ID: 976013098

View in Genome Browser
Species Human (GRCh38)
Location 4:80516396-80516418
Sequence TTCTGTGGGCTATACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 15, 3: 85, 4: 576}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976013093_976013098 25 Left 976013093 4:80516348-80516370 CCTTAGGCTAGGTAATTTATAAA 0: 6
1: 153
2: 2194
3: 13353
4: 16311
Right 976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG 0: 1
1: 1
2: 15
3: 85
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976013098 Original CRISPR TTCTGTGGGCTATACAAGGA TGG Intronic
901335105 1:8442534-8442556 TTCTGCAGGCTGTACAAGCACGG - Intronic
901574658 1:10191255-10191277 TTCTGCAGGCTGTACAAGGGTGG + Intergenic
902111119 1:14079094-14079116 TTCTGCGGGCTGTACAAGCATGG + Intergenic
902655952 1:17868499-17868521 TCCTGCGGGCTGTACAAGCATGG - Intergenic
902689010 1:18098024-18098046 TTTTGGGGGCTGTACAAGCATGG - Intergenic
902789337 1:18755659-18755681 TTCTGCAAGCTATACAAGCATGG - Intergenic
903369615 1:22826783-22826805 TTCTCAGGGCCAGACAAGGAGGG - Intronic
904778559 1:32927059-32927081 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
906753534 1:48287716-48287738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
906757914 1:48338279-48338301 TTCTGTTGCCTGTACAAGGGTGG + Intronic
907023240 1:51089099-51089121 TTCTGCAGGCTATACAAGCATGG + Intergenic
907733444 1:57089401-57089423 TTCTTCGGGCTGTACAAGCAGGG + Intronic
908087148 1:60647768-60647790 TTCTGCAGGCTGTACAAGCATGG + Intergenic
908396271 1:63728441-63728463 TTCTGCAGGCTGTACAAGCATGG - Intergenic
908554572 1:65245003-65245025 TTCTGTGTTCAATTCAAGGAAGG + Intergenic
910141689 1:84033229-84033251 TTCTGTGTGCAATACCATGATGG - Intergenic
910312217 1:85836794-85836816 TTATCAGGGGTATACAAGGAAGG + Intronic
910509115 1:87983930-87983952 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910633241 1:89379092-89379114 TTCTGCAGGCTGTACAAGCATGG + Intronic
910671860 1:89781816-89781838 TTCTGTGAGCTGTTCTAGGAGGG - Intronic
910738125 1:90484758-90484780 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910777083 1:90887545-90887567 TTCTGTGGGCTGTACAAGCATGG - Intergenic
911590859 1:99746016-99746038 TTCTGCAGGCTGTACAAGCATGG - Intronic
911617788 1:100033909-100033931 TTCTGTAGAGTATTCAAGGAGGG + Intergenic
911625548 1:100119827-100119849 TTCTGTAGGCTGTACAAGCATGG - Intronic
911661396 1:100505826-100505848 TTCTGTGGGCTGTACGAGCATGG + Intronic
912591896 1:110830682-110830704 TTCTGCAGGCTGTACAAGCATGG + Intergenic
912761032 1:112367745-112367767 TTCTGTAGGCTGTACAAACATGG - Intergenic
912878560 1:113387082-113387104 TTCTGCAGGCTGTACAAGCATGG - Intergenic
913202527 1:116506810-116506832 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
913330632 1:117664156-117664178 TTCTGCAGGCTGTACAAGAATGG - Intergenic
915295008 1:154914077-154914099 TTCTACAGGCTATACAAGCATGG - Intergenic
915438800 1:155930668-155930690 TTTTGAGAGCTTTACAAGGATGG - Intronic
916287910 1:163131345-163131367 TTCTGCAGGCTACACAAGCATGG - Intronic
916288163 1:163133364-163133386 TTCTGCAGGCTGTACAAGCATGG - Intronic
916459450 1:165008262-165008284 TTCTGTGTGCTACAAAAGGTTGG - Intergenic
916604123 1:166324268-166324290 TTCTGCAGGCTGTACAAGCATGG - Intergenic
917537525 1:175885053-175885075 TTCTTTAGGGGATACAAGGAAGG - Intergenic
917759451 1:178140905-178140927 TTCTGTAGGCTATGCAAGCATGG + Intronic
918705048 1:187649729-187649751 TGCTCTGGTATATACAAGGAGGG - Intergenic
919149616 1:193678981-193679003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
919384185 1:196897983-196898005 TTCTGTGTGGAATACATGGATGG + Intronic
920163639 1:204019286-204019308 TTCTGCAGGCTGTACAAGAATGG - Intergenic
920553164 1:206882103-206882125 TTCTGCAGGCTGTACAAGTATGG - Intergenic
920900503 1:210105962-210105984 TTCTGCAGGCTGTACAAGCATGG - Intronic
920972519 1:210754724-210754746 TTCTGCAGGCCATACAAGCATGG - Intronic
921472005 1:215560884-215560906 TTCTGCAGGCTGTACAAGTATGG - Intergenic
921730969 1:218577467-218577489 TTCTGCAGGCTGTACAAGCATGG - Intergenic
921897411 1:220414736-220414758 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922277535 1:224092938-224092960 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922335208 1:224613808-224613830 TTCTGCAGGCTGTACAAGCACGG - Intronic
922741506 1:228016711-228016733 TTCTGCAGGCTGTACAAGCATGG + Intronic
922805698 1:228387700-228387722 TTCTGTGGGAAAGACAAGGCAGG - Intergenic
922862962 1:228835111-228835133 TTCTGCAGGCTGTACAAGCATGG + Intergenic
922999583 1:229995786-229995808 TTCTGCAGGCTGTACAAGCATGG - Intergenic
923894746 1:238257487-238257509 TACTGTGGGCCATACAAGGCTGG + Intergenic
923994986 1:239484167-239484189 TTCTGCAGGCTGTACAAGCATGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924504858 1:244672437-244672459 TTCTGCAGGCTGTACAAGCATGG - Intronic
924767257 1:247045563-247045585 TTCTGCAGGCTGTACAAGCATGG - Intronic
1062770414 10:95989-96011 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063094544 10:2898314-2898336 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063550112 10:7024237-7024259 TTGTGTAGGCTGTACAAGCATGG - Intergenic
1064359884 10:14655022-14655044 TTCTGCAGGCTGTACAAGCATGG + Intronic
1065904029 10:30232633-30232655 TTCTGCAGGCTATATAAGCATGG - Intergenic
1066498867 10:35970835-35970857 TTCTGCAGGCCTTACAAGGATGG - Intergenic
1068148333 10:53099547-53099569 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1069130768 10:64699352-64699374 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1070245625 10:74728893-74728915 TTCTGTAGGCTGTACAAACATGG - Intergenic
1070382383 10:75892614-75892636 TTCTTTTGGCTATGGAAGGATGG + Intronic
1070413249 10:76164675-76164697 TATTGTGGGATCTACAAGGAAGG - Intronic
1070522095 10:77262802-77262824 TTCTGCAGGCTGTACAAGCATGG - Intronic
1071242823 10:83727279-83727301 TTCTGTGGGCTGTACAAGCATGG - Intergenic
1071757125 10:88555592-88555614 TTCTGCGGGCTATACAAGCATGG - Intronic
1071845310 10:89515678-89515700 TTCTTTGGGCAACACAAGCAGGG - Intronic
1072233066 10:93429315-93429337 TTCTGCAGGCTGTACAAGCATGG - Intronic
1072491497 10:95910338-95910360 TTCTGCAGGCTATATAAGCATGG + Intronic
1072616652 10:97054056-97054078 TTCTGTGGGCTGGACGAGTATGG + Intronic
1074100233 10:110348904-110348926 TTCTGCAGGCTACACAAGTATGG + Intergenic
1074440285 10:113471910-113471932 TTCTGCAGGCTCTACAAGCATGG + Intergenic
