ID: 975999637

View in Genome Browser
Species Human (GRCh38)
Location 4:80358302-80358324
Sequence ACATACGTTCTGTTATTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 351}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975999637 Original CRISPR ACATACGTTCTGTTATTTTG GGG Intronic
903713859 1:25348316-25348338 ACAAAAGTTCTCTGATTTTGTGG + Intronic
905431575 1:37928335-37928357 AGCTAAGTTCTGTTTTTTTGGGG + Intronic
909121492 1:71609673-71609695 ACATACGTTCTTATCCTTTGTGG + Intronic
910675998 1:89817638-89817660 GCCTCCGTTCTGTTTTTTTGTGG + Intronic
911148822 1:94577569-94577591 ATATATGTTCTGTTGTTTTTGGG + Intergenic
911836091 1:102621030-102621052 ACATACAGTCTTTTGTTTTGAGG + Intergenic
911891713 1:103379867-103379889 ATATATGTTCTGTTGATTTGGGG - Intergenic
912063291 1:105701526-105701548 ACAAACTTTCTGCTTTTTTGTGG + Intergenic
913712904 1:121504214-121504236 ACGTATATTCTGTTGTTTTGGGG - Intergenic
915039378 1:152955258-152955280 ACATACGATTTTTTTTTTTGTGG - Intergenic
915061101 1:153186179-153186201 ATGTACGTTCTGTTGATTTGGGG + Intergenic
918227610 1:182499139-182499161 ATGTATGTTCTGTTGTTTTGGGG + Intronic
918926476 1:190792901-190792923 ACATATGATCTGTTTTTTTCCGG - Intergenic
919599253 1:199602197-199602219 AAATATGTTCTGTTGATTTGGGG - Intergenic
920309507 1:205040538-205040560 ACCTACTGTCTGTTCTTTTGAGG - Intergenic
920553724 1:206887925-206887947 ACATAAGATCTGTTCCTTTGCGG + Intergenic
921319925 1:213928763-213928785 ACAAACGTCCAGTTATTTTTTGG - Intergenic
921320898 1:213937430-213937452 AAATATGTTCTGTTATTTTAAGG + Intergenic
921979672 1:221242357-221242379 ACATAAGTTCTGTTCTATGGGGG + Intergenic
922693870 1:227716401-227716423 ATATATATTCTGTTGTTTTGGGG - Intergenic
923110656 1:230887327-230887349 AAATGCGTTCTGTTGTTGTGGGG + Intergenic
923416499 1:233767616-233767638 ACATATATTCTGTTGATTTGGGG + Intergenic
924358263 1:243207562-243207584 ATATGCGTTCTGCTATTTGGGGG - Intronic
1064387255 10:14907377-14907399 AGATACATTCTGCTAGTTTGGGG + Intronic
1065067003 10:21979540-21979562 CCATAGGTACTGTTATTTTTAGG + Intronic
1067241169 10:44495798-44495820 ACAAACATTCTGTTGTTTTTGGG - Intergenic
1068535075 10:58232359-58232381 ATGTATGTTCTGTTAATTTGGGG - Intronic
1069241215 10:66141726-66141748 TTATATGTGCTGTTATTTTGGGG - Intronic
1071063013 10:81596230-81596252 ATATAAATTCTGTTGTTTTGGGG - Intergenic
1071244174 10:83744686-83744708 ACGTACATTCTGTTGATTTGGGG + Intergenic
1071891842 10:90017135-90017157 ACATAAGTTTTGGTATGTTGTGG + Intergenic
1072091486 10:92132693-92132715 ACGTATGTTCTGTTGATTTGGGG - Intronic
1072200581 10:93154517-93154539 ACATATTTTCTCCTATTTTGTGG - Intergenic
1072368715 10:94742344-94742366 ATATACATTCTGTTGTTTTGGGG + Intronic
1073570551 10:104577519-104577541 GCATACATTCTGTTCTTTTATGG - Intergenic
1073698403 10:105896107-105896129 ACATATATTCTGTTGATTTGGGG - Intergenic
1074952829 10:118356504-118356526 TCATACATTATTTTATTTTGAGG - Intergenic
1075309687 10:121403233-121403255 ATATATGTTTTGTTATTTTTTGG - Intergenic
1075513099 10:123088023-123088045 ACATTCCTGCTGCTATTTTGGGG + Intergenic
1076340352 10:129741220-129741242 AGACACGGCCTGTTATTTTGTGG - Intronic
1077852969 11:6093044-6093066 ATGTATATTCTGTTATTTTGGGG + Intergenic
1078504487 11:11923555-11923577 ACATATATTCTGTTTTATTGAGG + Intronic
1078862675 11:15264886-15264908 AGTTACTTTCTGTTAGTTTGTGG - Intergenic
1079915194 11:26360892-26360914 ACATACCTACTGTTATTACGTGG + Intronic
