ID: 976005337

View in Genome Browser
Species Human (GRCh38)
Location 4:80423491-80423513
Sequence ATTGTTTTCTGGGGCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976005329_976005337 16 Left 976005329 4:80423452-80423474 CCAAATTTTCTAAGTCCTCATTT 0: 1
1: 0
2: 7
3: 39
4: 541
Right 976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 192
976005327_976005337 25 Left 976005327 4:80423443-80423465 CCCTTTTCTCCAAATTTTCTAAG 0: 1
1: 0
2: 2
3: 114
4: 911
Right 976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 192
976005331_976005337 1 Left 976005331 4:80423467-80423489 CCTCATTTTGTTCCTGAGGCTGG 0: 1
1: 2
2: 3
3: 64
4: 687
Right 976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 192
976005328_976005337 24 Left 976005328 4:80423444-80423466 CCTTTTCTCCAAATTTTCTAAGT 0: 1
1: 0
2: 5
3: 53
4: 605
Right 976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976005337 Original CRISPR ATTGTTTTCTGGGGCAGCAC TGG Intronic
900968357 1:5975332-5975354 ATTCATTCCTGGGGCACCACTGG + Intronic
903221322 1:21871090-21871112 AATGTGTTCTTGAGCAGCACGGG - Intronic
907314333 1:53558989-53559011 TTTGGTTTCTGGGACAGCACAGG - Intronic
909894529 1:81050706-81050728 ATTTTTTTCGGGGGCATCACAGG - Intergenic
911048507 1:93649361-93649383 GGTGGTTTCTGGGGCAGCACTGG - Intronic
917217550 1:172693405-172693427 ACTGTTTCCTCAGGCAGCACAGG + Intergenic
917487262 1:175466577-175466599 ATTTTTTTCTGGGCCAGCCAGGG + Intronic
918613574 1:186518938-186518960 ATTCTGTTCTGAGGCAGAACAGG + Intergenic
924018780 1:239758004-239758026 ATTGTTTTCTTTGGCAGTGCTGG - Intronic
924650938 1:245926848-245926870 TTTTTTTTCTGGGGCCGCAAAGG - Intronic
1063372552 10:5531315-5531337 CTTGTTTTCTGGGACTGCAGCGG - Intergenic
1063802459 10:9595949-9595971 ATTGATTTCCAGGGCAGCTCGGG - Intergenic
1064207986 10:13341113-13341135 ATTGTATTTTTGGACAGCACTGG + Intronic
1064337862 10:14459816-14459838 TTTGTTCCCGGGGGCAGCACAGG - Intronic
1064795966 10:19011066-19011088 ATTGTTTTATGGCCCAGCACAGG + Intergenic
1065938833 10:30545723-30545745 ATTATTTTCTGGGATAGCACGGG - Intergenic
1066225577 10:33379884-33379906 ATTGTTTTCATTGGGAGCACTGG + Intergenic
1066282919 10:33935623-33935645 ATTGAGATCTGGTGCAGCACAGG + Intergenic
1067717228 10:48699016-48699038 TGTGCTTTCTGGGGCTGCACGGG - Intronic
1068166313 10:53336963-53336985 ATTGTTCTCTGTGTCAGCCCTGG + Intergenic
1071113033 10:82184426-82184448 AATGGTTTCTGGGGAAACACTGG + Intronic
1071421630 10:85505850-85505872 ATTAGTTTCTGAGGCAGCACTGG + Intergenic
1071726890 10:88207845-88207867 ATTGTTGTCTAGATCAGCACAGG - Intergenic
1071872525 10:89811037-89811059 CTTGTTGTCTGGGGCAGTCCTGG + Intergenic