1074575939 10:114669359-114669381 TTCTCTGTGGTATCCAAGGATGG - Intronic
1074927293 10:118086172-118086194 TTCTGCAGGCTATACAAGCATGG + Intergenic
1076287300 10:129312762-129312784 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1076465666 10:130679855-130679877 TTCTGCAGGCTATAGAAGCATGG - Intergenic
1077941695 11:6849647-6849669 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1078087975 11:8245842-8245864 TTCTGTAGGTTGTACAAGCATGG + Intronic
1078473762 11:11612876-11612898 TTCTGTGAGCTCTTAAAGGATGG + Intronic
1078512015 11:11991718-11991740 TTCTGCGGGCTGTACGAGCATGG - Intronic
1078512131 11:11992780-11992802 TTCTGCAGGCTATACGAGCATGG - Intronic
1078905622 11:15685661-15685683 TTCTACAGGCTATACAAGCATGG + Intergenic
1079349764 11:19682586-19682608 TTCTGAAGGCTATACAAGCATGG + Intronic
1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG + Intergenic
1080109931 11:28555225-28555247 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1080255964 11:30290898-30290920 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1080338409 11:31227219-31227241 TTCTGTAGACTGTACAAGCATGG + Intronic
1080547236 11:33332848-33332870 TTCTGCAGGCTGTACAAGCAGGG + Intronic
1080562164 11:33473927-33473949 TTCTGCGGGCTGTACAAGCATGG + Intergenic
1080831014 11:35893285-35893307 TTCTGCAGGCTATACAAGCATGG - Intergenic
1080878755 11:36300209-36300231 TTCTGCAGGCTGTACAAGCATGG + Intronic
1081243176 11:40731474-40731496 TTCTGTAGGCTGTACAAGCATGG - Intronic
1081404711 11:42683593-42683615 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1081529283 11:43947054-43947076 TTCTGCAGGCTATACAAGCATGG + Intergenic
1081739492 11:45428219-45428241 TTCTGTGGGCTTTAATAGGATGG - Intergenic
1081788223 11:45763540-45763562 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1082930016 11:58592841-58592863 TTCTGCAGGCTGTACAAGCATGG + Intronic
1084309034 11:68305366-68305388 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1085193829 11:74653870-74653892 TTCTGCAGGCTGTACAAGCATGG + Intronic
1085383971 11:76145578-76145600 TTCTGCAGGCTATATAAGCATGG - Intergenic
1085986537 11:81794172-81794194 TTCTGTAGGCTGTAAAAGCATGG - Intergenic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1086391519 11:86369990-86370012 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1086729150 11:90227023-90227045 TTCTGCAGGCTATACAGGAAGGG + Intergenic
1088678089 11:112215790-112215812 TTCTGTGGGATGTACCAGCATGG + Intronic
1088923372 11:114278114-114278136 TTCTGCAGGCTGTACAAGCATGG + Intronic
1089575752 11:119441869-119441891 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1089584838 11:119503676-119503698 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1089929912 11:122299591-122299613 TTCTGCAGGCTATACAAACACGG + Intergenic
1090257955 11:125299007-125299029 TTCTGCAGGCTGTACAAGCATGG + Intronic
1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG + Intergenic
1090860306 11:130647215-130647237 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1090864079 11:130680542-130680564 ATCTGTAGACTATACAAAGAAGG + Intronic
1091025296 11:132136108-132136130 TTCTGTGGGCTCTACAGGATAGG + Intronic
1091211701 11:133866112-133866134 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1091283066 11:134392973-134392995 TTCTGTGGGCAATCCAGGGTGGG + Intronic
1091345923 11:134853939-134853961 TTCTGTGGGCTATTCACAGGGGG - Intergenic
1091951067 12:4593443-4593465 TCCAGTGGGCTATGCAGGGAAGG - Intronic
1091960849 12:4692894-4692916 TTCTGTAGGCTGTACAAGCATGG + Exonic
1091989803 12:4946277-4946299 TTCTGCAGGCTATACAAGCATGG + Intergenic
1092080425 12:5711437-5711459 TTCTGCAGGCTGTACAAGCATGG - Intronic
1092203171 12:6599882-6599904 TTCTGTCGGGTCTGCAAGGATGG - Exonic
1092701255 12:11233592-11233614 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1093730420 12:22559909-22559931 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1094084458 12:26574681-26574703 TTCTGCGGGCCATACAAGCATGG + Intronic
1094144091 12:27210820-27210842 TTCTGTAGGCTGTACAAGCGTGG - Intergenic
1094428051 12:30336558-30336580 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1094473652 12:30825183-30825205 CTCTCAGGGCTATAGAAGGATGG - Intergenic
1095175589 12:39088675-39088697 TTCTGTAGGCCATGCAAGCATGG + Intergenic
1095675911 12:44917771-44917793 TCCTGTGGGCTAGAGAAGTAAGG + Intronic
1096096979 12:48941914-48941936 TACTGTGGCCCATCCAAGGAGGG + Intronic
1097870305 12:64596446-64596468 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1098055661 12:66502761-66502783 TTCTGCAGGCTGTACAAGCATGG - Intronic
1098131467 12:67354945-67354967 TTTTGTGGATTATAAAAGGAAGG + Intergenic
1098470031 12:70832780-70832802 TTCTGCAGGCTGTACAAGCATGG + Intronic
1099089571 12:78288328-78288350 TACTTTAGGATATACAAGGAAGG - Intergenic
1099544184 12:83955891-83955913 CTCTGCAGGCTATACAAGCATGG + Intergenic
1099703813 12:86124522-86124544 TTTTGTGAGCTTTACCAGGATGG - Intronic
1100002534 12:89854941-89854963 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1100692567 12:97054127-97054149 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1101039072 12:100736047-100736069 TTCTCTGGGCTTTCCAAGAAAGG - Intronic
1101353369 12:103954347-103954369 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101418886 12:104532675-104532697 TTCTGTGGGGTATGCAAAGTAGG - Intronic
1101419992 12:104543043-104543065 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101510816 12:105390831-105390853 TTCTGCAGGCTCTACTAGGATGG + Intronic
1101636061 12:106542410-106542432 TTCTGCAGGCTCTACAAGCATGG + Intronic
1101918329 12:108912984-108913006 TTCTGCAGGCTGTACAAGCATGG - Intronic
1102381067 12:112467349-112467371 TTCTGAAGGCTGTACAAGCATGG + Intronic
1103024294 12:117560930-117560952 TTCTGCAGGCTGTACAAGTATGG - Intronic
1103248097 12:119475501-119475523 TTCTATGAGTTATACAAGGCTGG + Intronic
1104118232 12:125771460-125771482 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1104218384 12:126757625-126757647 TTCTGTGAGTTCTACAAAGATGG + Intergenic
1104604551 12:130178452-130178474 TTCAGTGGTCTATCCGAGGATGG + Intergenic
1104644564 12:130487542-130487564 TTCTGCAGGCTGTACAAGCATGG - Intronic
1106947239 13:34842297-34842319 TTCTGTGGGCTGTACAGGAAGGG - Intergenic
1107021116 13:35752709-35752731 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1107348118 13:39484924-39484946 TTCTTCTGGCTATTCAAGGAAGG - Intronic
