ID: 976000610

View in Genome Browser
Species Human (GRCh38)
Location 4:80370080-80370102
Sequence CCATAATTGTAAGTTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25928
Summary {0: 477, 1: 6480, 2: 8361, 3: 6485, 4: 4125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976000610_976000615 -8 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000615 4:80370095-80370117 AATTATGGCAGAGGGTGAAAGGG 0: 1
1: 13
2: 243
3: 1375
4: 2933
976000610_976000616 -1 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000616 4:80370102-80370124 GCAGAGGGTGAAAGGGAAGCTGG 0: 1
1: 52
2: 297
3: 857
4: 2291
976000610_976000618 21 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000618 4:80370124-80370146 GCACTTTACATGGCCAGAGCAGG 0: 10
1: 52
2: 206
3: 604
4: 1971
976000610_976000614 -9 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000614 4:80370094-80370116 CAATTATGGCAGAGGGTGAAAGG 0: 4
1: 136
2: 1522
3: 2744
4: 5086
976000610_976000619 24 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000619 4:80370127-80370149 CTTTACATGGCCAGAGCAGGAGG 0: 7
1: 90
2: 332
3: 572
4: 1317
976000610_976000617 11 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000617 4:80370114-80370136 AGGGAAGCTGGCACTTTACATGG 0: 1
1: 1
2: 12
3: 71
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976000610 Original CRISPR CCATAATTGTAAGTTTCCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr