674563 TTGAGTTATGGGGACTGAGAAGG - Intronic
1172838419 20:37887658-37887680 CTGAGCTGTGAGCACTGCAAGGG - Intergenic
1177582267 21:23040047-23040069 TTGAGTTTTGGGCACAGAAAAGG + Intergenic
1177998578 21:28132629-28132651 CTGAGTCATGAGAACTGCAGGGG + Intergenic
1183140788 22:35936861-35936883 CTGAGTTTAGAAGACTGAAAGGG - Intronic
1185319561 22:50194230-50194252 CTGGGTTCTGAGAACTGAACAGG - Intronic
949188043 3:1217829-1217851 TTGAGTTAAAGGCACTGAAAAGG - Intronic
949992395 3:9590501-9590523 CAGAGTTGTGAGCCCTTAAAAGG + Intergenic
951264668 3:20552217-20552239 CTGAGAGCTGAGCACTGAACAGG - Intergenic
951638542 3:24807808-24807830 TTGAGGTATCAGGACTGAAAAGG - Intergenic
952725660 3:36581962-36581984 CTGAGTTCTGACCACTGGGATGG - Intergenic
952976520 3:38701121-38701143 CTAAGTTCTGAGCACTGAGCTGG - Intronic
957774520 3:84739090-84739112 CTGAGTTATTAGAAATAAAAGGG - Intergenic
958611133 3:96428245-96428267 TTGAGTTACAAGCACTCAAATGG - Intergenic
958788794 3:98627832-98627854 CTCAGTGAGGAGCTCTGAAATGG + Intergenic
959551951 3:107669910-107669932 CTGACTCATGAGCATGGAAATGG + Intronic
959616367 3:108352533-108352555 CTAAGATATTAGCACTGGAAAGG - Intronic
963106824 3:141654463-141654485 CTGAGTTTTGAATACTAAAAAGG - Intergenic
963751441 3:149183970-149183992 CTGATTTATAGGAACTGAAATGG + Intronic
964001110 3:151772974-151772996 CTCTGATATGAGTACTGAAAGGG - Intergenic
967375505 3:188796210-188796232 CTGAGTTATGAGGAGTGAGTAGG + Intronic
968082974 3:195859654-195859676 CTGAGTTCTTGGTACTGAAATGG - Intergenic
971524121 4:27594429-27594451 CTGAGTTATGGAAACTGAGATGG - Intergenic
972784260 4:42312352-42312374 TAGAGTTATGAGCCCTTAAAAGG - Intergenic
975629582 4:76386900-76386922 TCGAGTTCTGACCACTGAAATGG - Intronic
975994296 4:80296647-80296669 CTGAGTTATGAGCACTGAAAAGG - Intronic
977709861 4:100112574-100112596 TAGAGTTATGAGCCCTTAAAAGG + Intergenic
979378912 4:119984778-119984800 CTGAGTTATGGGCTCTGGATTGG + Intergenic
979673257 4:123383600-123383622 GTGTGTTATGAGCACTGAATAGG + Intergenic
981896828 4:149811674-149811696 CTGAGCTGAGAGCACTGAAGTGG - Intergenic
986965538 5:13266853-13266875 GTGAGTTATGAGATCTGATAAGG - Intergenic
987139948 5:14935021-14935043 CTGAATTGTGTGCTCTGAAATGG - Intergenic
988721749 5:33885963-33885985 CTGAGTTAGAAGAACTGCAACGG + Intronic
989271583 5:39539738-39539760 CAGAGTTATTAGCATTAAAAAGG - Intergenic
989788985 5:45369306-45369328 ATGAATTATGAGCAGTCAAAAGG - Intronic
995098064 5:108263046-108263068 GTGAGTAATGAGAACTGAGATGG - Intronic
995441796 5:112200322-112200344 CTGTGTAATGAGCACTGTTAGGG - Intronic
995938501 5:117548666-117548688 GTCACTTATCAGCACTGAAATGG - Intergenic
996997493 5:129715846-129715868 CTGAGTTATCAGCACCTAAACGG + Intronic
997242839 5:132320651-132320673 CTCAGTTATGAACAGTGAAGGGG + Intronic
997394705 5:133549473-133549495 CTGTGTTATAAGCAATAAAAAGG - Intronic
997625783 5:135329700-135329722 CTGAGTGATGATCACTGGCATGG - Intronic
999127904 5:149259905-149259927 CTGAATACTGAGCACTGAATGGG + Exonic
999670685 5:153956838-153956860 CTGTGTTATGGGCAGAGAAAGGG - Intergenic
1000133560 5:158322629-158322651 GTGAGTTATGTGCAGGGAAATGG - Intergenic
1000705704 5:164508726-164508748 CTGAGTTATAAGGATTAAAACGG + Intergenic
1001468269 5:171988152-171988174 CTTAGTTCTGTCCACTGAAAGGG + Intronic
1002901508 6:1413737-1413759 CTGTGTCTTGAGCATTGAAAGGG - Intergenic
1003339607 6:5206847-5206869 GTCAGTTATGAATACTGAAAAGG - Intronic
1004361561 6:14975877-14975899 TTGAGTTAGCATCACTGAAATGG - Intergenic
1005984987 6:30866122-30866144 CTGAGAAAGCAGCACTGAAATGG - Intergenic
1007240516 6:40421504-40421526 CTGAGTTATTATCAATAAAAAGG + Intronic
1007994669 6:46293743-46293765 CTCAGGTAAGAGCACAGAAAGGG + Intronic
1009303556 6:62059238-62059260 CTGAGCACTGAGCACTGAATAGG + Intronic
1009461644 6:63920797-63920819 GTGTGTGATGAGCACTGGAAAGG + Intronic