1075251268 10:120876361-120876383 ATTGTTGTGTGGTGCAGCCCAGG + Intronic
1075547871 10:123369010-123369032 AATGTCTGCTGGGACAGCACAGG - Intergenic
1076886626 10:133266075-133266097 ACTGTTGGCGGGGGCAGCACTGG - Intronic
1077493209 11:2871645-2871667 TTTGTTTTCTGGGGCTCCAAGGG + Intergenic
1077509985 11:2954052-2954074 GTTGTTTTCTTCGGGAGCACGGG + Intronic
1079485890 11:20935649-20935671 ACTGTTTTATGGGGAAGGACTGG + Intronic
1080426959 11:32163885-32163907 ATTTGGTCCTGGGGCAGCACAGG - Intergenic
1080802462 11:35620195-35620217 ATTCTTTACTGTGCCAGCACGGG + Exonic
1081755910 11:45544300-45544322 ACTGTTTCCTAGGGCAGGACTGG - Intergenic
1088132308 11:106508160-106508182 AGTGTTTGCTGAGGCAGCAGGGG - Intergenic
1088171777 11:107006122-107006144 CTTGTTATCTTGGGCATCACTGG - Intronic
1088266012 11:107988326-107988348 AGTGTTTTCAGGGGGAGGACTGG + Intergenic
1088397991 11:109389812-109389834 ATGGTTTTCCTGAGCAGCACAGG + Intergenic
1088439258 11:109850480-109850502 ATTGTTTTCTGGTGAGGCAATGG - Intergenic
1089300433 11:117495505-117495527 ATTGCTTTCTGGCTCAGGACAGG + Intronic
1091479268 12:809851-809873 ATTGCTTTCCAGGGCAGCATGGG - Intronic
1092697659 12:11191267-11191289 CTGGTTTTGTGAGGCAGCACAGG + Intergenic
1093070262 12:14701058-14701080 ATTATTTTATGGGGCAGGATAGG + Intergenic
1093271497 12:17067772-17067794 TTTTTTTTCTGGTGCAGCAGAGG + Intergenic
1095895622 12:47277645-47277667 TTTGTTTTTTGGGGCATCTCTGG + Intergenic
1099128346 12:78794765-78794787 ATTCTCTTCTGGGGAAGCAGGGG + Intergenic
1099141179 12:78977469-78977491 GGTGTCTTCTGTGGCAGCACAGG + Intronic
1100179557 12:92070642-92070664 ACTGTTATCTTGGGCAGGACAGG - Intronic
1100576701 12:95898455-95898477 ATTGCTTTTCAGGGCAGCACAGG - Exonic
1102881008 12:116484961-116484983 TTTGTTTTCTTTGGAAGCACTGG + Intergenic
1103014719 12:117484927-117484949 ATTGCCTTCTGCGGCAGCATAGG - Intronic
1104646440 12:130501090-130501112 GTTAATTTCTGGGGCAGCAATGG - Intronic
1105038098 12:132941091-132941113 TGTGTTTCCTGGGTCAGCACTGG - Intronic
1107478471 13:40764067-40764089 AAGGTACTCTGGGGCAGCACAGG + Intronic
1107732631 13:43364125-43364147 ATTGTTTTCTCTAACAGCACAGG + Intronic
1109460019 13:62644286-62644308 ATTGTGTCCTGGGGCAGCAGGGG + Intergenic
1111145302 13:84170792-84170814 GTGTTTTTCTGGGGCAGCAGAGG + Intergenic
1111676368 13:91394413-91394435 ATTCATTACTGGGGCAGCTCGGG + Intergenic
1112977684 13:105341206-105341228 ATGGATTCCTGGGGCAGAACTGG - Intergenic
1113766488 13:112883791-112883813 ATTGTTTGCGGGGGCAGCGTGGG - Exonic
1116899578 14:50349018-50349040 ATTTTTTTCTGAGGCAGAAAAGG + Intronic
1121323555 14:93006834-93006856 ATTGTTTTCAGTGGCAGGCCTGG - Intronic
1122291737 14:100684344-100684366 TCTGTTTTCTGGGGAAGTACCGG + Intergenic
1124376114 15:29129861-29129883 ATTGTTTTCTGAGGTAGCATGGG - Intronic
1126055923 15:44729395-44729417 ACTGCTTTCTGGGGCTGCCCAGG + Exonic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1127114592 15:55712363-55712385 CTTGTTTTCTGTGCCAGCAAAGG + Intronic
1130706289 15:86236455-86236477 ATTGATTGCTGGTGCAGCCCAGG + Intronic
1131184571 15:90263854-90263876 ATTGATTCATGGGGCAGAACTGG - Exonic
1132955406 16:2589943-2589965 ATTGTGGACTGTGGCAGCACAGG - Intronic
1133058825 16:3161156-3161178 ATTTTTTTCTGGGGCAGTCAGGG + Intergenic
1138347369 16:56328355-56328377 AGAGTTTTCTGGGGCAGGAAGGG - Intronic
1140124118 16:72106136-72106158 CCTGCTTTCTGGGGCAGCGCTGG + Intronic
1140827822 16:78724030-78724052 CATGTTTTCTGGGCCAGGACTGG + Intronic
1142147315 16:88498028-88498050 AGTGCTATCGGGGGCAGCACAGG - Intronic
1144376612 17:14649062-14649084 GTTGTGTTCTGGGACAGCACAGG + Intergenic
1147329737 17:39690608-39690630 ATTGTTATCTGGGGCTGTGCTGG - Intronic
1148505843 17:48126457-48126479 ATTGTTGTCTCTGCCAGCACAGG - Intergenic
1150203489 17:63381116-63381138 TTTATTTTATGGGGCAGCAAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152941923 17:83177289-83177311 CTTGTTTTCTGGGAAAGCAATGG + Intergenic
1153047823 18:872530-872552 ATTGTTTTATAGGGCACCTCTGG + Intergenic
1154273535 18:12940289-12940311 ATTGGTTTCTGGGACAGAAGGGG - Intergenic
1156140024 18:34097492-34097514 AATGTTTTCTTGAACAGCACTGG - Intronic
1157674481 18:49559022-49559044 CTGGTTCTCTGGGGCAGCAGTGG - Intergenic
1159576353 18:70183072-70183094 GTTGATTTCTGGGGAAGGACAGG - Intronic
1163791428 19:19308609-19308631 ATTGTTCTCTGATGCAGCTCAGG + Intronic
1163885879 19:19964396-19964418 ATTTTTTTCTGAAACAGCACTGG - Intergenic
1164820379 19:31245790-31245812 AGTGTCTTCTTGGGCACCACAGG - Intergenic
1167037239 19:47001671-47001693 ACTGTGTTCTGGGGCAGCCCAGG - Exonic
1168559361 19:57370388-57370410 TTGGTGTTCTGGGGCAGGACTGG + Intronic
1168562526 19:57395982-57396004 TTGGTGTTCTGGGGCAGGACTGG + Intronic
930565613 2:53015895-53015917 ATTGTTTTATGCACCAGCACAGG - Intergenic
933237818 2:79884934-79884956 ATTGTCTACTGGGGGAGCACGGG + Intronic
933304143 2:80576696-80576718 ATTGTTTTTTGGGGGAGCCGAGG + Intronic
935564644 2:104592753-104592775 ATTGTTGCCTCAGGCAGCACAGG + Intergenic
935814024 2:106829599-106829621 ATGGTTTTATGGGTCAGGACAGG - Intronic
936113789 2:109686129-109686151 ATTGGTATCTTGGGGAGCACTGG + Intergenic
937386925 2:121443093-121443115 TTTGTGTACTGGGGCTGCACAGG - Intronic
938011430 2:127831831-127831853 ATTGTTTTCTCAGTCAACACTGG - Intergenic
940460473 2:153958111-153958133 CTTACTTTCTGGGGCAGCAAGGG + Intronic
941741546 2:169040702-169040724 TTGGTTTTCTGGGGAGGCACAGG - Intergenic
