ID: 976012745

View in Genome Browser
Species Human (GRCh38)
Location 4:80510967-80510989
Sequence CCATCTAGTGAGAATGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976012742_976012745 -2 Left 976012742 4:80510946-80510968 CCAACCTCTGGCTTCTTTTAGCC 0: 1
1: 0
2: 1
3: 32
4: 295
Right 976012745 4:80510967-80510989 CCATCTAGTGAGAATGAATTTGG 0: 1
1: 1
2: 1
3: 15
4: 137
976012743_976012745 -6 Left 976012743 4:80510950-80510972 CCTCTGGCTTCTTTTAGCCATCT 0: 1
1: 0
2: 2
3: 20
4: 239
Right 976012745 4:80510967-80510989 CCATCTAGTGAGAATGAATTTGG 0: 1
1: 1
2: 1
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976012745 Original CRISPR CCATCTAGTGAGAATGAATT TGG Intronic
909566219 1:77056228-77056250 CCATCTAGAGAGAATGAATTTGG - Intronic
909812825 1:79953070-79953092 TCATCAAGTGAGAGTGAATATGG - Intergenic
910083010 1:83364330-83364352 TCATCCAGAGAGAATGAACTTGG + Intergenic
910481308 1:87661272-87661294 CCATAGAGTGAGACTGATTTTGG + Intergenic
913127092 1:115801916-115801938 TCATTTAGTGAGAAAGAATTTGG - Intergenic
913343422 1:117783039-117783061 CCAGCAATTCAGAATGAATTAGG + Intergenic
916408059 1:164517298-164517320 TCATCCAGTGAGAATGATATTGG - Intergenic
917851609 1:179069290-179069312 CCCTCTAGTGAGAATGCTTTAGG + Intronic
920269726 1:204753885-204753907 CCATTTAGTGGGAATCAATGTGG - Intergenic
920779762 1:208977544-208977566 GCATCTAGTGAGAATGGGCTAGG + Intergenic
923987957 1:239402624-239402646 CAAGCTAGGGAGAATAAATTTGG - Intronic
1063206865 10:3840646-3840668 CTATCTAGTGAGTATGAAAAGGG - Intergenic
1063349769 10:5343426-5343448 CCATTTAGGGATAATGAATTTGG + Intergenic
1063473413 10:6307452-6307474 CTATGTACTGAGAATGAATTAGG + Intergenic
1065839847 10:29693444-29693466 CCAGCCAATGAGAATGTATTTGG - Intronic
1067279908 10:44863419-44863441 CTATCCAGTGAGTATGAGTTAGG + Intergenic
1067331554 10:45326666-45326688 CCATCTAGAAAGACTGAATGTGG + Intergenic
1068550572 10:58403623-58403645 CTATCTAGTGTGACTGTATTAGG - Intergenic
1071906276 10:90177700-90177722 CCATCTATTGAGAATAATCTTGG + Intergenic
1076620469 10:131784169-131784191 TCATCTTGGGAGAAAGAATTTGG - Intergenic
1078381601 11:10847132-10847154 CCATAACCTGAGAATGAATTAGG + Intronic
1079573926 11:21979581-21979603 CCATGAAGGGAGAATGACTTTGG - Intergenic
1091496421 12:977045-977067 TCTTCTTGGGAGAATGAATTTGG + Intronic
1093877437 12:24366357-24366379 TGATCTAATCAGAATGAATTAGG + Intergenic
1098968233 12:76818528-76818550 ACATCCAGTGAGAGTGATTTGGG + Intronic
1100687836 12:97005901-97005923 CGATATAATGAGAATGGATTAGG - Intergenic
1100936237 12:99670307-99670329 CCATCTATTTATTATGAATTAGG - Intronic
1107984720 13:45765760-45765782 TCATCTAGTGAGAATATAGTGGG + Intergenic
1109491322 13:63103727-63103749 CAATCCAGTGAGAATGCATTCGG + Intergenic
1111043753 13:82787134-82787156 CCATCTACAGAGAATTTATTAGG - Intergenic
1111287823 13:86118822-86118844 CCCTCTGGTGAGAAAGTATTTGG - Intergenic