1009618814 6:66045349-66045371 ATGACTTATGAGCAGTGAAATGG + Intergenic
1009805703 6:68599482-68599504 CTTAGCTCTGATCACTGAAAGGG + Intergenic
1010448475 6:75975885-75975907 TTCATTTATGAGCACTGAAATGG + Intronic
1011974153 6:93272538-93272560 CTGAATTGTGAGCTATGAAAAGG - Intronic
1013790305 6:113828978-113829000 TGGAGTTATAGGCACTGAAAAGG - Intergenic
1014333630 6:120102926-120102948 TTGATCTATGAGCACTGACAAGG + Intergenic
1017560386 6:155621419-155621441 CTGAGTTCTGATCATCGAAAGGG - Intergenic
1017560586 6:155624188-155624210 CTGAGTTCTGATCATTGCAAAGG - Intergenic
1020615496 7:10454491-10454513 CTGAGATAGGAACAATGAAAAGG - Intergenic
1023847756 7:44132313-44132335 CTGAGTTAACACCACTGATAAGG - Intergenic
1024626467 7:51212096-51212118 CTATCTTATGAGCACTTAAAAGG - Intronic
1024903462 7:54349395-54349417 CTGAGTCATCAGCACAGAACAGG - Intergenic
1027539333 7:79448770-79448792 GTGAGTTACAAGCAATGAAAAGG + Intronic
1029038475 7:97548417-97548439 CTGAAATATGAGTCCTGAAAAGG + Intergenic
1032446310 7:131986810-131986832 CTGAGTTTTGAGGGATGAAAAGG + Intergenic
1032798906 7:135302525-135302547 CTGAATAATCAGGACTGAAAAGG - Intergenic
1036058944 8:5292970-5292992 CTGAGGTATGAACAGTGAAATGG + Intergenic
1036122824 8:6036498-6036520 CTGCGTTATGAGCACAGAGTAGG + Intergenic
1039803848 8:40982446-40982468 CTGAGTTAGGAGCTTTCAAATGG + Intergenic
1040979215 8:53228328-53228350 ATGAGTTGTGAGCACTGTTACGG + Exonic
1040992442 8:53367271-53367293 CAGAGTTGTGAGCCCTTAAAAGG - Intergenic
1042085980 8:65109179-65109201 CTCAGCTCTGAGGACTGAAATGG - Intergenic
1043660260 8:82731134-82731156 CTGTGCTATGAGCTCTGTAAGGG + Intergenic
1044122507 8:88414955-88414977 TTGAGTTGTCAGCACAGAAATGG + Intergenic
1045441543 8:102218173-102218195 CGGAGTTATGAGCATTTAGATGG + Intronic
1046401103 8:113704223-113704245 CTGAGTCTTGGGCATTGAAAAGG + Intergenic
1046766000 8:118070844-118070866 AAGAGGTATGAGCACTAAAAAGG + Intronic
1048177520 8:132166101-132166123 GTTAGCTATGAGAACTGAAATGG - Intronic
1048407910 8:134141758-134141780 CTGAATTATGAGGAATGACAGGG + Intergenic
1049019178 8:139942097-139942119 CTGATTTGTGAACACTGAACTGG + Intronic
1052436296 9:28434141-28434163 CTAAGCTATGAGGACTGCAAAGG + Intronic
1052458004 9:28725895-28725917 CAAGGTTATAAGCACTGAAAGGG + Intergenic
1056027794 9:82518056-82518078 ATGAGTGATGGGAACTGAAAAGG + Intergenic
1059477850 9:114562169-114562191 CTGAGGAATGAGCATTGCAATGG + Intergenic
1059567517 9:115397905-115397927 CTGAGTTTTGAGCACTGAAGTGG + Intronic
1060160042 9:121353843-121353865 CTGAGTCTTGAGGTCTGAAAAGG - Intronic
1061326222 9:129866364-129866386 CTAAGTTGTGACCACTTAAATGG - Intronic
1189951325 X:46234271-46234293 CTGAGCTTTAAGCACTCAAAGGG + Intergenic
1190796435 X:53748054-53748076 TTCAGTTATGTACACTGAAAAGG - Intergenic
1191638909 X:63409354-63409376 ATGAGTTGTGAGCCCTTAAAAGG + Intergenic
1193022185 X:76802374-76802396 CTGAGCTCTGTGCTCTGAAAGGG - Intergenic
1193713673 X:84910102-84910124 GTGAGTTATCTGCATTGAAATGG + Intergenic
1195367090 X:104137028-104137050 CTGAGTTGTGAGCATTAAATGGG - Intronic
1196282752 X:113842275-113842297 CTGTGTTATTAGCTCTGGAATGG - Intergenic
1196686863 X:118518206-118518228 ATGAATTATGAGCTTTGAAATGG + Intronic
1198520629 X:137448938-137448960 GTGAGTTGTGATCACTGAAGAGG - Intergenic
1200388946 X:155923251-155923273 AAGAATTAAGAGCACTGAAATGG - Intronic
1200423981 Y:3002877-3002899 CTGAGCAATGAGCAAAGAAAGGG - Intergenic
1200852908 Y:7904081-7904103 CTGAGTTAATAGCCCTGAGAGGG + Intergenic
1201270785 Y:12251841-12251863 TAGAGTTATGAGCCCTTAAAAGG + Intergenic
1201783974 Y:17753186-17753208 CTAATTTATTAGGACTGAAACGG + Intergenic
1201817579 Y:18152801-18152823 CTAATTTATTAGGACTGAAACGG - Intergenic
1202060312 Y:20880440-20880462 CTGAATTTTGAGAACTCAAAAGG + Intergenic
1202127354 Y:21580285-21580307 ATGACTTATCAGGACTGAAATGG - Intergenic