1107417800 13:40217466-40217488 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1107816243 13:44247010-44247032 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1109492082 13:63114783-63114805 TTCTCTTGGCTATAGAAAGATGG - Intergenic
1109673785 13:65645348-65645370 TGATGGTGGCTATACAAGGATGG - Intergenic
1109711174 13:66162565-66162587 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1109889393 13:68588766-68588788 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1110241870 13:73276763-73276785 TTCTGCAGGCTATACAAACATGG - Intergenic
1110797520 13:79657438-79657460 TTCTACAGGCTATACAAGCATGG - Intergenic
1111283906 13:86063750-86063772 TTCCGCAGGCTATACAAGCATGG + Intergenic
1111482442 13:88848702-88848724 TTCTGCGGGTTGTACAAGTATGG + Intergenic
1111807822 13:93059703-93059725 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
1112093752 13:96110119-96110141 TTCTGCTGGCTATATAAGCATGG + Intronic
1112182917 13:97103083-97103105 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112314840 13:98351664-98351686 TTCTGTAGGCTCTATAAGCATGG + Intronic
1112437777 13:99403958-99403980 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112450869 13:99508596-99508618 TTCTGCAGGCTGTACAAGCATGG + Intronic
1112860133 13:103820022-103820044 TTCTGAAGGCTGTACAAGAATGG + Intergenic
1113012424 13:105784935-105784957 TTCTGCAGGCTATACAAGAAGGG - Intergenic
1113825149 13:113246983-113247005 TTCTGCAGGCTATACAAGCATGG + Intronic
1114590647 14:23861622-23861644 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1114789111 14:25635928-25635950 TTCTGCAGGCTATACAAGCACGG - Intergenic
1115116177 14:29883012-29883034 TTCTGCAGGCTATACAAGCATGG + Intronic
1115775878 14:36714532-36714554 GTCTGTGGGCTGTAGAAGTAAGG + Intronic
1115874657 14:37846737-37846759 TTCTGCAGGCTTTACAAGCAGGG - Intronic
1115929165 14:38471513-38471535 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1116340810 14:43721636-43721658 TTCTGTATGCTGTACAAGCATGG + Intergenic
1116352863 14:43887576-43887598 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1116521124 14:45848367-45848389 TTCTGTAGGCTATACAAGCATGG + Intergenic
1117281229 14:54242990-54243012 TTCTGGAGGCTGTACAAGCATGG + Intergenic
1117631936 14:57702847-57702869 TTCTGTAGGCTATAAAATAAAGG + Intronic
1117778672 14:59208984-59209006 TTCTGCAGGCTGTACATGGATGG - Intronic
1117992483 14:61448478-61448500 TTCTGAGGGCATTACAAGGCTGG + Intronic
1119282589 14:73422558-73422580 TTCTGCAGGATATACAAGCATGG + Intronic
1120227616 14:81808826-81808848 TTCTGTAGGCTGTACAGGCATGG - Intergenic
1120397859 14:83991278-83991300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1120466426 14:84863558-84863580 TTCTGCAGGCTTTACAAGCATGG - Intergenic
1120515620 14:85466032-85466054 TTCTGGAGGCTATACAAGCATGG - Intergenic
1120802320 14:88704371-88704393 TTCTGCAGGCTGTACAAGCAGGG - Intronic
1121428998 14:93873734-93873756 GTCTGTGGGTTACAGAAGGAGGG - Intergenic
1121462874 14:94095525-94095547 TTCTGTAGGTTATACAAGCATGG + Intronic
1121513197 14:94529278-94529300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1121596630 14:95168322-95168344 ATCTGGAGGCTATACAAGCATGG - Intergenic
1121860530 14:97313548-97313570 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1122584270 14:102793873-102793895 TTCTGTGGGCTGATCAAGCAGGG + Intronic
1202857520 14_GL000225v1_random:60128-60150 TTCTCTGGGCTCCACAGGGAGGG - Intergenic
1124116452 15:26847713-26847735 ATCTGTGGGCTATAACAGGTGGG + Intronic
1124203658 15:27699196-27699218 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1124355185 15:28990051-28990073 TGCTGTGGGCTGCACAAGGACGG + Intronic
1125119822 15:36142118-36142140 TGCTGTGAGTTATTCAAGGATGG - Intergenic
1125406337 15:39355792-39355814 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1125519229 15:40339002-40339024 TTCTGTGGGGAATGCAGGGAGGG - Intronic
1126142703 15:45450885-45450907 TCCTGTGGGCTATACAGTGCTGG - Intergenic
1126383750 15:48073562-48073584 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1126432562 15:48601772-48601794 TTCTTTGTGCTGTAAAAGGAAGG - Intronic
1127008519 15:54596889-54596911 TTCTGCAGGCTATACAAGCATGG - Intronic
1127290982 15:57570832-57570854 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1127375938 15:58384289-58384311 TTCTGCAGGCTGTACAAGAATGG - Intronic
1127465560 15:59241189-59241211 TTCTGTGGGGTACACATGAAGGG + Intronic
1127507136 15:59608466-59608488 TTCTGCAGGTTGTACAAGGATGG + Intronic
1127692840 15:61414732-61414754 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1128629709 15:69252291-69252313 TTCTGCAGGCTATACAAACATGG + Intronic
1129996956 15:80015217-80015239 TTCTGCAGGCTATAAAAGCATGG + Intergenic
1130081731 15:80739699-80739721 TTCTGCAGGCTGTACAAGCATGG - Intronic
1130141978 15:81235273-81235295 TTCTGCAAGCTATACAAGCATGG + Intronic
1130711268 15:86283707-86283729 TTGTTTGGCCTATACAAGGATGG - Intronic
1131592906 15:93768725-93768747 TTCTGCAGGCTACACAAGCAAGG + Intergenic
1131771769 15:95745633-95745655 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1133644658 16:7753283-7753305 TTCTGCGAGCTGTACAAGCATGG + Intergenic
1133677024 16:8082861-8082883 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1133878065 16:9753247-9753269 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1134082530 16:11335006-11335028 TTCTGCAGGCTGTACAAGCATGG + Intronic
1135873157 16:26170722-26170744 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1137501012 16:49011797-49011819 TTCTGCAGGCTATATAAGCATGG + Intergenic
1137518353 16:49170394-49170416 TTCTGTGGGCTAAACAAAGAAGG - Intergenic
1137700880 16:50496879-50496901 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1138133531 16:54501994-54502016 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1139160070 16:64494170-64494192 TTCTGCAGGCTATACAAGCATGG - Intergenic
1140288271 16:73625594-73625616 TTCTGTGGTTTAGATAAGGATGG + Intergenic
1140297863 16:73726581-73726603 TTCTGAAGGCTATATAAGCACGG + Intergenic
1140875991 16:79152977-79152999 TGCTGGGGGAAATACAAGGAAGG + Intronic
1141125235 16:81396485-81396507 TTCTGCAGGCCATACAAGCATGG + Intergenic
1141758749 16:86012958-86012980 TTCTGTGGGGTGTACAAGCATGG + Intergenic
1142336641 16:89493589-89493611 TTTTGTGGGCTGTAAAAGAAGGG + Intronic
1144393966 17:14825266-14825288 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1145770251 17:27487621-27487643 TTCTGCAGGCTGTACAAGCATGG + Intronic
1147753114 17:42749463-42749485 CTCTGTGGGCATTACAAGGGAGG - Intergenic
1148653991 17:49269664-49269686 ATCTGAGGGCTAAACAAAGAAGG - Intergenic
1149016844 17:51917521-51917543 TTCTGTAGGCTATATAAGCATGG + Intronic
1149281663 17:55111719-55111741 TTCTGTAGGCTATACAAACATGG - Intronic
1150968076 17:69994790-69994812 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1151136184 17:71947577-71947599 TTCTGCAGGCTATACAAGCATGG - Intergenic
1152370229 17:79883242-79883264 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1153232702 18:2955256-2955278 TTCTGCAGGCTGTACAAGCACGG + Intronic
1153345554 18:4021504-4021526 TTCTGGAGGCTGTACAAGCATGG - Intronic
1153657703 18:7299611-7299633 GTCTGTAGGCTGTACAAGTATGG - Intergenic
1153744023 18:8158681-8158703 TTCTGCAGGCTTTACAAGCATGG + Intronic
1154946502 18:21166805-21166827 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1155683187 18:28515012-28515034 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1156077638 18:33300253-33300275 TTCTGCAGGCTATAGAAGCATGG - Intronic
1156678269 18:39557615-39557637 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1157974687 18:52313755-52313777 TTCAGTGGGTTATAAAAGAAGGG + Intergenic
1158904904 18:62002322-62002344 TTTTGCAGGCTATACAAGCATGG + Intergenic
1159362207 18:67420019-67420041 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1159542962 18:69802790-69802812 TTCTGCAGGCTGTACAAGCATGG - Intronic
1160121610 18:76135307-76135329 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1161798562 19:6402231-6402253 TACTGTGGACTGAACAAGGAGGG + Intergenic
1163056651 19:14725032-14725054 TTCTGCAGGCTCTACAAGCATGG + Intronic
1163502656 19:17686146-17686168 TTCTGTGGACTTTACAGGGAGGG - Intronic
1164451741 19:28372020-28372042 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1164675977 19:30101818-30101840 TTCTGCAGGCCATACAAGCATGG + Intergenic
1164851323 19:31486659-31486681 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164858537 19:31544274-31544296 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164883585 19:31758662-31758684 TTCTGTGGGCCAGATAAGGAGGG + Intergenic
1164884466 19:31766098-31766120 TTCTGTAGGCTGTGCAAGTATGG - Intergenic
1164896457 19:31881544-31881566 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164921305 19:32090533-32090555 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1165191397 19:34066716-34066738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1167225137 19:48233456-48233478 TTCTGTGGGCAAGCCAAGCATGG + Intronic
1167653069 19:50743875-50743897 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1167977209 19:53238531-53238553 TTCTGTTGGATTTACAAGCAAGG - Exonic
1168448389 19:56444218-56444240 TTCAGTAGGCTGTACAAGCATGG + Intronic
1168665335 19:58200851-58200873 TTCTGCAGGCTGTACAAGGGTGG + Intronic
1168704284 19:58459813-58459835 TTCTGAGGGCTGTACGAGCATGG - Intergenic
925022496 2:582764-582786 TTCTGTGGGCTGCAAAATGAGGG - Intergenic
925060530 2:886558-886580 TTCACTGGGCTAGACATGGATGG - Intergenic
925357305 2:3250899-3250921 TTCTGCAGGCTATATAAGCATGG - Intronic
925498651 2:4480503-4480525 TTCTGCTGGCTATAAAAGCATGG + Intergenic
925559960 2:5180992-5181014 TTCTGCAGGCTATACAGGCACGG + Intergenic
925758341 2:7156888-7156910 TTCTGCAGGCTGTACAAGCATGG - Intergenic
925889735 2:8424013-8424035 TTCTGCAGGCTGTACAAGCATGG + Intergenic
925907825 2:8549864-8549886 TTCTGCTGGCTGTACAAGCATGG - Intergenic
926389868 2:12378576-12378598 TTCTTTTAGCTATAAAAGGAAGG - Intergenic
926823635 2:16880721-16880743 TTCCTGGGGCTATACAAGAAAGG + Intergenic
927062222 2:19434276-19434298 TTCTGCAGACTATACAAGCATGG - Intergenic
927332219 2:21878810-21878832 TTCTACAGGCTATACAAGCATGG + Intergenic
929695253 2:44109156-44109178 TTCTGCAGGCTGTACAAGCATGG - Intergenic
929894309 2:45945241-45945263 TTCTGCAGGCTGTACAAGCATGG + Intronic
930118428 2:47739962-47739984 TTCTGTAGGCTGTACAAGCATGG + Intronic
930276998 2:49323323-49323345 TTCTGCAGGCTGTACAAGCATGG + Intergenic
930384466 2:50676267-50676289 TTCTATAGGTTATACAAGCATGG - Intronic
930727028 2:54692438-54692460 TTCTGCAGGCTGTACAAGCATGG - Intergenic
930906519 2:56574842-56574864 TTCCATAGGCTATACAAGCATGG - Intergenic
931056769 2:58481406-58481428 TTCTGCAGGCTGTACAAGCATGG + Intergenic
931614811 2:64144688-64144710 TGCTGTTGGCTGAACAAGGACGG + Intergenic
932070107 2:68611670-68611692 TTCTGTGGGCTGTGCAAGCATGG + Intronic
932903935 2:75729752-75729774 TTCTGCAGGCTATACAAGCATGG - Intergenic
933330266 2:80884648-80884670 TTCTGCAGGCTGTACAAGTATGG + Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
934702077 2:96450587-96450609 TTCTGCAGGCTGTACAAGCATGG + Intergenic
934944288 2:98526736-98526758 TTCTGCAGGCTATACAAGCATGG + Intronic
935715936 2:105938945-105938967 TTCTGCAGGCTGTACAAGCATGG - Intergenic
935943518 2:108265946-108265968 TTCTGTGGCCAACACAAGGCTGG + Intergenic
936038810 2:109133165-109133187 TTCTGTGAGGGTTACAAGGAAGG + Intronic
936237257 2:110753275-110753297 TTCTGCAGGCTGTACAAGCATGG - Intronic
936256063 2:110913695-110913717 TTCTGCAGGCTATACAAGCATGG + Intronic
936259750 2:110948611-110948633 TTCTGTGGGCTGTAGAGGAAGGG + Intronic
936469898 2:112789798-112789820 TTCTGCAGGCTGTACAAGCATGG - Intergenic
936835991 2:116710153-116710175 TTCTGCAGGCTGTACAAGCATGG + Intergenic
938883313 2:135615202-135615224 TTCTGTTGACTCTACAAGGAAGG + Intronic
939023654 2:136986496-136986518 TTCTGCAGGCTGTACAAGCATGG - Intronic
939023935 2:136989535-136989557 TTCTGCAGGCTATACAAGCATGG - Intronic
939196059 2:138974107-138974129 TTCTGCAGGCTGTACAAGCATGG + Intergenic
939231204 2:139428235-139428257 TTCTATAGGCTGTACAAGCATGG - Intergenic
939678526 2:145102196-145102218 TTCTGCAGGCTGTACAAGCATGG + Intergenic
940109785 2:150138852-150138874 CTCTGTGGGCTATACAATACTGG + Intergenic
940194682 2:151080568-151080590 TTCTGCAGGCTGTACAAGCATGG + Intergenic
940361992 2:152805233-152805255 CTCTGTGGGCTAGCCAAGGCCGG - Intergenic
940416453 2:153428228-153428250 TTCTGCAGGCTATACTAGCATGG + Intergenic
940422288 2:153493946-153493968 TTCTATGGGCTATACAAGCACGG + Intergenic
941192633 2:162404696-162404718 TTCTGCAGGCTGTACAAGCATGG - Intronic
941370914 2:164662884-164662906 TTCTGCAGGCTGTACAAGCATGG - Intronic
941922885 2:170869815-170869837 TTCTGCAGGCTATACAAGCATGG - Intergenic
941984449 2:171496608-171496630 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942063137 2:172246743-172246765 TTCTGAGGGCTGTACAAACAAGG + Intergenic
942347330 2:175017086-175017108 TTCTGCAAGCTATACAAGCATGG - Intergenic
942364748 2:175212995-175213017 TTCTGCAGGCTGTACAAGCATGG - Intergenic
942503419 2:176616510-176616532 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942534209 2:176946174-176946196 TTCTGCAGGCTGTACAAGCATGG - Intergenic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
943580328 2:189676013-189676035 TTCTGCAGGCTGTACAAGCATGG - Exonic
944227163 2:197359671-197359693 TTCTGCAGGCTGTACAAGCATGG + Intergenic
945237793 2:207648379-207648401 TTCTGCAGGCTGTACAAGCAGGG - Intergenic
945679117 2:212891630-212891652 TTCTGCAGGCTGTACAAGCATGG - Intergenic
945893075 2:215450837-215450859 TTCTGCAGGCTGTACAAGCATGG - Intergenic
946515183 2:220403718-220403740 TTCTGCAGGCTATACAAGCCTGG - Intergenic
947091894 2:226521319-226521341 TTCTGCAGGCTATACAAGCCTGG + Intergenic
947197371 2:227582438-227582460 TTCTGTAGGCTATACAAGCATGG - Intergenic
947197518 2:227583667-227583689 TTCTGCAGGCTGTACAAGCATGG + Intergenic
947782831 2:232785038-232785060 TTCTGCAGACTATACAAGCATGG - Intronic
948030715 2:234815200-234815222 TTCTGCAGGCTGTACAAGGATGG - Intergenic
948046295 2:234947956-234947978 TTCTGTGGGCTGTACAAGCATGG + Intergenic
948056910 2:235015533-235015555 CTCTGTGGGGAATGCAAGGATGG + Intronic
1169412216 20:5381450-5381472 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
1169467242 20:5852122-5852144 TTCTGCAGGCTGTACAAGCATGG - Intronic
1169621266 20:7509031-7509053 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1170714189 20:18817787-18817809 TTGTTTGGTCTATACAAGGTGGG + Intronic
1170717680 20:18846106-18846128 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1170721277 20:18881384-18881406 TTCTGCAGGCCATACAAGCATGG - Intergenic
1171353370 20:24522735-24522757 TTCTGTAGGCTGTACAAGCATGG + Intronic
1173734831 20:45352527-45352549 TTCTGCAGGCTATACAAGCATGG - Intergenic
1173912255 20:46679060-46679082 TTCTGCAGGCTGTACAAGCATGG - Intronic
1174060507 20:47829656-47829678 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174071391 20:47901714-47901736 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1174152662 20:48496947-48496969 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174444070 20:50578824-50578846 TTCTGCAGGCTGTACAAGCATGG + Intronic
1175649146 20:60702136-60702158 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1175852805 20:62102869-62102891 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1177462043 21:21425084-21425106 TTCTGTCTGGTATACAACGAGGG + Intronic
1177882084 21:26706214-26706236 TTCTGTAGGCTGTATAAGCATGG + Intergenic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1178326266 21:31647720-31647742 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1179190436 21:39118169-39118191 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1179378615 21:40877708-40877730 TTCTGCAGGCTATACAAACAGGG + Intergenic
1179877174 21:44274937-44274959 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1180152367 21:45956734-45956756 TTTTGTAGGCTACACAAGCATGG + Intergenic
1180174787 21:46082299-46082321 TGCTGTGGGCGGTACAAGGACGG + Intergenic
1180818807 22:18810794-18810816 TTCTGTGGGCTGGACAGGTATGG - Intergenic
1181205031 22:21245249-21245271 TTCTGTGGGCTGGACAGGTATGG - Intergenic
1181688940 22:24547643-24547665 TTCTGAGGGCTGTAGAAGGCAGG + Intronic
1182803174 22:33048698-33048720 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182866629 22:33610038-33610060 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182882191 22:33743174-33743196 TTGTGTAGGCTATACAGGCATGG - Intronic
1182908327 22:33957743-33957765 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1183070063 22:35389989-35390011 TCCTCTGGGCTACACATGGAGGG + Intronic
1184319335 22:43727822-43727844 TTCTGCAGGCTGTACAAGCATGG + Intronic
1203221894 22_KI270731v1_random:50166-50188 TTCTGTGGGCTGGACAGGTATGG + Intergenic
1203268935 22_KI270734v1_random:36647-36669 TTCTGTGGGCTGGACAGGTATGG - Intergenic
949154032 3:807795-807817 TTCTGCAGGCTATACAAGTGGGG - Intergenic
949366616 3:3288551-3288573 TTCTGCAGGCTGTACAAGCATGG - Intergenic
949706058 3:6818188-6818210 TTCTGCAGGCTGTACAAGTATGG + Intronic
950280283 3:11701372-11701394 TGCTGTAGGCTGTACAAGCATGG - Intronic
952010632 3:28897040-28897062 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952110932 3:30123238-30123260 TTCTGCAGGCTGTACAAGCATGG - Intergenic
952427993 3:33194758-33194780 TTTTGAGGGCTATGAAAGGAAGG + Intronic
952670519 3:35961822-35961844 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952739314 3:36720309-36720331 TTCTGCAGGCTGTACAAGCATGG - Intronic
953428785 3:42819610-42819632 CTCTGTGGGCAATACAAAGAAGG - Exonic
954575431 3:51673372-51673394 GTCTGTGAGCTATTCAAGGCAGG - Intronic
955167161 3:56526068-56526090 TTCTGCAGGCTGTACAAGCATGG - Intergenic
956148306 3:66214328-66214350 TTCTGCAGGCTGTACAAGTATGG - Intronic
957011629 3:75012233-75012255 TTCTGCAGGCTGTACAAGAATGG - Intergenic
957576359 3:82013784-82013806 TTCTGCAGGCTGTACAAGCATGG - Intergenic
958042840 3:88246705-88246727 TTCTGCAGGCTGTACAAGCATGG - Intergenic
960250143 3:115442828-115442850 TTCTGCAGGCTGTACAAGTATGG + Intergenic
960521495 3:118660456-118660478 TTCTGCAGGCTGTACAAGCATGG - Intergenic
960545461 3:118909297-118909319 TTCTGTAGGCTATATAATAATGG + Intronic
961525316 3:127493140-127493162 TTCTGCAGGCTATACAAGCATGG + Intergenic
961656746 3:128446707-128446729 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961672247 3:128541768-128541790 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961765028 3:129203343-129203365 TTCTGTAGGCTGTACAAGCATGG - Intergenic
961922335 3:130440680-130440702 TTCTCTGGGCTCTACACGTAAGG + Exonic
963849338 3:150194603-150194625 TTCTGCAGGCTATACCAGCATGG + Intergenic
963927542 3:150966914-150966936 CTCTGTGATCTATACAACGAGGG - Intronic
964092235 3:152891427-152891449 TTCTGCAGGCTGTACAAGCATGG + Intergenic
964561057 3:157997032-157997054 TTCTGCAGGCTATACAAGCAGGG - Intergenic
964831826 3:160892203-160892225 TTCTGTAGGCTATACAGGCATGG + Intronic
964903246 3:161686483-161686505 TTCTGCAGGCTGTACAAGCATGG - Intergenic
965781814 3:172294331-172294353 TTCTGCAGGCTGTACAAGCATGG + Intronic
965865294 3:173198409-173198431 TTCTGCAGGATATACAAGCATGG + Intergenic
965865554 3:173200496-173200518 TTCTGCAGGATATACAAGTATGG + Intergenic
966457939 3:180139459-180139481 TTCTGCAGATTATACAAGGATGG + Intergenic
966675254 3:182579312-182579334 TTCTGCAGGCTGTACAAGCATGG + Intergenic
967504934 3:190243472-190243494 TTCTGCAGGCTGTACAAAGATGG + Intergenic
967806129 3:193715993-193716015 TTCTGTAGGCTGTACAAACATGG - Intergenic
967806602 3:193719679-193719701 CTCTGTGTACTATTCAAGGATGG - Intergenic
968780925 4:2580779-2580801 TTCTGTAGGCTATACAAGCATGG - Intronic
968981058 4:3849711-3849733 TTCTGTGGGCTGTACAAGCATGG + Intergenic
969174753 4:5390024-5390046 CTCTGTGGGCTCCAGAAGGAAGG + Intronic
969543518 4:7808927-7808949 TTCTGCAGGCTATACAAGTATGG - Intronic
969553006 4:7884227-7884249 TTCTGCAGGCTTTACAAGCATGG - Intronic
970015463 4:11507725-11507747 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970249635 4:14100686-14100708 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970625219 4:17869788-17869810 TTCAGTGGGATATCCAAGAAAGG - Intronic
971376229 4:26057889-26057911 TTCTGCAGGCTGTACAAGCATGG + Intergenic
971455914 4:26843763-26843785 TTCTGCAGGCTGTACAAGCAGGG + Intergenic
971976019 4:33687972-33687994 TTCTGCAGGCTATGCAAGCATGG - Intergenic
972161933 4:36237673-36237695 TTCTGCAGGCTGTACAAGCATGG - Intronic
972198781 4:36687098-36687120 TTCTGTATGCAATAGAAGGATGG - Intergenic
972828625 4:42788678-42788700 TTCTATGGGCTGTACAGGCATGG - Intergenic
973009996 4:45060979-45061001 TTCTGTAGGCTGTGCAAGCATGG - Intergenic
973614502 4:52665201-52665223 TTCTGCAGGCTACACAAGCATGG + Intergenic
973665439 4:53154244-53154266 TTCTGCAGGCTGTACAAGCATGG + Intronic
973979093 4:56291760-56291782 TTCTGCAGGCTATATAAGCATGG - Intronic
974297941 4:60027849-60027871 TTCTGCAGGCTGTACAAGCATGG + Intergenic
974325528 4:60409322-60409344 TTCTGCAGGCTGTACAAGCATGG - Intergenic
974441602 4:61925510-61925532 TTCTGCAGGCTCTACAAGCATGG + Intronic
974488589 4:62534901-62534923 TTCTGCAGGCTCTACAAGCATGG + Intergenic
974580555 4:63794977-63794999 TTCTGCAGGCTGTACAAGCATGG - Intergenic
976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG + Intronic
976589459 4:86834765-86834787 TTCTGCAGGCTGTACAAGCATGG + Intronic
977154962 4:93560314-93560336 TTCTGCAGGCTATACAAACATGG + Intronic
977325177 4:95565549-95565571 TTCTGCAGGCTGTACAAGCATGG - Intergenic
977612674 4:99052402-99052424 TTCTGCAGGCTATACAAGCATGG + Intronic
977902492 4:102438241-102438263 TTCTGCAGGCTGTACAAGCATGG - Intergenic
978131807 4:105207453-105207475 TTCTTTGGGATATACATTGAAGG + Intronic
978333617 4:107642929-107642951 TCCTGTTGGCTATACCAGGGAGG - Intronic
978668598 4:111217131-111217153 TTCAGTAGGCAATACAATGAAGG - Intergenic
979234552 4:118385192-118385214 TTCTGCGGGCTGTACAAGCATGG - Intergenic
980613884 4:135193882-135193904 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980614110 4:135195436-135195458 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980806561 4:137822736-137822758 TTCTGAGGGCCATATAAGGAAGG - Intergenic
980906660 4:138954836-138954858 TACTGTGTGCCCTACAAGGAGGG - Intergenic
981052509 4:140323346-140323368 TTCTGCAGGCTGTACAAGCATGG - Intronic
981262714 4:142741215-142741237 TTCTGCAGGCTATACAAGAATGG + Intronic
982038705 4:151373351-151373373 TTTTGTGGGCTGTACAAGTATGG + Intergenic
982178032 4:152725098-152725120 TTCTGCAGGCTGTACAAGCATGG + Intronic
982282560 4:153699973-153699995 TTCTGCAGGCTGTACAAGCATGG + Intergenic
982386114 4:154804126-154804148 TTCTGTAAGCTTTACAAGCATGG - Intronic
982553688 4:156834098-156834120 TTCTGTGTAATATACAAAGAAGG - Intronic
982775897 4:159441028-159441050 TTCTGCAGGCTGTACAAGCATGG - Intergenic
983165164 4:164467373-164467395 TTCTGCAGGCTGTACAAGCATGG + Intergenic
983256127 4:165402680-165402702 TTCTGCAGGCTGTACAAGCATGG - Intronic
983468220 4:168122578-168122600 TTCTGCAGGCTGTACAAGCATGG + Intronic
983914632 4:173279155-173279177 TTCTGCAGGCTGTACAAGCATGG + Intronic
984367699 4:178820345-178820367 TTCTGCAGGCTGTACAAGCATGG + Intergenic
984636500 4:182116129-182116151 TTCTGTGTGTTCTACAATGATGG - Intergenic
984744032 4:183196166-183196188 TTCTGCAGGATATACAAGCACGG - Intronic
985235707 4:187871584-187871606 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985365766 4:189231014-189231036 TTCTGTTTGCTGTACAAGCATGG + Intergenic
985636939 5:1040423-1040445 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985809424 5:2072107-2072129 TTCTGCAGGCTGTACAAGCATGG - Intergenic
986590848 5:9367997-9368019 TTCTGCAGGCTGTACAAGCATGG - Intronic
987144413 5:14978457-14978479 TTCTGCAGGCTGTACAAGCATGG + Intergenic
987220377 5:15784774-15784796 TTCTGCAGGCTGTACAAGCATGG - Intronic
988549333 5:32185975-32185997 TTCTGCAGGCTGTACAAGCATGG - Intergenic
988924656 5:35977653-35977675 TTCTGCAGGCTGTACAAGCATGG - Intronic
989111305 5:37908717-37908739 TTCTGCAGGCTGTACAAGCATGG - Intergenic
989393396 5:40925689-40925711 TTCTGTAGGCTGTACAAGCATGG + Intronic
989448085 5:41554464-41554486 TTCTGCAGGCCATACAAGCATGG - Intergenic
989802215 5:45556857-45556879 TTCTGTTGGCAATTCAGGGAGGG - Intronic
990451109 5:55932516-55932538 GTTTGTGGGTTATAAAAGGACGG - Intergenic
990619089 5:57540539-57540561 TTCTGCAGGCTGTACAAGCATGG - Intergenic
990989361 5:61670134-61670156 TTCTGCAGGCTATACAAGCATGG + Intronic
991008224 5:61853367-61853389 TTCTGCAGGCTGTACAAGCATGG + Intergenic
991437492 5:66611596-66611618 TTCTGTGGTGTTTAAAAGGAAGG + Intronic
991643643 5:68778960-68778982 TTCTGCAGGCTGTACAAGCATGG + Intergenic
992558042 5:77922340-77922362 TTCTGCAGGCTATACAAGCATGG - Intergenic
992647389 5:78824167-78824189 TTCTGCAGGCTGTACAAGCATGG - Intronic
992876395 5:81059922-81059944 TTCTGCAGGCTGTACAAGCATGG + Intronic
993113304 5:83686673-83686695 TGCTGGGGGCTATACAGTGAAGG - Intronic
993198401 5:84781150-84781172 TTCTGTAGGCTGTACAAGCATGG + Intergenic
993832728 5:92779540-92779562 TTCTGTGGGATTTGCAAGAAAGG + Intergenic
994500068 5:100564156-100564178 TTCTGCAGACTATACAAGCATGG - Intronic
995648929 5:114345716-114345738 TTCTGCAGGCTATACAAGCATGG + Intergenic
995761253 5:115564610-115564632 TTCTGCAGGCTGTACAAGCATGG - Intergenic
996090266 5:119344159-119344181 TTCTGCAGGCTATGCAAGCATGG + Intronic
