ID: 976000952

View in Genome Browser
Species Human (GRCh38)
Location 4:80372444-80372466
Sequence CTTAGCCAGCACTGCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976000952_976000957 5 Left 976000952 4:80372444-80372466 CCCAGATAGCAGTGCTGGCTAAG 0: 1
1: 1
2: 1
3: 11
4: 120
Right 976000957 4:80372472-80372494 AGAGGAGAAAAGCCAAACTCTGG 0: 1
1: 1
2: 1
3: 43
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976000952 Original CRISPR CTTAGCCAGCACTGCTATCT GGG (reversed) Intronic
902615628 1:17622054-17622076 ATAAGCCAGCACTGCTTTATGGG + Intronic
902871248 1:19314805-19314827 CTCAGCCACCACTGCCAACTGGG - Intronic
904789070 1:33004801-33004823 CTGAGCCAGAGCTGCTAGCTTGG + Intergenic
907847977 1:58227077-58227099 TTTAGCCAGCTCTACTGTCTTGG - Intronic
910984426 1:92991850-92991872 CTCAGCCAGGACTGCTATCTAGG - Intergenic
913478893 1:119265642-119265664 CTTAGCTAGCTCTTTTATCTAGG + Intergenic
915097205 1:153471481-153471503 CTTGGCCAGCACCACTATCTAGG - Intergenic
919709311 1:200710479-200710501 CTTAGACTGCACAGCCATCTAGG - Intergenic
921602871 1:217125109-217125131 CCTAGCAAGCACTGGGATCTAGG - Intronic
922661052 1:227430607-227430629 CTTTGCCATCACTGCCATTTAGG + Intergenic
1063122466 10:3114631-3114653 CTTCCCCAGCATTGCTGTCTGGG - Intronic
1065811856 10:29450196-29450218 CTGCGCTAGCACTTCTATCTTGG - Intergenic
1075378875 10:122002070-122002092 CTTAGCCAGCACCTTCATCTTGG - Intronic
1088977931 11:114832347-114832369 GTTTGCCAGCACTGCTGTTTAGG + Intergenic
1093614289 12:21203061-21203083 CTTAACCACCACTGTAATCTTGG + Intronic
1094795309 12:33965235-33965257 CTTAGACTGCACTGCAGTCTAGG + Intergenic
1095107945 12:38258341-38258363 CTTAGACTGCACTGCAGTCTAGG + Intergenic
1095378084 12:41555703-41555725 CTTTGGCAGCAATGCTATTTGGG - Exonic
1097429985 12:59493666-59493688 TTGAGCAAGCACTGCAATCTCGG + Intergenic
1098181930 12:67856432-67856454 CCTAGCGAGCACTGCCTTCTGGG + Intergenic
1099769468 12:87032800-87032822 TTCAGCCAACACTGTTATCTAGG - Intergenic
1100836374 12:98570848-98570870 CTTAACCAGCACAGCAATATAGG - Intergenic
1101695048 12:107117268-107117290 GTTAGCAAGCCCTGCTATATGGG + Intergenic
1109417821 13:62066691-62066713 CTTTGCTAGCACAACTATCTAGG + Intergenic
1116469939 14:45275239-45275261 ATTGGCCAGCACCTCTATCTGGG + Intergenic
1117293341 14:54354576-54354598 CTTCCCCAGCGCTGCTCTCTAGG + Intergenic
1122469721 14:101958069-101958091 CTTCCCCAGCATTGCTCTCTAGG + Intergenic
1124582353 15:30969890-30969912 CTTAGCCAACTATGCTTTCTTGG + Intronic
1126569950 15:50140223-50140245 TTGAGCCATCACTGATATCTAGG + Intronic
1132264292 15:100454093-100454115 CCTGGCCAACATTGCTATCTTGG - Intronic
1133509816 16:6446564-6446586 CCTAGCCAGCACTGCCCCCTAGG - Intronic
1133553135 16:6878276-6878298 ATTAGCCAGAACTGCTCTCATGG - Intronic
1140908835 16:79432893-79432915 CTTTGCCAGCACAGTGATCTTGG + Intergenic
1143328743 17:6118950-6118972 ATTAGCCAGCACTTTGATCTTGG - Intronic
1147521176 17:41175149-41175171 CTCAGCCAGCACCGTTATATGGG + Intergenic
1151004687 17:70420863-70420885 CTAAGCCAGCACCATTATCTGGG - Intergenic
1151020879 17:70616068-70616090 CTCAGACATCACTGCTTTCTTGG + Intergenic
1153950335 18:10053061-10053083 CATAGTCATCACTGCTATCATGG - Intergenic
1155142770 18:23057887-23057909 CTTAGCCTGCACTTTCATCTCGG - Intergenic
1155740702 18:29284601-29284623 TTTAACCATCACTGTTATCTAGG - Intergenic