1079921028 11:26434886-26434908 ATGTACATTCTGTTGTTTTGGGG + Intronic
1080593456 11:33745381-33745403 ATGTACATTCTGCTATTTTGGGG - Intronic
1083062561 11:59889754-59889776 ATGTATGTTCTGTTGTTTTGGGG + Intergenic
1086506057 11:87505754-87505776 ACGTATATTCTGTTGTTTTGGGG + Intergenic
1086877669 11:92116351-92116373 ATACAGCTTCTGTTATTTTGAGG - Intergenic
1087502971 11:98983096-98983118 ACATATGTTCTGCTATTTGTTGG - Intergenic
1087513745 11:99130637-99130659 ATATATATTCTGTTGTTTTGGGG - Intronic
1088186794 11:107179273-107179295 ACATGCCTTCTGTTATGGTGAGG - Intergenic
1090461781 11:126897390-126897412 CCAAGCGTTCTCTTATTTTGGGG + Intronic
1090740562 11:129655931-129655953 ACATATATTCTGTTGTTTTGGGG - Intergenic
1091068222 11:132537645-132537667 AAATACTTTGTCTTATTTTGTGG - Intronic
1091478438 12:800745-800767 AGTTACCATCTGTTATTTTGGGG - Intronic
1092516162 12:9216036-9216058 ATATATATTCTGTTGTTTTGGGG - Intergenic
1092583023 12:9867250-9867272 ACTTACTTTCTGTCATTTGGTGG - Intronic
1093106009 12:15087980-15088002 CCATAATATCTGTTATTTTGTGG - Intergenic
1093595826 12:20958012-20958034 ATGTATATTCTGTTATTTTGGGG - Intergenic
1093615720 12:21221160-21221182 ACATAGCTTTTATTATTTTGAGG - Intronic
1093796213 12:23315562-23315584 ACATACGTATCATTATTTTGTGG + Intergenic
1095333945 12:41004404-41004426 ATATATATTCTGTTATTTTGGGG + Intronic
1095365598 12:41400546-41400568 ACATATGTTCTGTTTTGTTCTGG + Intronic
1096925410 12:55138914-55138936 ATGTATATTCTGTTATTTTGGGG - Intergenic
1098641396 12:72842009-72842031 ATGTATATTCTGTTATTTTGGGG - Intergenic
1098658623 12:73066285-73066307 ACACATTTTCTGTTATTTTTTGG + Intergenic
1098660871 12:73092760-73092782 AAATACCATCTGTTATTTTCAGG + Intergenic
1098667745 12:73185144-73185166 ACGTATATTCTGTTATTTTGGGG + Intergenic
1099139284 12:78951064-78951086 ACATACGTTCATTTATGTAGAGG - Intronic
1099350105 12:81556483-81556505 ATATATGTTATGTTAGTTTGTGG - Intronic
1099381465 12:81958152-81958174 ACATATGTTCTCTCATTCTGTGG + Intergenic
1100339098 12:93660833-93660855 ATATAAGTACTGTTATTTGGAGG + Intergenic
1104256128 12:127140766-127140788 ACATATATTCTGTTGATTTGGGG + Intergenic
1106907555 13:34424380-34424402 ATATATGTTATATTATTTTGGGG - Intergenic
1107388192 13:39935872-39935894 ACATAAATTTTGTTAATTTGTGG - Intergenic
1109096979 13:58131566-58131588 ACGTATATTCTGTTGTTTTGGGG + Intergenic
1109633133 13:65079470-65079492 ACTTACCTTCTATTATTCTGTGG + Intergenic
1109768786 13:66941850-66941872 ATATACATTCTGCTATTTTTGGG - Intronic
1110245182 13:73315466-73315488 ACATACTTTCTCCCATTTTGTGG - Intergenic
1111650069 13:91079658-91079680 AAATACATTCTGTCATGTTGAGG - Intergenic
1111814345 13:93132117-93132139 ATATACATTCTCTTGTTTTGGGG + Intergenic
1113491192 13:110693361-110693383 ACTTACATTCTTTTTTTTTGAGG + Intronic
1114126646 14:19734924-19734946 AAATACATTCTTTTATTTTTAGG + Intronic
1114584706 14:23799981-23800003 ACATACACTCTACTATTTTGAGG + Intergenic
1115690749 14:35841641-35841663 ACATACATCCTGTTGATTTGGGG + Intronic
1116693285 14:48138747-48138769 ACATACATTCTATTATTGTCTGG + Intergenic
1117248343 14:53909992-53910014 ACATATATTCTGTTGATTTGGGG + Intergenic
1117635873 14:57742749-57742771 ATATATGTTCTGTTGATTTGGGG - Intronic
1118232642 14:63967635-63967657 TCATATAATCTGTTATTTTGAGG - Intronic
1120066009 14:80041494-80041516 ACATATATTCTGTTGATTTGGGG - Intergenic
1123896322 15:24833812-24833834 ACCTACCGTCTGTTCTTTTGAGG - Intronic
1125157160 15:36601001-36601023 ACATAATTTCTATTATTTTTAGG + Intronic
1125240755 15:37572990-37573012 AAATATGTTCTCTCATTTTGTGG + Intergenic
1125845904 15:42853416-42853438 ACATTTATTCTGTTATTTTTTGG + Intronic
1126278222 15:46910225-46910247 ACATATTTTCTGTTGATTTGGGG - Intergenic
1126282730 15:46975183-46975205 AAATACTTTCTCTTATTCTGTGG - Intergenic
1126545434 15:49868471-49868493 ACCTGTCTTCTGTTATTTTGAGG - Intronic
1127021347 15:54751929-54751951 ATGTACGTTCTGTTGATTTGGGG - Intergenic
1127688358 15:61370547-61370569 ACATGCCCTCTGTTATTTAGTGG + Intergenic
1136927968 16:34392485-34392507 AGGTATATTCTGTTATTTTGGGG + Intergenic
1136976606 16:35019321-35019343 AGGTATATTCTGTTATTTTGGGG - Intergenic
1138808796 16:60123957-60123979 ACATAAGTTCTGCTATTTAGAGG - Intergenic
1138865163 16:60809409-60809431 CCCTACATTCTGTTATTATGGGG + Intergenic
1139272721 16:65698858-65698880 ACCTGGGTTATGTTATTTTGAGG + Intergenic
1139406348 16:66721507-66721529 AGATGAGTTTTGTTATTTTGGGG - Exonic
1140148001 16:72330978-72331000 ATATATATTCTGTTGTTTTGGGG + Intergenic
1140333846 16:74084542-74084564 ACATTCCTTCTGTTACTTTTGGG - Intergenic
1144137528 17:12312405-12312427 ATATATATTCTGTTGTTTTGGGG + Intergenic
1146237305 17:31179041-31179063 ATATACATTCTGTTGATTTGGGG - Intronic
1148521221 17:48277348-48277370 ACAGAGGGTCTGTTAGTTTGAGG - Intronic
1149166591 17:53759630-53759652 ACATATATTCTGTTGATTTGGGG + Intergenic
1150567907 17:66358862-66358884 ACATACGTTGTGTCACTTTGAGG + Intronic
1151101962 17:71566137-71566159 ACTTATGTTTTGTTGTTTTGAGG - Intergenic
1151141493 17:71996788-71996810 AAAAATGTTCTGTTAGTTTGGGG + Intergenic
1152576053 17:81141447-81141469 ACTTACTTTCTTTTCTTTTGGGG - Intronic
1153454438 18:5264363-5264385 ACGTATATTCTGTTGTTTTGGGG - Intergenic
1153668477 18:7387595-7387617 AAATAATTTCTGTTATATTGAGG - Intergenic
1155253781 18:23976828-23976850 ATATATATTCTGTTGTTTTGGGG + Intergenic
1156173255 18:34511947-34511969 GCATATTTTCTGTTATTTGGGGG + Intronic
1157854888 18:51096534-51096556 ACATATATTCTGTTGATTTGGGG + Intergenic
1158026524 18:52904349-52904371 TCATAGATTCAGTTATTTTGTGG + Intronic
1159743663 18:72205804-72205826 GTATACGTTTTGGTATTTTGTGG + Intergenic
1161178448 19:2863000-2863022 CCATACCTGCTTTTATTTTGCGG - Intergenic
1163626168 19:18391153-18391175 ATATACATTTTTTTATTTTGGGG + Exonic
1163950826 19:20583704-20583726 ACATAAGGTCTGTTTTATTGTGG + Intronic
1163967265 19:20758358-20758380 ACATAAGGTCTGTTTTATTGTGG - Intronic
1164033553 19:21433363-21433385 ACATAAGGTTTGTTATTTTCTGG + Intronic
1164232217 19:23300081-23300103 ATATATATTCTGTTGTTTTGGGG + Intergenic
1164849094 19:31465801-31465823 ACATGCCTTCTGTTGTTCTGAGG + Intergenic
1167881161 19:52458542-52458564 ACATAGGTTTTATTATTTTGGGG + Intronic
1168462322 19:56569449-56569471 ACTTATTTTCTGTTATTTTCTGG + Intronic
925633723 2:5922074-5922096 ACATCTTATCTGTTATTTTGTGG - Intergenic
928346797 2:30505910-30505932 AGATAAGTTGTGTCATTTTGAGG + Intronic
929649469 2:43663938-43663960 ACATATATTCTGTTGATTTGGGG + Intronic
929850503 2:45584507-45584529 ACAAGCTTTCTGTTATTTTGGGG - Intronic
930078864 2:47431396-47431418 ACATACGTTTTGATATTATGGGG + Intronic
930455492 2:51603462-51603484 ATATATATTCTGTTGTTTTGGGG + Intergenic
931109014 2:59090209-59090231 ATATATATTCTGTTGTTTTGGGG + Intergenic
932389910 2:71378422-71378444 TCATACTTTCTGTTCTTTTTGGG - Intronic
933105742 2:78322787-78322809 AAATATTTTCTGCTATTTTGTGG - Intergenic
933412935 2:81948647-81948669 ACATACATTCTGTTGATTTGGGG + Intergenic
933534540 2:83555774-83555796 ATATATATTCTGTTGTTTTGGGG + Intergenic
933935139 2:87197631-87197653 ACATACGTTCTGTAAATCTTAGG - Intergenic
934218863 2:90062707-90062729 ATATATATTCTGTTGTTTTGGGG + Intergenic
934877520 2:97938704-97938726 ACATATATTCTGTTGATTTGGGG - Intronic
934982664 2:98858133-98858155 ACATATGTTTTGGTATGTTGTGG - Intronic
935480186 2:103577546-103577568 AAATATTTTCTGCTATTTTGTGG + Intergenic
936149416 2:110006157-110006179 ATATATATTCTGTTGTTTTGGGG + Intergenic
936195263 2:110365213-110365235 ATATATATTCTGTTGTTTTGGGG - Intergenic
937397434 2:121549616-121549638 ATATATATTCTGTTATTTTTGGG - Intronic
940094732 2:149961868-149961890 ATGTATATTCTGTTATTTTGGGG + Intergenic
941379984 2:164780431-164780453 ACATATGTTCTTTTTTTTTAAGG + Intronic
941682007 2:168410219-168410241 ATATATATTCTGTTAATTTGGGG + Intergenic
942128463 2:172851401-172851423 ATGTAAGTTCTGTTGTTTTGGGG + Intronic
942728922 2:179042094-179042116 ATGTATGTTCTGTTGTTTTGGGG - Intronic
943073556 2:183169971-183169993 ATATATATTCTGTTGTTTTGGGG + Intergenic
943626506 2:190207211-190207233 AGATAAATACTGTTATTTTGAGG - Intronic
944347665 2:198687452-198687474 ATGTATGTTCTGTTATTTTGGGG - Intergenic
944737366 2:202579619-202579641 ACATGAGTTTTATTATTTTGAGG + Intergenic
944799603 2:203226723-203226745 ACAGACTTTTTGTTTTTTTGGGG + Intergenic
946103491 2:217348989-217349011 AAATATATTCTGTTGTTTTGAGG + Intronic
947479923 2:230489978-230490000 ACATATATTCTGTTGATTTGGGG + Intronic
1168909080 20:1431540-1431562 AAATACTTTCTCTCATTTTGTGG + Intergenic
1171404772 20:24903133-24903155 ATATATGTTCTGTTGATTTGGGG - Intergenic
1175499269 20:59438207-59438229 AAATTCCTTCTGTGATTTTGGGG + Intergenic
1175718369 20:61270473-61270495 ACATAAGTTCTATAATTTTACGG - Intronic
1177694841 21:24557493-24557515 ATGTACGTTCTGTTGATTTGGGG - Intergenic
1178091611 21:29169407-29169429 ACATCCTTTCTGTCATCTTGAGG + Intronic
1180583344 22:16862208-16862230 ATATATATTCTGTTGTTTTGGGG - Intergenic
1181837501 22:25622891-25622913 ACATAGTTTCTGTAATTTAGGGG + Intronic
1183039756 22:35168331-35168353 ATGTATGTTCTGTTAATTTGGGG - Intergenic
1184972338 22:48034151-48034173 ATTTAATTTCTGTTATTTTGGGG + Intergenic
950608442 3:14106859-14106881 AGATGAGTTTTGTTATTTTGGGG + Intergenic
952224556 3:31362052-31362074 ACATCCGCTCTGTGCTTTTGTGG - Intergenic
952615414 3:35266043-35266065 AGATATTTTCTGTTACTTTGGGG - Intergenic
953114001 3:39973578-39973600 ACGTATATTCTGTTGTTTTGGGG - Intronic
955121934 3:56069003-56069025 ATATATATTCTGTTGTTTTGGGG + Intronic
956355270 3:68384630-68384652 ATATATATTCTGTTGTTTTGGGG + Intronic
957307346 3:78474788-78474810 ATATATATTCTGTTATTTGGGGG - Intergenic
957992982 3:87651331-87651353 AAGTATATTCTGTTATTTTGGGG + Intergenic
957994858 3:87676629-87676651 AGGGACGTTCTGTTATTTTCTGG - Intergenic
958471716 3:94529335-94529357 ACATAATTTCTGTTATATTAAGG + Intergenic
958656219 3:97007068-97007090 ATATATATTCTGTTGTTTTGGGG + Intronic
959245750 3:103865439-103865461 ACATACATAGTGTTATTTTATGG - Intergenic
959299652 3:104581182-104581204 ACATAATTTCTCTTATCTTGTGG + Intergenic
959439193 3:106356124-106356146 ATATATATTCTGTTGTTTTGGGG + Intergenic
959679979 3:109084007-109084029 ACATAGTTTTTATTATTTTGAGG - Intronic
959713766 3:109410685-109410707 ACGTACATTCTGTTGATTTGGGG + Intergenic
960685882 3:120293081-120293103 ATGTATGTTCTGTTGTTTTGGGG - Intergenic
961206858 3:125090383-125090405 ACATATATTCTGCTGTTTTGGGG + Intronic
962907616 3:139819098-139819120 ACATATATTCTGTTGATTTGGGG - Intergenic
963726799 3:148931951-148931973 CCATACTTTCTCTCATTTTGAGG - Intergenic
964687260 3:159410343-159410365 AAATACTTTCTGCTATTCTGTGG - Intronic
964741582 3:159971679-159971701 ACATACTGTCACTTATTTTGTGG + Intergenic
964878511 3:161397115-161397137 ATTTACATTCTGTTGTTTTGAGG - Intergenic
965040835 3:163504829-163504851 ACTTAATTTCTATTATTTTGTGG - Intergenic
965097853 3:164257084-164257106 ACATATATTCTGTTGATTTGGGG - Intergenic
967637673 3:191822850-191822872 ATGTATGTTCTGTTGTTTTGGGG - Intergenic
967782194 3:193451807-193451829 ACATTCTTGCTGTTGTTTTGGGG - Intronic
967796949 3:193608668-193608690 ACGTATGTTCTGTTGATTTGGGG + Intronic
970118547 4:12726501-12726523 AAATAGGTTTTGTTGTTTTGTGG + Intergenic
970655140 4:18222777-18222799 ACTTACATTCTGTTGATTTGGGG + Intergenic
973197270 4:47460675-47460697 ACATACTTTTTTTTCTTTTGAGG + Intronic
973544847 4:51971031-51971053 ATGTATGTTCTGTTGTTTTGGGG + Intergenic
973575072 4:52278869-52278891 ATATACGTTGTGTTGTTTTGGGG - Intergenic
974373007 4:61042063-61042085 ACACACATTCTATTACTTTGTGG - Intergenic
974737416 4:65954889-65954911 ACATGCTTTCTGTTATCTTCTGG - Intergenic
975110281 4:70615896-70615918 AAATATGTGGTGTTATTTTGGGG + Intergenic
975999637 4:80358302-80358324 ACATACGTTCTGTTATTTTGGGG + Intronic
976073339 4:81268012-81268034 TCATAGGTTTTGTTATGTTGTGG + Intergenic
976341930 4:83955648-83955670 ACATATATTCTGTTGATTTGGGG + Intergenic
976863332 4:89692610-89692632 ACATATTTTCACTTATTTTGGGG + Intergenic
976968905 4:91080093-91080115 ATGTATGTTCTGTTGTTTTGGGG - Intronic
977467473 4:97400768-97400790 ACATATATTCTGTTGATTTGTGG + Intronic
977524066 4:98123652-98123674 ACGTATATTCTGTTGTTTTGGGG + Intronic
977560614 4:98529823-98529845 ACAGATCTTGTGTTATTTTGTGG - Intronic
977728785 4:100327376-100327398 ACATACTATGTATTATTTTGTGG - Intergenic
977765586 4:100793941-100793963 GCAAACATTCTGTTATTATGAGG + Intronic
979022593 4:115522531-115522553 ATGTATGTTCTGTTGTTTTGGGG + Intergenic
979243556 4:118471956-118471978 ATATGCGTTCTGCTATTTGGGGG + Intergenic
979876198 4:125894871-125894893 ATATATGTTCTGTTGATTTGGGG - Intergenic
980583250 4:134782264-134782286 ATATATATTCTGTTGTTTTGAGG + Intergenic
980622657 4:135329312-135329334 ACATATGTTCTGCACTTTTGTGG + Intergenic
980699626 4:136407836-136407858 ACAAATGTTCTATTATTTTCAGG + Intergenic
982840431 4:160177394-160177416 ACGTACATTCTGTTGTTTTGAGG - Intergenic
982879134 4:160688456-160688478 ATATACATTCTGTTGTTTTGAGG - Intergenic
983292265 4:165821550-165821572 ATGTACGTTCTGTTGATTTGGGG - Intergenic
983417339 4:167475374-167475396 ACATACTTTTTTTTTTTTTGTGG - Intergenic
983596044 4:169469584-169469606 ATATACATTCTGTTAATTTGGGG + Intronic
984071201 4:175115126-175115148 ATGTATATTCTGTTATTTTGGGG - Intergenic
984724284 4:183005063-183005085 ATGTACATTCTGTTGTTTTGGGG - Intergenic
986267115 5:6200450-6200472 TCCTAGGTCCTGTTATTTTGAGG - Intergenic
989078309 5:37588452-37588474 ATATACGTTCTATTATGTTGAGG - Intronic
991532387 5:67630222-67630244 ACATATATTCTGTTGATTTGGGG + Intergenic
993405545 5:87507947-87507969 ACATATATTCTCTTGTTTTGGGG - Intergenic
993896822 5:93545294-93545316 ACAGAGGTTCTGCTATTTTGTGG + Intergenic
994235048 5:97353493-97353515 ATGTATGTTCTGTTGTTTTGGGG + Intergenic
994581122 5:101643107-101643129 ACACACTTTCTGTGATTTCGTGG + Intergenic