996217679 5:120888937-120888959 TTCTGAAGGCTGTACAAGCATGG - Intergenic
997878100 5:137566911-137566933 TTCTGTGGTCTGTGCCAGGATGG + Intronic
998072105 5:139205959-139205981 TTCTGCAGGCTGTACAAGCATGG - Intronic
998217664 5:140249632-140249654 GTCTGCAGGCTATACAAGCATGG + Intronic
999107662 5:149087795-149087817 TTCTGCAGGCTGTACAAGCATGG - Intergenic
999648984 5:153747143-153747165 TTCTGTGGGCTATACAAGCATGG + Intronic
1000101098 5:158017284-158017306 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1000208914 5:159092368-159092390 TCCTGTGTGCTTTACAATGAAGG + Intronic
1000402014 5:160839069-160839091 TTCTGCAGGCTGTACAAGCATGG - Intronic
1000830060 5:166092131-166092153 TTCTGCAGGCTATGCAAGCATGG + Intergenic
1001061843 5:168497565-168497587 TTCTGCAGGCTGTACAAGCATGG + Intronic
1003439409 6:6125196-6125218 TTCTGCAGGCTATATAAGCATGG - Intergenic
1004455229 6:15785738-15785760 TTCTGCAGGCTATACAAGCATGG - Intergenic
1004700098 6:18070470-18070492 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004804206 6:19184215-19184237 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004882531 6:20023036-20023058 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1005423195 6:25673852-25673874 TTCTGCAGGCTGTACAAGCATGG + Intronic
1005573408 6:27169015-27169037 TTCCGCAGGCTATACAAGCATGG - Intergenic
1005645271 6:27831808-27831830 TACTGTGGGAAATACAAGAAAGG + Intergenic
1005945489 6:30592270-30592292 TACTGTGGGGTATATAAGAAGGG + Intronic
1007225301 6:40309528-40309550 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1008113286 6:47517242-47517264 TTCTGCAAGCTATACAAGCATGG - Intronic
1008189760 6:48439845-48439867 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1008306680 6:49911299-49911321 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1008652712 6:53579405-53579427 TTCTGCAGGCTGTACAAGCATGG + Intronic
1008830013 6:55747524-55747546 TTCTTTAGGCTATACAAACATGG - Intergenic
1009873346 6:69474986-69475008 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1010266578 6:73874787-73874809 TTCTGTAGGCTGTACAAGCTTGG + Intergenic
1010301532 6:74266017-74266039 TTCTGTATACTATACAAAGAAGG - Intergenic
1011346265 6:86372348-86372370 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011371229 6:86638843-86638865 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011781915 6:90799280-90799302 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1011848107 6:91591161-91591183 TTCTCTGAGCTAAACAAGGGAGG + Intergenic
1011898538 6:92262391-92262413 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011947733 6:92927833-92927855 TTCTGCAGGCTATACAAGTGTGG - Intergenic
1011996789 6:93599589-93599611 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012124943 6:95417233-95417255 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012149290 6:95725914-95725936 TTCTGTGGGAAAAAGAAGGATGG - Intergenic
1012402770 6:98857916-98857938 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1012528359 6:100204517-100204539 TTCTGCAGGCCATACAAGAATGG + Intergenic
1013486766 6:110604157-110604179 TTCTGCAGGCCATACAAGCATGG - Intergenic
1013729655 6:113149478-113149500 TTCTGTAGGCTGTATAAGCATGG - Intergenic
1013748570 6:113374519-113374541 TTCTGTTGGCTCCTCAAGGAAGG - Intergenic
1014051688 6:116962510-116962532 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1014172855 6:118298127-118298149 TTCTGTAGGCTGTATAAGCATGG - Intronic
1014587110 6:123212434-123212456 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1014835339 6:126155113-126155135 TTCTGCAGCCTATACAAGCATGG + Intergenic
1014835557 6:126156614-126156636 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1015489858 6:133812714-133812736 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1015804176 6:137091907-137091929 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016007497 6:139104674-139104696 TTCCATGGGCCAAACAAGGAAGG + Intergenic
1016141758 6:140620981-140621003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016549408 6:145260189-145260211 TTCTGTGGCCTTTAAAAGAAAGG - Intergenic
1016564271 6:145435086-145435108 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1017190970 6:151652276-151652298 TTCTGCAGCCTATACAAGCAGGG + Intergenic
1017392527 6:153957317-153957339 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1017458283 6:154623455-154623477 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1018161226 6:161044721-161044743 TTCTGTATGCTATACAAGCGTGG + Intronic
1020414289 7:7928474-7928496 TTCTGCAGGCTATACAGGCATGG + Intronic
1020502866 7:8944952-8944974 TTCTGCAGGCTGTACAAGGATGG + Intergenic
1021660018 7:22910430-22910452 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1022293400 7:29025251-29025273 TTCTGTAGGCTATACAAGTATGG + Intronic
1022763084 7:33378722-33378744 TGCTGTGGGCTAACCAAGAAAGG - Intronic
1022946441 7:35289788-35289810 TTCTGTAGCCTATTCAAGGTTGG + Intergenic
1023096422 7:36664775-36664797 TTCTGCAGGCTGTACAAGCATGG + Intronic
1023986142 7:45097615-45097637 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024034978 7:45500339-45500361 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024596915 7:50946298-50946320 TTCTGCAGGCTACACAAGCATGG + Intergenic
1024713533 7:52046036-52046058 TTCTGTGGGATATATAACTAAGG - Intergenic
1025759232 7:64374727-64374749 ATCTGTGGGCTATAACAGGCAGG - Intergenic
1026058622 7:67006817-67006839 TTCTGCAGGCTCTACAAGCATGG + Intronic
1027880468 7:83828993-83829015 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1027944936 7:84732724-84732746 TTCTGCAGGCTGTACAAGTATGG + Intergenic
1027949738 7:84799664-84799686 TTCTGTAGGCTATACAAGCATGG - Intergenic
1028216506 7:88139964-88139986 TTCTGCAGGCTGTACAAGCATGG + Intronic
1028516066 7:91679541-91679563 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1028933177 7:96437422-96437444 TTCTGCAGGCTATACAAGCATGG + Intergenic
1029065419 7:97843481-97843503 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1029981167 7:104880371-104880393 TTCTGCAGGCTGTACAAGCATGG - Intronic
1030022130 7:105285809-105285831 TTCTGCAGGCTTTACAAGCATGG - Intronic
1030472384 7:109981235-109981257 ATCTGTGGGCTCCACAATGATGG - Intergenic
1030917262 7:115330858-115330880 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1031382247 7:121101652-121101674 TTCTGCAGGCTGTACAAGTATGG + Intronic