1160245210 18:77153167-77153189 CTCAGCCAGCACTGTTTTCTGGG - Intergenic
1162879925 19:13650780-13650802 CTTAGCCAGAACAGCTGGCTTGG + Intergenic
1164042719 19:21507646-21507668 CATAGCCATGACTGATATCTTGG - Intronic
925634388 2:5928606-5928628 CTCAGCTAGCACTGCCAGCTGGG + Intergenic
928603496 2:32923610-32923632 TTCAGCCAGCCCTGCTATCTAGG - Intergenic
929342512 2:40838522-40838544 CTTACCCTTCTCTGCTATCTTGG - Intergenic
929832737 2:45360494-45360516 CAAAGCCAGCTCTGCTATTTAGG - Intergenic
929999424 2:46850863-46850885 CTCAGTCAGCCATGCTATCTTGG + Intronic
930171748 2:48258578-48258600 CTTAGTAAAAACTGCTATCTGGG - Intergenic
935445827 2:103155545-103155567 CTTAGCCAGCATCGCCAGCTCGG + Intergenic
940046674 2:149417021-149417043 CCCAGCCAGCATTGCTACCTGGG - Intronic
940798751 2:158109132-158109154 CTTAGCCAGGACTGCTGCCCTGG - Intronic
941033397 2:160538704-160538726 CTCAGCCAGCACCACTATCCAGG - Intergenic
942951805 2:181729860-181729882 CTTAGCCAGCTCTGCTATCTAGG - Intergenic
943682144 2:190779672-190779694 CCTAGCTAGCAGTGCTATTTGGG - Intergenic
944383308 2:199136888-199136910 CATTGCCAGCAGTACTATCTGGG - Intergenic
946733845 2:222734545-222734567 CTGAGCCAGCTCTACTAACTTGG - Intergenic
1168799495 20:635104-635126 CTTAACGAGCAATGCTGTCTTGG - Intergenic
1173472265 20:43333041-43333063 CTTAGCAGGCACTGCTCTCAGGG + Intergenic
1177642709 21:23864328-23864350 CTTAGCTAGCATTGGGATCTGGG - Intergenic
1177885240 21:26738569-26738591 TTCAGCCAGCACTCCTATCTGGG - Intergenic
1183402531 22:37613092-37613114 CTGACCCAGCACTGCTACCCTGG + Intronic
949720748 3:6987225-6987247 CTTGGCATGTACTGCTATCTTGG + Intronic
949866770 3:8553454-8553476 CCTGGCCACCACTGTTATCTGGG - Intronic
950202503 3:11055176-11055198 CTTACCCAGCCCTGCTCTCAAGG - Intergenic
952518918 3:34134980-34135002 CTTACCCAGCTCTGGTATCAGGG - Intergenic
954104696 3:48403708-48403730 CTCAGCCAGCCCTGCAGTCTGGG + Intergenic
954334211 3:49906672-49906694 CTTAGCCAGCTATGTTAGCTTGG - Intronic
956367852 3:68524357-68524379 TTTTGCCAGCCCTTCTATCTGGG - Intronic
961590807 3:127979700-127979722 CTTGGACAGCACTGGTATCAAGG + Intronic
963890924 3:150635247-150635269 CTTAACCACCACCGCTAGCTGGG + Intergenic
964990347 3:162803082-162803104 CTCAGCCAGCACCACTCTCTAGG + Intergenic
976000952 4:80372444-80372466 CTTAGCCAGCACTGCTATCTGGG - Intronic
977962196 4:103098658-103098680 CTTAGACTGCACAGCTGTCTGGG + Intronic
978285721 4:107074117-107074139 CTGAGCCAGCACTGGTACCGAGG + Intronic
978489447 4:109296598-109296620 CTTGTCCAGCACTCCTATTTTGG + Intronic
980144322 4:128962518-128962540 CTTAGCCATCCCTGTTTTCTTGG - Intronic
980982216 4:139664543-139664565 ATTGGCCAGCACTGTCATCTTGG + Intergenic
984429187 4:179626574-179626596 ATTAGACTGCACTGCAATCTAGG + Intergenic
985950553 5:3218952-3218974 ATGAGCCAGCACTGCGAGCTGGG + Intergenic
986635797 5:9821079-9821101 GTTGGCCTGCACTGCTATCAAGG - Intergenic
987728277 5:21732448-21732470 CTTAGCCAGCAAGGATGTCTTGG - Intergenic
988574316 5:32405291-32405313 CAGAGCCAGGACTGCAATCTTGG + Intronic
989168545 5:38453482-38453504 CTTAGCATGCTCTGCTATTTAGG - Intronic
991510854 5:67375185-67375207 CTCAGCCAGCACAACTATCTGGG + Intergenic
992793505 5:80234864-80234886 CTTAACTAACACTGTTATCTTGG + Intronic
993600299 5:89914891-89914913 TTTATCCAGCAATCCTATCTGGG + Intergenic
