ID: 976020192

View in Genome Browser
Species Human (GRCh38)
Location 4:80614103-80614125
Sequence ATGTATACAGAAATGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 663}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976020192 Original CRISPR ATGTATACAGAAATGAAAAG GGG (reversed) Intronic
900675494 1:3882874-3882896 ATGTATACGTAGATGAAACGTGG + Intronic
902032834 1:13435437-13435459 ATGTATAGAGCAATGAGAAGGGG - Intergenic
902371312 1:16008823-16008845 AAGTAAAAAGAAAAGAAAAGTGG + Intergenic
902543196 1:17168737-17168759 ATGTCTACACAAATCAAGAGGGG + Intergenic
903083628 1:20834555-20834577 ATGAAAATAGAAATCAAAAGAGG + Intronic
903382328 1:22905922-22905944 ATGCACACAAAAAGGAAAAGCGG - Intronic
903749259 1:25610267-25610289 ATGTCTTCTGAAATGAAAAGCGG + Intergenic
904081957 1:27877828-27877850 ATGTATACAGCACTTAGAAGGGG + Intronic
904343864 1:29855614-29855636 ATCTATTCACAAGTGAAAAGTGG - Intergenic
904627800 1:31817091-31817113 ATATATATATATATGAAAAGCGG - Intergenic
904747856 1:32721965-32721987 ATGAATGCAGAAATGAGTAGTGG - Intergenic
905551805 1:38847530-38847552 AAATATAGAGAAATGAAAATAGG - Intronic
905845989 1:41232525-41232547 ATATATGGTGAAATGAAAAGAGG + Intronic
907688508 1:56638024-56638046 ATGAATACAGAGATGAAAGTGGG - Intronic
908288611 1:62638506-62638528 ATATATATAGATATGAAAATAGG - Intronic
908288612 1:62638673-62638695 ATATATATAGATATGAAAATAGG + Intronic
908900992 1:68956306-68956328 AATTATAAAGAAATGAAAAGAGG + Intergenic
909206075 1:72759360-72759382 ATGTAAACAAAAAAGAAATGTGG - Intergenic
909525967 1:76622945-76622967 ATCTTTCCAGAAATGAGAAGAGG + Intronic
909535965 1:76736573-76736595 GTGTATTCAGATATGAAGAGAGG - Intergenic
909846821 1:80404545-80404567 ATGTATACAGAAAACTATAGTGG - Intergenic
909890084 1:80994472-80994494 AGGCATACACAAAAGAAAAGAGG - Intergenic
910132340 1:83923307-83923329 AAGAAAATAGAAATGAAAAGAGG + Intronic
910294655 1:85632327-85632349 AAGAAGACAGAAATGGAAAGGGG + Intergenic
910944880 1:92579594-92579616 ATGTATACAGAGGGGAAAAATGG - Intronic
910984352 1:92991173-92991195 TTTTATAGAGTAATGAAAAGAGG + Intergenic
911264004 1:95721869-95721891 ATGATTAGAGCAATGAAAAGAGG - Intergenic
911303887 1:96209373-96209395 ATGTAGCCAGAAATGAAACCTGG + Intergenic
911926006 1:103833854-103833876 ATGTATAATGACATGAAAATTGG + Intergenic
911959044 1:104275256-104275278 ATGTAAATAAAAATGCAAAGAGG - Intergenic
912046681 1:105467786-105467808 ATTTATACAGAAATTAATACAGG - Intergenic
912620251 1:111149055-111149077 ATGAAAACAGAAAAGAATAGAGG - Intronic
912993005 1:114508253-114508275 AAGGATAAAGAAATGAAGAGGGG + Intronic
913052086 1:115126408-115126430 ATAAATACAGAAATTAAAAGAGG + Intergenic
913186719 1:116375069-116375091 ATGTTTACAGAAATGATCAAGGG - Intronic
913429457 1:118774849-118774871 ATGAATAGATAAATGAAATGTGG - Intergenic