995284438 5:110370487-110370509 AAATATGGACTGTTATTTTGAGG + Intronic
995431387 5:112082248-112082270 AAATACCTTCTCTCATTTTGTGG - Intergenic
995437619 5:112155258-112155280 ACATATGTTTTGTGATGTTGTGG - Intronic
995824787 5:116283637-116283659 AAATAAGACCTGTTATTTTGAGG + Intronic
996751157 5:126890253-126890275 ACATACTTTTTTTTTTTTTGAGG + Intronic
997181990 5:131839317-131839339 ATATATGTTTTGTTGTTTTGGGG + Intronic
998759343 5:145415021-145415043 ATGTATATTCTGTTATTTTGGGG - Intergenic
998925909 5:147126341-147126363 ACATTTATTCTGTTGTTTTGAGG + Intergenic
999740746 5:154549418-154549440 AAATACTTTCTCCTATTTTGTGG + Intergenic
1000634544 5:163629279-163629301 TCATAAGTTTTGTTATTTTGGGG + Intergenic
1000738186 5:164931897-164931919 ACATATATTCTGTTGATTTGGGG + Intergenic
1001572247 5:172737610-172737632 ACATATGTTCTGTTCTCATGTGG - Intergenic
1001965669 5:175908395-175908417 ACATATGTGCTGTTATTTTTAGG - Intergenic
1002251279 5:177930800-177930822 ACATATGTGCTGTTATTTTTAGG + Intergenic
1003337748 6:5190593-5190615 ATATGGGATCTGTTATTTTGTGG - Intronic
1003647753 6:7928359-7928381 ATGTACATTCTGTTAATTTGGGG - Intronic
1003819962 6:9884979-9885001 ACGTATGTTCTGTTGATTTGGGG - Intronic
1004396448 6:15249367-15249389 ACCTACTGACTGTTATTTTGGGG + Intronic
1004428258 6:15520999-15521021 AAATCCATTCTGTTATTTTTTGG + Exonic
1008167311 6:48154012-48154034 ACGTATATTCTGTTATTTTTGGG - Intergenic
1008716207 6:54293085-54293107 ATGTACATTCTGTTGTTTTGGGG + Intergenic
1008811011 6:55498959-55498981 ATATACATTTTGTTTTTTTGTGG - Intronic
1009472466 6:64044653-64044675 ACATTCTTTCTGTTCTTTTCAGG + Intronic
1010062703 6:71643022-71643044 ACATACCTTCTGAGCTTTTGAGG + Intergenic
1010471066 6:76229286-76229308 ACAGAAGTTCTTTGATTTTGTGG + Intergenic
1010475217 6:76278313-76278335 ATATACGTTCTCCTATTTTGTGG + Intergenic
1010547067 6:77172186-77172208 ACATGCGTCTTATTATTTTGAGG + Intergenic
1010593771 6:77740275-77740297 ATGTACATTCTGTTGTTTTGAGG + Intronic
1010895833 6:81362232-81362254 AAATACTTTCTGTCATTTTGGGG - Intergenic
1011937417 6:92798599-92798621 ATATACTTTCTGTTCTTTTCAGG + Intergenic
1013708503 6:112869478-112869500 ACGTATGTTCTGTTGTTTTGGGG - Intergenic
1014128231 6:117802147-117802169 ACATATATTCTGTTGATTTGGGG + Intergenic
1014792179 6:125685473-125685495 ATGTACATTCTGCTATTTTGGGG - Intergenic
1014868484 6:126561126-126561148 ACATATATTCTGTTGATTTGGGG - Intergenic
1015614211 6:135057951-135057973 AAAGACGATCAGTTATTTTGAGG - Intronic
1015802332 6:137072824-137072846 ACATATATTCTGTTGATTTGGGG - Intergenic
1020446251 7:8271469-8271491 ACTTATGTTCTGTTTTTTTTTGG + Intergenic
1020542779 7:9481189-9481211 AAATATGTTCTCTCATTTTGTGG + Intergenic
1021235700 7:18139977-18139999 GCATACATTCTGTTGTTCTGTGG + Intronic
1022351356 7:29568557-29568579 ACATACTTTCTTTTAATTTAAGG - Intergenic
1022478722 7:30729035-30729057 ACATACCTTCAGTTATTTCTTGG + Intronic
1022634914 7:32122394-32122416 ACATATATTCTGTTGATTTGGGG - Intronic
1023531582 7:41162262-41162284 GCCTAAGTTCTGTTATTTTGAGG + Intergenic
1024297635 7:47858358-47858380 GGATACCTTCTGTTTTTTTGAGG - Intronic
1024408604 7:49012454-49012476 ATATATATTCTGTTGTTTTGGGG - Intergenic
1024482441 7:49877926-49877948 ACATAGGTTCTGTCATTTTGGGG + Intronic
1025184668 7:56848318-56848340 ACATTCACTCTGTTATTTTTTGG - Intergenic
1025687262 7:63728644-63728666 ACATTCACTCTGTTATTTTTTGG + Intergenic
1027506128 7:79019068-79019090 ATGTACATTCTGTTCTTTTGTGG - Intronic
