ID: 976000614

View in Genome Browser
Species Human (GRCh38)
Location 4:80370094-80370116
Sequence CAATTATGGCAGAGGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9492
Summary {0: 4, 1: 136, 2: 1522, 3: 2744, 4: 5086}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976000610_976000614 -9 Left 976000610 4:80370080-80370102 CCTCAGGAAACTTACAATTATGG 0: 477
1: 6480
2: 8361
3: 6485
4: 4125
Right 976000614 4:80370094-80370116 CAATTATGGCAGAGGGTGAAAGG 0: 4
1: 136
2: 1522
3: 2744
4: 5086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976000614 Original CRISPR CAATTATGGCAGAGGGTGAA AGG Intronic
Too many off-targets to display for this crispr