1031394959 7:121262237-121262259 TTCTGCAGGCTATACAAGCATGG - Intronic
1032810298 7:135407197-135407219 TTCTGCAGGCTGTACAAGCATGG - Intronic
1035006247 7:155663330-155663352 TTCTGTAGGCTGTACAAGTGTGG + Intronic
1036426295 8:8647940-8647962 TTCTGTAGGCTGTACGAGTATGG + Intergenic
1036617449 8:10399587-10399609 TTCTGCTGGCTATATAAGCATGG - Intronic
1036927981 8:12925897-12925919 TTCTGTCGGCTGTAAAAGCACGG - Intergenic
1037389388 8:18377629-18377651 TTCTGCAGGCTACACAAGCATGG + Intergenic
1037647677 8:20808239-20808261 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1037650445 8:20833289-20833311 TTCTGCAGGCTATACAAGCATGG + Intergenic
1037970661 8:23169445-23169467 TCCTGTAGGCTGTACAAGCACGG - Intergenic
1038739990 8:30208634-30208656 TTCTGCAGGCTGTACAAGTACGG - Intergenic
1038747270 8:30265486-30265508 TTCTGCGGGCTGTATAAGCATGG - Intergenic
1039167518 8:34701299-34701321 TTCTGCAGGCTGTACAAGGATGG - Intergenic
1039948410 8:42149616-42149638 TTCTGTAGGCTATGCAAGCGTGG - Intergenic
1040013359 8:42680549-42680571 TTCTGCGGGTTGTACAAGCATGG - Intergenic
1040628874 8:49185128-49185150 CTTTGTGGGCTGTACAAGCAGGG - Intergenic
1040984789 8:53281554-53281576 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1041265616 8:56061288-56061310 TTCTGCAGGCTATACCAGCATGG - Intergenic
1041598815 8:59690650-59690672 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1041872589 8:62651944-62651966 TTCTGCAGGCTGTACAAGCATGG - Intronic
1042033718 8:64506973-64506995 TTCTGCAGACTATACAAGCATGG - Intergenic
1043617075 8:82138975-82138997 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1043639637 8:82435614-82435636 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1044130013 8:88510001-88510023 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1044193834 8:89351796-89351818 TTCTGTAGGCTGTTCAAGCATGG + Intergenic
1045158253 8:99504289-99504311 TTCTGCAGGCTGTACAAGCATGG - Intronic
1045536274 8:103031377-103031399 TTCTGTAGGCTGTGCAAGCATGG + Intronic
1046110776 8:109721453-109721475 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1046588999 8:116182831-116182853 TTCTGCAGACTATACAAGCATGG - Intergenic
1047997590 8:130351519-130351541 TTCTGCAGGCTGTACAAGCATGG + Intronic
1048425027 8:134315186-134315208 TTCTGAGAACTATACAAGCATGG + Intergenic
1048655679 8:136533402-136533424 TTCTGTGGTCAATTCAAGGACGG - Intergenic
1048744069 8:137593593-137593615 TTATGCAGGCTATACAAGCATGG - Intergenic
1050964702 9:11784188-11784210 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1051281576 9:15446702-15446724 TTCTGTGGGAAAGACAAGGTAGG + Intronic
1051442226 9:17097793-17097815 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1052228466 9:26118340-26118362 TTCTGAAGTGTATACAAGGATGG + Intergenic
1052544191 9:29852363-29852385 TTCTGTTGGCAGTAGAAGGAAGG + Intergenic
1053438676 9:38095524-38095546 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1053456688 9:38238466-38238488 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1054792456 9:69268816-69268838 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1055074829 9:72203321-72203343 TTCTGGGAGCTTTGCAAGGAAGG + Intronic
1055147804 9:72957881-72957903 TTCTGTAGGCTGTACAAGCATGG + Intronic
1055762158 9:79620780-79620802 TTCTGTAGGCTGCACAAGCATGG + Intronic
1055976197 9:81957356-81957378 TTCTGCAGGCTATACAGGAAAGG + Intergenic
1056003933 9:82247238-82247260 TTCTGCAGGCAATACAAGCATGG - Intergenic
1056021430 9:82441867-82441889 TTCTGTGCACTATACAAGCATGG - Intergenic
1056033520 9:82579541-82579563 TTCTGCAGGCTATACAAGCATGG - Intergenic
1056328220 9:85500034-85500056 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1056362612 9:85874056-85874078 TGCTGCAGGCTATACAAGCATGG + Intergenic
1059688941 9:116665153-116665175 TTCTGTAGGCTGTACAAGCATGG - Intronic
1061928483 9:133819662-133819684 TGCTCTGGGCTCCACAAGGAGGG - Intronic
1062145742 9:134988729-134988751 TTCTGCAGGCTATACAAGCGTGG + Intergenic
1186168140 X:6848846-6848868 TTCTGTAGGCTCTACAAGCATGG - Intergenic
1186718163 X:12275358-12275380 TTCTGTAGGCTGTACAAACATGG - Intronic
1187215880 X:17275864-17275886 TTCAGTGGGATATAGGAGGAAGG - Intergenic
1187834807 X:23421182-23421204 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1188422137 X:30003186-30003208 TTCTGCGACCTATAAAAGGAAGG - Intergenic
1188422327 X:30005224-30005246 TTCTGCGACCTATAAAAGGAAGG - Intergenic
1188888508 X:35581265-35581287 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1188944734 X:36285424-36285446 TTCTCTTGGCCATGCAAGGATGG + Intronic
1189285604 X:39850247-39850269 TTCTGGGGCCTATACAAGGAAGG - Intergenic
1189707432 X:43772958-43772980 TTCTGCAGGCTATACAAGCATGG - Intronic
1189860005 X:45262336-45262358 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1190517727 X:51242434-51242456 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1190539620 X:51463743-51463765 TTCTGCAGGCTACACAAGCATGG + Intergenic
1192399483 X:70820514-70820536 TTCTGCAGGCTGTACAAGAATGG + Intronic
1192626207 X:72731163-72731185 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1193134613 X:77956659-77956681 TTCTGCAGGCTGTACAAGTATGG - Intronic
1193443052 X:81566278-81566300 TTCTGTAGGCTGTACAAACATGG - Intergenic
1193810209 X:86042371-86042393 TTCTGCAGGCTGTACAAGCATGG + Intronic
1194473311 X:94325511-94325533 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1194475063 X:94348355-94348377 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195289674 X:103420124-103420146 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195659446 X:107363651-107363673 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195815807 X:108885972-108885994 TTCTGCAGGCTCTACAAGGATGG - Intergenic
1195857905 X:109350432-109350454 TGCTATGGGGTATACAAGGGAGG - Intergenic
1196513973 X:116547877-116547899 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1196836843 X:119821265-119821287 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1197674379 X:129313852-129313874 TTCTGTACGCTGTACAAGCATGG + Intergenic
1197811118 X:130443965-130443987 TTCTCTGGGCTATAAAGAGATGG + Intergenic
1197813793 X:130476089-130476111 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1198599998 X:138272235-138272257 TTCTTCAGGCTATACAAGCATGG + Intergenic
1199071373 X:143479402-143479424 TTCTGCAGGCTGTACAAGGATGG + Intergenic