1028143241 7:87294136-87294158 ATGTATGTTCTGTTGTTTTGGGG - Intergenic
1028386825 7:90264417-90264439 AAAACCATTCTGTTATTTTGTGG + Intronic
1028814872 7:95132329-95132351 AGATTGGTTTTGTTATTTTGAGG + Intronic
1028837003 7:95385595-95385617 ACATATATTGTGTTGTTTTGGGG - Intronic
1029097455 7:98099856-98099878 ACATATTTTCTTTCATTTTGTGG + Intergenic
1029181935 7:98708453-98708475 ACATACTTTTTTTTTTTTTGGGG - Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030401566 7:109058206-109058228 TTATATATTCTGTTATTTTGGGG + Intergenic
1031422992 7:121571584-121571606 AAATACGTTATTTTATTTTGAGG - Intergenic
1033924255 7:146437956-146437978 ATACAGGTACTGTTATTTTGTGG - Intronic
1033955080 7:146837521-146837543 TCATCATTTCTGTTATTTTGGGG + Intronic
1037075820 8:14716452-14716474 GCACACTTACTGTTATTTTGGGG + Intronic
1037846238 8:22285065-22285087 ACCTACTTACTGTTTTTTTGTGG + Intronic
1038852552 8:31294188-31294210 ATATACTTTCTGTCCTTTTGGGG - Intergenic
1039154336 8:34538082-34538104 ACATATATTCTGTTGATTTGGGG - Intergenic
1039256853 8:35728588-35728610 ACATATGCTCTGTTATTTGCAGG + Intronic
1039969785 8:42311773-42311795 ACATAGGTTCTGGAATATTGAGG + Intronic
1041073356 8:54146594-54146616 ACATATGTACTATTATTTTGAGG + Intronic
1042389212 8:68213912-68213934 ACATTTATTTTGTTATTTTGTGG + Intronic
1042429318 8:68686624-68686646 ATATAAATTCTATTATTTTGAGG - Intronic
1042489773 8:69383774-69383796 ACGTATATTCTGTTGTTTTGGGG - Intergenic
1042981879 8:74539036-74539058 ATATATATTCTGTTGTTTTGGGG + Intergenic
1043202131 8:77383449-77383471 ACATACCTTCTTTTTTTTTTTGG - Intergenic
1043304733 8:78780696-78780718 ATGTATATTCTGTTATTTTGGGG + Intronic
1044113549 8:88305467-88305489 ATATATATTCTGTTGTTTTGGGG - Intronic
1044494736 8:92863230-92863252 ACATACGTGCGGTTAATTTAAGG - Intergenic
1045012647 8:97971661-97971683 ACAAACTGTCTTTTATTTTGGGG + Intronic
1045631976 8:104135226-104135248 ACATATATGCTGTAATTTTGAGG + Intronic
1045846302 8:106640518-106640540 ACATATGGTCTCTTCTTTTGAGG + Intronic
1045860326 8:106809340-106809362 ACATTCTTTCTGTTCTATTGAGG - Intergenic
1046056792 8:109087752-109087774 AGATACTGTCTGTTATGTTGGGG - Exonic
1046274734 8:111943542-111943564 ACATACTTGTGGTTATTTTGTGG - Intergenic
1046987119 8:120400161-120400183 ATGTATGTTCTGTTGTTTTGGGG - Intronic
1048437815 8:134433981-134434003 GCCTCCGTTCTGTTATTGTGAGG - Intergenic
1048619425 8:136115404-136115426 ACATACGTCCTGGTAATTTAGGG - Intergenic
1049900360 9:156238-156260 ACAGGAGTTCTGTAATTTTGAGG - Intronic
1050881680 9:10708059-10708081 ACATATATTATGTAATTTTGGGG + Intergenic
1051284109 9:15477322-15477344 ACATACATATTTTTATTTTGTGG + Intronic
1052094386 9:24367036-24367058 ATGTACATTCTGTTGTTTTGGGG + Intergenic
1052546201 9:29883430-29883452 AAATACTTTCTTTCATTTTGTGG - Intergenic
1053535225 9:38919009-38919031 AAAGACGTTCTGTGATTTTGGGG - Intergenic
1053743406 9:41166541-41166563 ACAGGAGTTCTGTAATTTTGAGG - Intronic
1053794180 9:41709922-41709944 ATTTACGTTCTGATTTTTTGTGG + Intergenic
1054182588 9:61921961-61921983 ATTTACGTTCTGATTTTTTGTGG + Intergenic
1054207447 9:62143413-62143435 AAAGACGTTCTGTGATTTTGGGG - Intergenic
1054348680 9:63996342-63996364 ACAGGAGTTCTGTAATTTTGAGG - Intergenic
1054446411 9:65322726-65322748 ACAGGAGTTCTGTAATTTTGAGG - Intergenic
1054470771 9:65536017-65536039 ATTTACGTTCTGATTTTTTGTGG - Intergenic
1054483864 9:65698782-65698804 ACAGGAGTTCTGTAATTTTGAGG + Intronic
1054630906 9:67444941-67444963 AAAGACGTTCTGTGATTTTGGGG + Intergenic
1054655920 9:67666518-67666540 ATTTACGTTCTGATTTTTTGTGG - Intergenic
1054684938 9:68264735-68264757 ACAGGAGTTCTGTAATTTTGAGG + Intronic
1054736878 9:68762180-68762202 ACATAGTTTCTGTCTTTTTGTGG - Intronic
1055231268 9:74069085-74069107 ACATACTTTCTTTTATTATTGGG + Intergenic
1055622014 9:78135819-78135841 ACGTATGTTCTGTTGATTTGGGG - Intergenic
1055685853 9:78773969-78773991 CCATACATTCTGTTACTTTTAGG + Intergenic
1056127647 9:83552437-83552459 ATATACATTCTGTTGTTTTGGGG + Intergenic
1056701135 9:88909632-88909654 ACATATATTCTGTTGATTTGGGG - Intergenic
1057765468 9:97913651-97913673 ACATGATTTCTGTTAATTTGTGG - Intronic
1058248686 9:102663981-102664003 AAATACTTTCTCTTATTCTGTGG + Intergenic
1059509751 9:114833895-114833917 ATGTACATTCTGTTGTTTTGGGG + Intergenic
1061159397 9:128884523-128884545 ACATAAGTTCTGATATACTGTGG + Intronic
1203359040 Un_KI270442v1:194980-195002 ATATACATTCTGTTGATTTGTGG - Intergenic
1188718827 X:33498792-33498814 ATATATTTACTGTTATTTTGAGG - Intergenic
1189673816 X:43440982-43441004 ATGTACATTCTGTTGTTTTGGGG + Intergenic
1190271844 X:48870662-48870684 ACATATATTCTGTTGATTTGGGG - Intergenic
1190901593 X:54679581-54679603 ATATATATTCTGTTGTTTTGAGG - Intergenic
1191081564 X:56516434-56516456 AAATACTTTCTTTTATTCTGTGG - Intergenic
1191132373 X:57028489-57028511 ATGTATATTCTGTTATTTTGGGG + Intergenic
1191611425 X:63118653-63118675 ATATACCTCCTATTATTTTGAGG - Intergenic
1191776206 X:64816418-64816440 ATGTATGTTCTGTTGTTTTGTGG - Intergenic
1191823877 X:65342332-65342354 ATCTACATTCTGTTGTTTTGGGG - Intergenic
1192065056 X:67874929-67874951 ACATAGCCTTTGTTATTTTGAGG + Intergenic
1192079851 X:68037228-68037250 ACATATGTTTTATTATGTTGAGG - Intergenic
1192272555 X:69596388-69596410 ACATATTTTCTCTCATTTTGTGG - Intergenic
1192388424 X:70698324-70698346 ACATTCATTCTATTTTTTTGAGG - Intronic
1192655733 X:72991883-72991905 ATGTACATTCTGTTGTTTTGGGG - Intergenic
1193023957 X:76823382-76823404 CCATAAGTTTTGTTATGTTGAGG + Intergenic
1193171282 X:78339238-78339260 ATGTATGTTCTGTTGTTTTGAGG + Intergenic
1193217578 X:78882599-78882621 ACATATATTCTGTTGATTTGGGG + Intergenic
1193261159 X:79407810-79407832 ACATTGCTTGTGTTATTTTGAGG - Intergenic
1194028955 X:88788221-88788243 ACGTATATTCTGTTGTTTTGGGG + Intergenic
1194375891 X:93133200-93133222 ATGTACATTCTGTTAATTTGGGG - Intergenic
1194580837 X:95668473-95668495 ACGTATATTCTGTTGTTTTGGGG - Intergenic
1195153687 X:102099928-102099950 ATATATATTCTGTTGTTTTGGGG - Intergenic
1195610453 X:106861187-106861209 GAATATGTTCTGTTGTTTTGGGG + Intronic
1196013107 X:110909149-110909171 ACATATATTCTGTTGATTTGGGG + Intergenic
1196537687 X:116867069-116867091 ATGTACGTTCTCTTGTTTTGGGG + Intergenic
1196597159 X:117558334-117558356 ACGTACATTCTGTTGATTTGGGG - Intergenic
1196600149 X:117592149-117592171 ACGTATATTCTGTTGTTTTGGGG - Intergenic
1197456778 X:126686122-126686144 ATATACATTCTTTCATTTTGTGG + Intergenic
1197852673 X:130879973-130879995 ATATAGGTTCTTTTGTTTTGAGG - Intronic
1198698979 X:139376165-139376187 ACATATGTTCTGTTGATTTGGGG + Intergenic
1199262590 X:145792644-145792666 AGATACGTACTCTTGTTTTGAGG + Intergenic
1199309058 X:146301350-146301372 ACTTAGGTTGTGTTTTTTTGGGG + Intergenic
1199407790 X:147483337-147483359 ATATATATTCTGTTATTTTTGGG + Intergenic
1199490246 X:148389510-148389532 AGAAATCTTCTGTTATTTTGAGG - Intergenic