942885084 2:180913453-180913475 ATTGTTTTCTGTGGGAGGGCTGG - Intergenic
944783843 2:203047608-203047630 AATGCCTTCTGTGGCAGCACAGG + Intronic
945377072 2:209091368-209091390 ATTCATATCTGTGGCAGCACTGG - Intergenic
945912621 2:215666915-215666937 ATTGTTTTCTAGGGTAACAATGG + Intergenic
946523713 2:220495246-220495268 ATTGTATTCAGTGGCATCACTGG + Intergenic
946819481 2:223615303-223615325 AGTGTCTTCTAGAGCAGCACAGG - Intergenic
1168902437 20:1376397-1376419 GTTGTTTTGTGGGGCAGCATTGG - Intronic
1169834867 20:9866774-9866796 TCTGGTTTCTGGGGCATCACTGG - Intergenic
1172140693 20:32721123-32721145 AAGGCTTTCTGAGGCAGCACAGG + Intronic
1173709474 20:45141766-45141788 ACTGTTGTCTCAGGCAGCACAGG + Intergenic
1174530175 20:51205818-51205840 ATGGCTTTCAGGGGCAGCAAAGG - Intergenic
1175084378 20:56446177-56446199 AATGTTTTCTAGAGCAGGACTGG - Intronic
1176158437 20:63635666-63635688 CTTGGTGTCTGGGGCAGCAGTGG - Intergenic
1177029592 21:15966481-15966503 ACTGTTATCTGGGGAAGAACTGG + Intergenic
1181176912 22:21043173-21043195 AGTGTTCTCATGGGCAGCACTGG - Intergenic
1183813598 22:40279359-40279381 TAAGTTTCCTGGGGCAGCACTGG + Intronic
1184583375 22:45431417-45431439 AGGCTTTTCTGGGGCAGCCCAGG - Intronic
1184786807 22:46676008-46676030 CTTGTTTTCTGGGGCAGGGAAGG + Intronic
949405710 3:3712282-3712304 ATTGTCTTCTGGGGCTTGACTGG - Intronic
952406519 3:33009647-33009669 CTTGTTTTATGGCCCAGCACAGG - Intronic
958492185 3:94790870-94790892 ATTATTTCCTGGGTCAGCTCAGG - Intergenic
959758412 3:109927257-109927279 AGTGTTTTCTCGGGCTGCACTGG - Intergenic
962509446 3:136084177-136084199 ATGGTTTTCTGGGCCAGGCCTGG + Intronic
962573435 3:136734572-136734594 ATTGTTACGTGGGGCAGCAGGGG + Intronic
962808583 3:138944037-138944059 TTTGTTTTCTGTGTCATCACTGG - Intergenic
967858592 3:194135418-194135440 ATTGTTTCCTGGGGAAGCCCGGG + Intergenic
968944792 4:3658060-3658082 ATTGTTTTCTGGTGCAGGGTTGG - Intergenic
970280234 4:14446894-14446916 ATTGTCTGCTCGGGCAGCAAGGG - Intergenic
971685228 4:29757077-29757099 ACTGTTTCCTCAGGCAGCACAGG - Intergenic
972254407 4:37337628-37337650 CTTGTCTCCTTGGGCAGCACAGG + Intronic
975608506 4:76180202-76180224 AATGTTTACTGGGCCAGCCCAGG + Intronic
976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG + Intronic
976273784 4:83255884-83255906 ATTTTTTTCTTAGGCAGCATTGG - Intergenic
978879240 4:113680860-113680882 ACCTTTCTCTGGGGCAGCACTGG + Intronic
979868787 4:125790360-125790382 TTTATCTTCTGGGGCAGCAGTGG - Intergenic
983300098 4:165914234-165914256 ATTGTTTTCTGGGGTAGCGATGG - Intronic
985033653 4:185817547-185817569 ATTGTGTCCTGTGGCAGCAGTGG + Intronic
986774586 5:11002252-11002274 CATGTTTTCTGGAGCACCACTGG - Intronic
988296663 5:29372142-29372164 ATAGTTTCCTGGGCCAGGACCGG + Intergenic
989581469 5:43037328-43037350 ATTCTTTTCCGTGGCAGTACTGG - Intergenic
990714585 5:58622676-58622698 CTTATTTTATGGGTCAGCACTGG - Intronic
993458243 5:88149928-88149950 ATTGTTGTCTGAGGCAGCGTTGG + Intergenic
994836806 5:104865628-104865650 ACTGTTGTCTCAGGCAGCACAGG - Intergenic
994850222 5:105045588-105045610 ATTGCTTGCTTGGGAAGCACTGG - Intergenic
996316272 5:122164227-122164249 AATGCTTTCAGGGGCAGAACAGG + Intronic
998562928 5:143188245-143188267 ATTGTGTTCTAGGTCAGCTCTGG - Intronic
999277204 5:150339163-150339185 GTCGTTTTCTGGGGCAGCTTGGG - Intronic
999809026 5:155110476-155110498 ATTGTTTTCTGGGCCCCAACAGG + Intergenic
1000210862 5:159104984-159105006 ATTATTATCTGGGGCCGCCCGGG - Intergenic
1000972772 5:167733026-167733048 ATTTTTTTCTGGAGCAGAAAGGG + Intronic
1002065051 5:176647691-176647713 ATTGTCTTCTGGGTGAGCGCGGG + Exonic
1004420244 6:15463194-15463216 ATTTTTTTCAGGGGGAGCAGGGG - Intronic
1005598291 6:27400352-27400374 AGAGTTTTCTGGGTCAGCAATGG + Exonic
1009592116 6:65686246-65686268 ATTGTCTTCTGGGGAAGAGCCGG - Intronic
1009806146 6:68604290-68604312 ACTGTTGTCTCGGGCAGCACAGG - Intergenic
1009934277 6:70215477-70215499 ATTGTTTTATGCCCCAGCACAGG + Exonic
1011850009 6:91614866-91614888 TTTGTTTTCTGGCTCAGCAGAGG - Intergenic
1012247820 6:96945652-96945674 ATTGGTGACTTGGGCAGCACTGG + Intronic
1012383534 6:98649836-98649858 ATTGTTTTCTAAGGCAAAACAGG - Intergenic
1018640837 6:165902571-165902593 ATAGTTATCTGTGGCAGCACTGG + Intronic
1019890586 7:3942957-3942979 ATTGTTTTCTGGTGTGGCACAGG + Intronic
1023821720 7:43984356-43984378 ATTGTCACCTGGGGCAGGACAGG - Intergenic
1024260857 7:47573009-47573031 CTTGATTTCTGGGGCAGCCCTGG - Intronic
1026457630 7:70586569-70586591 ATTGTACTCTGGGATAGCACTGG + Intronic
1027501189 7:78953197-78953219 ATTGTTTTTTGAGACAGCTCAGG - Intronic
1028222335 7:88212478-88212500 ATTGTTCTATGGTGCAGCCCAGG - Intronic
1029749983 7:102537775-102537797 ATTGTCACCTGGGGCAGGACAGG - Intergenic
1029767933 7:102636881-102636903 ATTGTCACCTGGGGCAGGACAGG - Intronic
1031474768 7:122207866-122207888 ATTGTTGTCTCAGGCAGCACAGG + Intergenic
1031640391 7:124156368-124156390 CTTCTTTTCAGGGGCAGCCCTGG - Intergenic
1033027414 7:137788873-137788895 TTTGTTTTGTTGGGCAGCACAGG - Intronic
1033375771 7:140760440-140760462 GATGTTTTCTGGAGCAGCAGGGG + Intronic
1034292757 7:149945757-149945779 ATCGGGTTCTGGGGAAGCACTGG + Intergenic
1034435378 7:151060573-151060595 TTTGTGTTCTGGGACAGCAGGGG + Intronic
1034813310 7:154151115-154151137 ATCGGGTTCTGGGGAAGCACTGG - Intronic
1038291145 8:26251072-26251094 AATGTTTTCTGGGTGAGGACTGG - Intergenic
1040819359 8:51537938-51537960 ATCCTTTTCTGGGGCAGGATTGG - Intronic