996774549 5:127119775-127119797 CTTAGCCAGCAACACTATCCAGG + Intergenic
997024301 5:130039837-130039859 CTTTGCCACAACTGCTATTTAGG - Intronic
997516414 5:134492983-134493005 CTTTGCCAGCGCTCCTATCCTGG - Intergenic
1003023266 6:2530448-2530470 CTCAGCCAGCACCACTATCCAGG + Intergenic
1005733314 6:28720354-28720376 CTGAGCAATCACTGCTATGTTGG + Intergenic
1005845221 6:29771808-29771830 CTCAGCCAGCACCACTCTCTGGG + Intergenic
1006066258 6:31464498-31464520 CTCAGCCAGCACCACTCTCTGGG - Intergenic
1009758799 6:67977331-67977353 TTCAGCCATCACTGCTATGTAGG - Intergenic
1010015994 6:71105371-71105393 CTCATCCAGCACCACTATCTGGG - Intergenic
1011913446 6:92471313-92471335 GTTAGTCAGCACTGCTTCCTTGG - Intergenic
1013699808 6:112751655-112751677 CTTTCCCAGCTCTGCTACCTTGG - Intergenic
1015908725 6:138145364-138145386 CTTGGCCAGTAAAGCTATCTGGG - Intergenic
1017022763 6:150153674-150153696 CTTAGTCAGCACTGGCATTTTGG + Intronic
1018366606 6:163126891-163126913 CCTGGCCAGCAGTGCTACCTGGG - Intronic
1018710740 6:166496776-166496798 CGTGGCCAGCCCTGCTCTCTGGG + Intronic
1020552776 7:9627615-9627637 CATAACCATCACTGCTATTTTGG - Intergenic
1021777172 7:24065322-24065344 CTTAGCCAGGACTGCTGGCAAGG - Intergenic
1024276231 7:47679184-47679206 CTTAGCCAGCCCTGCTCCCATGG - Intergenic
1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG + Intergenic
1024816852 7:53281717-53281739 CTTAACCATCACTGCTTTCCAGG - Intergenic
1029198447 7:98822855-98822877 CTGAGCCAGCACTGCTCTCCAGG + Intergenic
1030094573 7:105886591-105886613 CCTGGCCAGCACTGCTGTGTAGG + Intronic
1031544449 7:123034516-123034538 CTCAGCCAGCACTGTGATCTAGG + Intergenic
1036558637 8:9883295-9883317 CTCAGCCAGCACTACCATCTGGG + Intergenic
1036779845 8:11638798-11638820 TTTAGCCAGCACAAGTATCTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040671414 8:49695571-49695593 CTTAGCTAACACTCCTATCTGGG - Intergenic
1042146322 8:65733875-65733897 CTTAGCCAGAACTAAGATCTAGG + Intronic
1043543961 8:81294630-81294652 CCCAGCCAACACTGCTGTCTGGG + Intergenic
1044540692 8:93405512-93405534 CTGAGCCAGCACTGCTTCCTTGG + Intergenic
1046122840 8:109866844-109866866 CTCAGGCAGCACTACTATCGTGG + Intergenic
1046828071 8:118713828-118713850 CTTAGGCAGCAATGCTATCCTGG + Intergenic
1047415191 8:124658867-124658889 ATTAGCCAGCACCTCGATCTTGG + Intronic
1048862382 8:138733400-138733422 AAGAGCCAGCACTGCCATCTTGG - Intronic
1049758723 8:144322264-144322286 ATGAGCCAGCACTGCTTCCTAGG - Intronic
1051371062 9:16359611-16359633 CTCCTCCAGCAGTGCTATCTTGG + Intergenic
1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG + Intronic
1060113315 9:120921897-120921919 CCCTGCCAGCACTGCTATCACGG + Intronic
1062213911 9:135378801-135378823 CTCCGCCAGCAGTACTATCTGGG - Intergenic
1187286741 X:17912544-17912566 CTTAGACAGCTGTCCTATCTAGG - Intergenic
1187722790 X:22169554-22169576 CAGAGCCAGGACTGATATCTGGG + Intronic
1189587009 X:42472128-42472150 CTCAGCCTACACTGCTACCTGGG - Intergenic
1189620098 X:42827045-42827067 CTTTGCCAGAACTGTGATCTTGG - Intergenic
1193368455 X:80663246-80663268 ATTAGCCAGCAAAGCCATCTAGG + Intergenic
1197069715 X:122281085-122281107 CCTAGCCACCCCTGCTGTCTTGG - Intergenic
1199448750 X:147956307-147956329 CTTAGTTAGTACTGGTATCTTGG + Intergenic
1200957801 Y:8969673-8969695 CTTACCCAGCAGTGCTATAATGG - Intergenic