1115438793 14:33408152-33408174 CCATCTAGTACTGATGAATTGGG - Intronic
1118390742 14:65293346-65293368 CCTTCTGGTCTGAATGAATTAGG - Intergenic
1118952587 14:70447929-70447951 CCATCCAGTGAGTTTGGATTTGG + Intergenic
1119040110 14:71266816-71266838 ACATCTAATGTGAGTGAATTTGG + Intergenic
1120233571 14:81865768-81865790 CCATCTAATGAGAAACATTTGGG - Intergenic
1120598201 14:86466743-86466765 CCATCAATTGAGAATAATTTGGG + Intergenic
1120640282 14:87002517-87002539 CTATCTGGTAAGAATAAATTTGG + Intergenic
1122273342 14:100578136-100578158 TCATTTAGTGAGAATCGATTTGG - Intronic
1127511309 15:59644409-59644431 CTATCAAGTGAGAATGACTAAGG + Intronic
1128814259 15:70595549-70595571 CCATATAAGCAGAATGAATTTGG + Intergenic
1133686574 16:8170768-8170790 CCATGTGGTGAGAAGAAATTGGG + Intergenic
1135780894 16:25299636-25299658 AGATCTAGTGAGAATTCATTCGG - Intergenic
1137604403 16:49777842-49777864 CCATCTAGTGAGCATCCACTTGG - Intronic
1137855136 16:51787028-51787050 CCATGTAGTGAGAGGGATTTAGG - Intergenic
1137910085 16:52369090-52369112 CTATCAAGTGAGATTGCATTTGG + Intergenic
1138877083 16:60965337-60965359 TCATCTTGTTAGTATGAATTTGG - Intergenic
1139248335 16:65470259-65470281 CCATTTATTGAAACTGAATTTGG - Intergenic
1139792250 16:69448052-69448074 GCATATAGTGAGAATTCATTTGG + Intronic
1146524403 17:33553720-33553742 GAATGTTGTGAGAATGAATTGGG - Intronic
1148076686 17:44941032-44941054 CCATCTTGTGAGATTGCAATGGG - Intronic
1148704140 17:49613422-49613444 CCATCAAGTGTTAATGACTTTGG - Intronic
1149698268 17:58634110-58634132 ACATCTAGTAAGAAGAAATTGGG + Intronic
1149924034 17:60685055-60685077 CAATTTAGTGAGAATGTAATGGG + Intronic
1152147880 17:78580131-78580153 CATTCTAGTGGGAATGAATTGGG - Intergenic
1155852879 18:30794394-30794416 CCATTTAGTTGGATTGAATTAGG - Intergenic
1156973716 18:43190527-43190549 CCATCTTGTCACAGTGAATTAGG - Intergenic
1157155959 18:45266288-45266310 GCATCTAATGACACTGAATTTGG + Intronic
926277799 2:11418074-11418096 CCTGCTAGTGAAAATGAATCTGG + Intergenic
926907624 2:17820918-17820940 CCAAATACTGTGAATGAATTAGG + Intergenic
928275924 2:29899921-29899943 CCTTCTAGTTAGAATACATTTGG - Intronic
928382234 2:30828387-30828409 CCATCTAGGGAACAGGAATTTGG + Intergenic
930023294 2:47014358-47014380 CCACCTAGGGAGCAAGAATTAGG - Intronic
933592115 2:84244577-84244599 CCTTCTGATGAGAATGAATGAGG - Intergenic
937562263 2:123240582-123240604 TCATCTATTGAGAGTGGATTTGG + Intergenic
938002264 2:127752184-127752206 CCATTTAGTGATAAGGAAGTTGG - Intronic
939017828 2:136921806-136921828 CAATCTAGGGAGAGTGAATTTGG - Intronic
939253524 2:139714337-139714359 CCTTCTTGTGAAAATAAATTAGG + Intergenic
939889542 2:147720349-147720371 CCAACTGCTGAGAATGACTTTGG + Intergenic
940099138 2:150013629-150013651 GCATCTAGTGAAAAGTAATTTGG + Intergenic
940319801 2:152365025-152365047 CCATTTAGTGACAATGTATTGGG + Intronic
943114545 2:183650446-183650468 CCACCTGGTGAACATGAATTAGG - Intergenic
943264818 2:185715379-185715401 CAATCTACTGAGATTGAATCAGG - Intergenic
945316983 2:208379996-208380018 ACGGCTAGTGAGAATGAAATCGG - Intronic
946656245 2:221951185-221951207 CCATCTCATGAGAAGGAACTGGG + Intergenic
1169992932 20:11523648-11523670 CCATCTAGAAAGATGGAATTAGG - Intergenic
1170611870 20:17920929-17920951 CCATCCAGTTAGAATAAAATGGG + Intergenic
1173004850 20:39132357-39132379 CAAGCTAGTGAGAATTAAATGGG + Intergenic
1173238319 20:41269164-41269186 AGTTCTAGTGCGAATGAATTAGG - Intronic
1178115087 21:29408650-29408672 CCCTCTATTGAAATTGAATTTGG + Intronic
1178927345 21:36787003-36787025 CCATGTAGGGAGAATGAAGCTGG + Intronic
1182606688 22:31511172-31511194 TCATCGTGGGAGAATGAATTTGG + Intronic
1185407897 22:50665926-50665948 CCATCTGGCCAGAATGAATGAGG + Intergenic
949178766 3:1101135-1101157 CCATATAGACAGAATGAATTTGG + Intronic
951083240 3:18477351-18477373 CCATATAGATAGTATGAATTTGG - Intergenic
951568827 3:24040664-24040686 CCACATAGTTAGTATGAATTTGG + Intergenic
953808746 3:46094110-46094132 CCATCTAGTCAGACTGAGGTTGG + Intergenic
955412612 3:58665564-58665586 TCATCCAGTGAGCATTAATTGGG - Intronic
956953160 3:74305793-74305815 TCATTTTGTGAAAATGAATTGGG + Intronic
957544638 3:81621830-81621852 CCATCCAGTGAAAGTGAATGAGG - Intronic
961141791 3:124562339-124562361 TCATCTAGTGAGAATCTAATGGG + Intronic
961198119 3:125020827-125020849 CCATCCACAGAAAATGAATTTGG - Exonic
962343645 3:134604782-134604804 TCATCTAATGTGAATCAATTGGG - Intronic
962711299 3:138088613-138088635 GTATCTAGTGAGGATGAGTTGGG - Intronic
965215558 3:165860192-165860214 CCCTCAAGTGAGATTGAATGAGG + Intergenic
966510360 3:180755554-180755576 CCATATAGTAAAAATGAATGTGG - Intronic
968404388 4:327328-327350 CCAGCAAGGGGGAATGAATTGGG - Intergenic
970531671 4:16991498-16991520 CCATCTAGTGGTAATAAACTGGG + Intergenic
972345938 4:38192380-38192402 CCATTTAGAGAGAATGACATGGG + Intergenic
973096514 4:46208077-46208099 TCATCAATGGAGAATGAATTGGG + Intergenic
976012745 4:80510967-80510989 CCATCTAGTGAGAATGAATTTGG + Intronic
978642136 4:110883122-110883144 CCATTTAGAAAGAATAAATTAGG + Intergenic
980782568 4:137510860-137510882 CCATATAATGTGAATGATTTGGG - Intergenic
984566755 4:181340197-181340219 CTTTCTTGTGAAAATGAATTAGG + Intergenic
987925221 5:24332189-24332211 TCAAATAGTGAGAATTAATTAGG - Intergenic
989246850 5:39264661-39264683 CCAAAAAGTGAGAATGAGTTGGG - Intronic
990155852 5:52876625-52876647 TCATCTAGTAAGAATGTCTTAGG + Intronic
992027654 5:72686533-72686555 CCATCTAGTGTGTATGAATTGGG - Intergenic
995434843 5:112123802-112123824 TTATCTAGTGAAAATGACTTAGG - Intergenic
995492236 5:112705644-112705666 CCATCTAGAGAAATTGGATTTGG - Intergenic
998890782 5:146743480-146743502 TCACCTAATGAGAAGGAATTGGG + Intronic
998943302 5:147309317-147309339 CCATCCACTGAGAATGAAGGTGG + Intronic
1003379285 6:5608444-5608466 CTATTTAGTAAGAATGAACTTGG - Intronic
1003533859 6:6959085-6959107 CCACCTACTTAGAAGGAATTTGG + Intergenic
1004431866 6:15552300-15552322 TCATTTTGTGAGTATGAATTTGG - Intronic
1005403407 6:25459336-25459358 CCAGCTACTGAGAATGAAGTGGG - Intronic
1006254778 6:32822039-32822061 CCACCTAGTGAGAATCCATTTGG + Intronic
1008198520 6:48556473-48556495 GCATCTAGTCAAATTGAATTTGG + Intergenic
1009456303 6:63860631-63860653 AGATCTAGTGAGAATAAAATGGG - Intronic
1014097630 6:117478014-117478036 CCATCCAGGGAGCAGGAATTTGG - Intronic
1014366364 6:120547638-120547660 CCTACCAGTGAGAATGAAATGGG + Intergenic
1015182044 6:130370827-130370849 CCATCTAGTGATGATGAGATTGG + Intronic
1016618154 6:146076970-146076992 CCCTCTAGTCAGAATGACCTTGG + Intronic
1016651358 6:146464691-146464713 CCAGCTAATGAGAATAAAGTGGG + Intergenic
1017602634 6:156100361-156100383 CCAATGAATGAGAATGAATTAGG - Intergenic
1018442076 6:163822622-163822644 ATATCTTGTGATAATGAATTTGG - Intergenic
1019831366 7:3334332-3334354 CCATCTAATGAGAATGAAAGAGG - Intronic
1020154296 7:5709695-5709717 GCATCTAGTGAGTATCAACTTGG - Intronic
1020628126 7:10608076-10608098 TCATCTGCTGAGAAGGAATTAGG - Intergenic
1027299842 7:76820530-76820552 TCATCCAGAGAGAATGAACTTGG + Intergenic
1028425741 7:90686431-90686453 TGTTCTAATGAGAATGAATTTGG + Intronic
1030713851 7:112786861-112786883 TCATCTGGTGAGAATGCAGTAGG - Intronic
1031714268 7:125087997-125088019 CCATCTAGTGAGTAGAAACTAGG - Intergenic
1033645049 7:143294929-143294951 CATTCTAGTAAGAAAGAATTAGG + Intronic
1036941523 8:13057012-13057034 CCAGCTAGTGAGATTGAAGTGGG + Intergenic
1041195232 8:55395522-55395544 CCATCTAGAGAGACAGAATAAGG + Intronic
1044513645 8:93113067-93113089 CCCTCTACTCAGACTGAATTAGG - Intergenic
1048774274 8:137928403-137928425 CTATCTACTGATAATAAATTTGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1051246109 9:15113476-15113498 CCATCTATTGTGAAATAATTTGG - Intergenic
1051247780 9:15128929-15128951 CCATCTACTGAGAATGAGAATGG - Intergenic
1058758010 9:108101858-108101880 CCATCAAGTGTGGATGAAATGGG - Intergenic
1058846224 9:108962243-108962265 CCATCTCTTGAGAATGTACTGGG - Intronic
1060515430 9:124262813-124262835 CCATAGAGTGTGAAGGAATTTGG + Intronic
1188458281 X:30392487-30392509 CCATCTTCTGAAAATGAGTTAGG + Intergenic
1189643174 X:43096093-43096115 ACATCTAGTGACATTAAATTTGG - Intergenic
1191104893 X:56766685-56766707 CCTTCTCCTGAGAATGAATTCGG + Intergenic
1191109307 X:56792813-56792835 CCTTCTCCTGAGAATGAATGTGG + Intergenic
1191110813 X:56802212-56802234 CCTTCTCCTGAGAATGAATGCGG + Intergenic
1194187746 X:90794115-90794137 CCATCTAGGGAACAGGAATTTGG + Intergenic
1196618091 X:117790806-117790828 CCATCTTGTGTGGATGGATTAGG - Intergenic
1199294801 X:146144903-146144925 ACAGCTAGTGAGAATCACTTTGG - Intergenic
1199824386 X:151483988-151484010 CCATCTAATGATGATGGATTAGG - Intergenic
1200497011 Y:3898833-3898855 CCCTCTAATGAGAAGGAATTAGG - Intergenic
1200852959 Y:7904440-7904462 TCCTCTAGTGGGACTGAATTGGG + Intergenic