914508103 1:148306826-148306848 ATTCATAAAGAAATGAGAAGAGG - Intergenic
915411702 1:155705999-155706021 ATAGATAAATAAATGAAAAGAGG - Intronic
915808738 1:158883370-158883392 ATGTAGTCAGGAATGAAAAATGG + Intergenic
916035011 1:160914014-160914036 AAGTATAGAGAAAGGAAAAAGGG - Intergenic
916300579 1:163269205-163269227 GTGTACACATATATGAAAAGGGG + Intronic
916313099 1:163418477-163418499 ATGAATACAGTAAGGAAAAATGG - Intergenic
916478629 1:165194440-165194462 GTGTATACAGAATTCCAAAGAGG - Intergenic
916542761 1:165772926-165772948 GTGTAAAAAGATATGAAAAGGGG - Intronic
916782718 1:168053293-168053315 ATGCATACAGAAATAAAAGTTGG + Intronic
916858707 1:168779469-168779491 ATGTACAGAGAAATGAAATTTGG - Intergenic
917068068 1:171119206-171119228 ATGTACAAAGAAATGATAAATGG + Intergenic
917289541 1:173458126-173458148 ATGTATATATAAAAGAAATGTGG + Intergenic
917458454 1:175205952-175205974 ATGTAAACAGAATTGAGAATTGG - Intergenic
917551125 1:176030706-176030728 ATGAATACAGCATGGAAAAGCGG + Intronic
918566103 1:185934401-185934423 ATGTATACATAATTCAAAATTGG - Intronic
918707170 1:187679078-187679100 ATGTACACAGAAAAGCAAAAAGG - Intergenic
918774110 1:188607266-188607288 ATATATACATATATAAAAAGAGG - Intergenic
919036399 1:192315015-192315037 ATGTTTAGAGAAATGACAAATGG - Intergenic
919533691 1:198759241-198759263 ATGTAAAGAGAAATGTAAAGAGG - Intergenic
920248160 1:204603802-204603824 ATTTCTCCAGAAATGAAAATAGG + Intergenic
921011627 1:211147552-211147574 ATTTTTTCAGAAATTAAAAGAGG + Intergenic
922112463 1:222574519-222574541 CGGTATACAGAAATTAATAGGGG + Intronic
922283827 1:224151029-224151051 ATATACAAAGAAATGAAAAATGG - Intronic
922678422 1:227568548-227568570 CTGTATACAGCAAAGGAAAGTGG - Intronic
923098514 1:230794136-230794158 ATGTAGACAAAAATGAAAGGGGG + Intronic
923785681 1:237066208-237066230 ATGTAAACAGACATGAGAAAAGG - Intronic
923922203 1:238580018-238580040 ATGTATAAAGAAAGGAAAATAGG - Intergenic
923968487 1:239171839-239171861 ATGAATACATAAATAAAATGTGG + Intergenic
1062893210 10:1081756-1081778 ATGTAAAAAGAAATTAAATGAGG - Intronic
1063039301 10:2320374-2320396 ATGTATACAGAAAAAGAAAGAGG - Intergenic
1063114197 10:3062332-3062354 AAGTATAGAGAAAGAAAAAGGGG - Intergenic
1063599667 10:7468962-7468984 ATCTCTACAAAAAGGAAAAGGGG + Intergenic
1064062911 10:12154243-12154265 AATTATACAGAAATGAGAAACGG - Intronic
1064321254 10:14307246-14307268 AAGTATACAGAGAAGAAAATCGG + Intronic
1064323260 10:14325798-14325820 ATTTATAAAGAAATGAAATGAGG + Intronic
1064458131 10:15507693-15507715 TTGAATACAGCAAGGAAAAGTGG - Intergenic
1064777336 10:18793291-18793313 ATGTATACACATATATAAAGAGG + Intergenic
1064896009 10:20237460-20237482 ATGTATATAGAAAGTTAAAGAGG + Intronic
1065251972 10:23824281-23824303 ATATATAAATAAATAAAAAGAGG + Intronic
1065414059 10:25465253-25465275 ATGTATACAGAAATTACACGTGG - Intronic
1066230451 10:33427439-33427461 TTGTATAAGGTAATGAAAAGAGG - Intergenic
1067432905 10:46255676-46255698 ATATATAAAGAAATAAAAATTGG - Intergenic
1067513788 10:46919035-46919057 ACATTTCCAGAAATGAAAAGGGG - Intronic
1067648466 10:48132799-48132821 ACATTTCCAGAAATGAAAAGGGG + Intergenic
1067909392 10:50330487-50330509 ATAAATAAATAAATGAAAAGGGG + Intronic
1068023957 10:51619278-51619300 ATGTATAGAGAAAAGAAAGCAGG + Intronic
1068531351 10:58190258-58190280 ATTTACACAGAAATAAAAAAAGG + Intergenic
1070316254 10:75315903-75315925 ATGTAAATAGAAACCAAAAGAGG + Intergenic
1070364034 10:75718411-75718433 ATGTAGACTGAAATGACAATGGG - Intronic
1070655301 10:78267132-78267154 ATGGAAGCAGAAAGGAAAAGGGG - Intergenic
1070889572 10:79932795-79932817 ATGTTCACAGGAAAGAAAAGAGG - Intergenic
1071249244 10:83799780-83799802 AAATAAACAGAAATGAAAAAGGG - Intergenic
1071313696 10:84369916-84369938 AAGCATACATAAATGAAAATTGG - Intronic
1071314142 10:84376042-84376064 ATGTCAGCAGAAATGAACAGTGG - Intronic
1071916767 10:90301739-90301761 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
1072022200 10:91413240-91413262 ATGTTTACAGAAAGGTACAGGGG + Intronic
1072258204 10:93641226-93641248 ATGAAAACAGAAAGGAAAGGGGG - Intronic
1072332475 10:94367377-94367399 ATGTATACCTAAATGAGAACAGG + Intergenic
1072627555 10:97122979-97123001 ATTTATCCAGGAAGGAAAAGGGG + Intronic
1073057660 10:100712680-100712702 TTGTTTACAGAGATGAACAGTGG - Intergenic
1073611913 10:104952670-104952692 AGGGATATAGAAAGGAAAAGTGG - Intronic
1074339795 10:112616672-112616694 ATATATACAGAAAACTAAAGTGG + Intronic
1074486038 10:113881379-113881401 GTGTCTGCAGAAATGGAAAGTGG + Intronic
1074650459 10:115517636-115517658 ATAAATACCTAAATGAAAAGGGG - Intronic
1075363136 10:121858166-121858188 ATATATACACAAAAGAAAATAGG - Intronic
1078216854 11:9318862-9318884 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
1078550257 11:12275402-12275424 GTGTAGACAGAGAAGAAAAGAGG + Intergenic
1078598637 11:12711556-12711578 ATGTTGACAGCAATGAAGAGAGG - Intronic
1079249494 11:18776810-18776832 ATGTTAAAAAAAATGAAAAGTGG + Intronic
1079756119 11:24265867-24265889 ATGTATTCAGAAAGGAAAGCTGG + Intergenic
1080023714 11:27591793-27591815 ATAAATACATAAATGAAATGTGG + Intergenic
1080226312 11:29965145-29965167 ATGTAAACAGAGATGAGAGGAGG + Intergenic
1080706447 11:34699718-34699740 ATGGATACAAAAAAAAAAAGTGG - Intergenic
1081025302 11:38005241-38005263 ATATATATATAAAAGAAAAGAGG + Intergenic
1081074146 11:38648007-38648029 ATGTATACAGCAAATAATAGGGG + Intergenic
1081112922 11:39158942-39158964 GGGTCTCCAGAAATGAAAAGAGG - Intergenic
1081687962 11:45055898-45055920 ATATATATATAAAAGAAAAGAGG + Intergenic
1082958399 11:58896156-58896178 GTGAAGACAGAAAAGAAAAGAGG - Intronic
1083010648 11:59395120-59395142 ATTTTTAGAGAAATGAAGAGGGG + Intergenic
1083177140 11:60957522-60957544 AATTATAAAGAAAAGAAAAGAGG + Intergenic
1083368732 11:62160952-62160974 GTGTATTCAAATATGAAAAGAGG + Intergenic
1083901478 11:65645579-65645601 ATGAAGACAGAAATGAGAAGTGG - Intronic
1085167085 11:74412152-74412174 AGGTATGCAGAAAAGAAAATGGG - Intergenic
1085192840 11:74643675-74643697 ATGTATTCAGAAATGAAGTTGGG + Intronic
1085440553 11:76558838-76558860 AAGTAGACAGAAAAGAAAAGAGG + Intergenic
1085978964 11:81698226-81698248 AGGCATCCAGATATGAAAAGAGG + Intergenic
1085985985 11:81788992-81789014 ATGTATTTAGAAATCAAGAGTGG - Intergenic
1086190918 11:84078202-84078224 ACATATACAGAAATGAAAAAAGG - Intronic
1086509493 11:87541810-87541832 GTTTTTACAGAAATGAAAGGGGG + Intergenic
1087163317 11:94973096-94973118 ATGTATACAAAGAAGAAAACAGG + Intronic
1087375831 11:97338692-97338714 ATGGACACATTAATGAAAAGTGG - Intergenic
1087447756 11:98276373-98276395 ATGTATTCAGTTAGGAAAAGAGG + Intergenic
1087454654 11:98368942-98368964 ATATATGCAGAAGTGAAAAAGGG - Intergenic
1087606929 11:100388075-100388097 ATATAATCAGAAATGATAAGGGG + Intergenic
1087636987 11:100712952-100712974 ATTTCTAAAGGAATGAAAAGAGG - Intronic
1087782421 11:102315302-102315324 ATGTCTGTAGAAATGAAAAAAGG + Intergenic
1088008617 11:104972363-104972385 CTCAATACAGAAATGAAAAGCGG + Intergenic
1088371890 11:109099301-109099323 ATGTTTAAAGAAATCAAAAATGG - Intergenic
1089898082 11:121952190-121952212 ATGAATACAGAAGTTCAAAGAGG - Intergenic
1089936866 11:122373515-122373537 ATGCATACATAAATAAAATGTGG - Intergenic
1090289505 11:125529671-125529693 ATGAATAGAGAGATGAAATGTGG - Intergenic
1090874982 11:130780889-130780911 ATGTGAACAGAAATGAATATTGG + Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1091258104 11:134209312-134209334 ATGTGTACAGAATTGTATAGAGG - Exonic
1091276295 11:134353857-134353879 ATGCAAACAGTAATCAAAAGAGG - Intronic
1091290543 11:134437092-134437114 CTGAAGACAGAAAGGAAAAGGGG - Intergenic
1092238275 12:6822859-6822881 AAGCATCCAGAAATGGAAAGAGG - Intronic
1092596852 12:10015804-10015826 ATAAATACAGACATAAAAAGAGG + Intronic
1092669548 12:10847593-10847615 ATGTTTCCTTAAATGAAAAGAGG + Intronic
1092699933 12:11217188-11217210 ATGTATACATAAATCAAAATAGG + Intergenic
1092743515 12:11652119-11652141 AAGTACACAGTAATGAAAAGAGG - Intronic
1093346993 12:18050144-18050166 ATTTATAAAGAAAGGAAAATTGG + Intergenic
1093396417 12:18688952-18688974 AGGAATAAAGAAAGGAAAAGAGG + Intronic
1093553383 12:20442020-20442042 ATGGATCCAGAAATGCAAAAGGG - Intronic
1093591609 12:20908099-20908121 AAGTAAAAGGAAATGAAAAGTGG + Intronic
1093651020 12:21645826-21645848 AAGTATAGAGAAAGAAAAAGTGG - Intronic
1093874819 12:24337660-24337682 ATGTCTACCGAACTTAAAAGAGG - Intergenic