1041415165 8:57599868-57599890 GGGCTTTTCTGGGGCAGCACCGG + Intergenic
1042172809 8:66008874-66008896 TTTCTTTTTTGGGGCAGCCCAGG + Intergenic
1043460525 8:80455743-80455765 ATTGCTGTCTAGAGCAGCACTGG + Intergenic
1044609364 8:94077182-94077204 ATTGATTTCTGGGACAGCTGGGG + Intergenic
1045362131 8:101442547-101442569 ATTCTCTTCTGGGGCAGGACAGG - Intergenic
1046388997 8:113543022-113543044 ACTGTCTTCAGGGGCGGCACTGG - Intergenic
1046446133 8:114322224-114322246 ATTGTTTTCTGAGGAAAGACTGG - Intergenic
1047247079 8:123155372-123155394 ATGGAATTCTGGGGCAGCAGAGG + Intergenic
1049014568 8:139910541-139910563 ATTTTTATCTGGGGTAACACAGG - Intronic
1052512156 9:29435520-29435542 ATTGTTTTCTGAGTAATCACTGG - Intergenic
1052918300 9:33940771-33940793 TTTGTTTTTTGGGGGAGTACAGG - Intronic
1052953493 9:34232899-34232921 TTTCTTTTCTGGAGCAGCTCTGG - Intronic
1053527033 9:38840634-38840656 TTTGTTTTCTGGGTCAGTTCTGG + Intergenic
1054199259 9:62065065-62065087 TTTGTTTTCTGGGTCAGTTCTGG + Intergenic
1054639097 9:67523292-67523314 TTTGTTTTCTGGGTCAGTTCTGG - Intergenic
1056065510 9:82929570-82929592 ATTATTTTCTGAGGCTCCACTGG - Intergenic
1056451139 9:86717896-86717918 ATTGTTTTCTGGAGCTGTTCTGG + Intergenic
1057221356 9:93259480-93259502 ATGGGTTGCGGGGGCAGCACAGG - Exonic
1057602842 9:96473462-96473484 ATTGTTATCTGGACCACCACTGG + Intronic
1058058052 9:100469043-100469065 AATGATTTATGGTGCAGCACTGG - Intronic
1058259570 9:102812202-102812224 ATTGTTGTCTCAGGCAGCACAGG + Intergenic
1059890366 9:118795330-118795352 AAGGTTTTCTGAGGCAGCAGGGG - Intergenic
1060196290 9:121625704-121625726 GTTGCTTCCTGGGGCACCACAGG + Intronic
1060284180 9:122234310-122234332 AGTGTTTGCTGGGGCAACAAAGG + Intergenic
1186626424 X:11298680-11298702 ATTGGTTGCTGGGGGATCACGGG - Exonic
1188405237 X:29799801-29799823 ATTGTTCCCTGGGGCATTACAGG + Intronic
1189297648 X:39930130-39930152 ATTGTTTTCTGGGCTGGCAAGGG - Intergenic
1189788680 X:44583154-44583176 ATTGTTTCCTGGGCCAGGTCCGG + Intergenic
1192301419 X:69907465-69907487 ATTGTTTTGTGTGACTGCACAGG + Intronic
1193297466 X:79850168-79850190 ACTGTTGTCTCAGGCAGCACAGG - Intergenic
1193320364 X:80114713-80114735 ATGGTTTTGTGGGCCAGCCCAGG + Intergenic
1193899868 X:87164023-87164045 ATTGTTTGCTAGGGCAGCTCAGG + Intergenic
1196692098 X:118570990-118571012 ATCGATTTCTGTGGCAGCCCAGG + Intronic
1196884466 X:120229644-120229666 ATTTTTTTCTTGGTCAGCAATGG - Intergenic
1197001972 X:121450521-121450543 ATTGTTGCCTCAGGCAGCACAGG - Intergenic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic
1198714687 X:139544625-139544647 CTTTTTTTCTGGGGGAACACAGG - Intronic
1199658380 X:150021663-150021685 ATTATTTTCTGTGGAAGCTCTGG + Intergenic