1094246930 12:28308950-28308972 ATGTATATTGGAATGAAAATAGG - Intronic
1094614236 12:32022031-32022053 AGGTATATAGAGAAGAAAAGGGG + Intergenic
1095617574 12:44210121-44210143 ATGAAAACAGAAACGAAATGAGG - Intronic
1095847809 12:46765030-46765052 AAGTATACAAAAATAAAAAGTGG - Exonic
1096043272 12:48539505-48539527 ATGAAAAGAGAAATGAGAAGTGG + Intergenic
1097482731 12:60150773-60150795 ATGTATTCAGATAGGAAGAGAGG - Intergenic
1097619369 12:61921780-61921802 ATGTATACAGAAAAGACAACAGG + Intronic
1097645351 12:62230076-62230098 ATAAAATCAGAAATGAAAAGGGG - Intronic
1097718488 12:62994403-62994425 AAGTATACAGAAAAGTAGAGAGG + Intergenic
1097880824 12:64685011-64685033 AGGTATACAGAACAGGAAAGTGG + Intronic
1098020078 12:66145657-66145679 ACATACACAGAAATGGAAAGTGG - Intronic
1099354278 12:81614135-81614157 ATGTATGTAGGAATGCAAAGGGG - Intronic
1099507169 12:83493070-83493092 TTGTACACAGAACTTAAAAGTGG - Intergenic
1099788998 12:87306191-87306213 ATTTATAAAGAAATGCAGAGAGG + Intergenic
1099847569 12:88047510-88047532 ATGTATGAAGTAATGAAAAGAGG - Intronic
1100202109 12:92310118-92310140 ATGTATACATGAATGAAATAAGG - Intergenic
1100369588 12:93955494-93955516 ATGAATACAAAGATGAGAAGTGG + Intergenic
1100666637 12:96760836-96760858 ATGGATAAAGAAAAAAAAAGTGG - Intronic
1100699474 12:97130975-97130997 ATGGAAAAAGAAAGGAAAAGAGG + Intergenic
1102472729 12:113168624-113168646 ATGTATACAGAAATGTCCTGTGG + Intronic
1102766415 12:115437316-115437338 ATGTACACAGAAGTAAAATGTGG - Intergenic
1105620019 13:22057649-22057671 AAGAATACAGAAAAGAAAACGGG - Intergenic
1105691455 13:22844047-22844069 AAGTAAAATGAAATGAAAAGAGG - Intergenic
1106528370 13:30564086-30564108 ATATATTCTCAAATGAAAAGTGG + Intronic
1106555745 13:30806787-30806809 ATGAATTCTGAAATGAGAAGTGG - Intergenic
1106852331 13:33807741-33807763 ATGGAAACAGAAATAAGAAGAGG - Intergenic
1107112983 13:36717585-36717607 ATGTACACAGAAATGGAACTGGG + Intergenic
1107324388 13:39225622-39225644 ATACAGACAGAAATGTAAAGAGG + Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108511095 13:51156470-51156492 ATTTACACAGAAAGGAAATGAGG + Intergenic
1108813828 13:54266887-54266909 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
1108978852 13:56484070-56484092 ATGTATAAAGAATTGGAGAGAGG - Intergenic
1109441992 13:62386488-62386510 AAGTAAATAGAAATGACAAGTGG + Intergenic
1109524253 13:63555290-63555312 ATGCATATGGAAATGAAAAGGGG - Intergenic
1109593915 13:64524568-64524590 ATGAATACAACAAAGAAAAGTGG - Intergenic
1109612399 13:64783849-64783871 ATGTAGACATTTATGAAAAGTGG + Intergenic
1109660204 13:65447754-65447776 ATGAATACATAAATAAAATGTGG + Intergenic
1109730914 13:66412537-66412559 ATGTATACATAAATAAAAAGTGG - Intronic
1109783645 13:67146105-67146127 ATGTTGACTGAAATGAAACGTGG - Intronic
1110084861 13:71364942-71364964 ATTTATACAAAAAAGAAAAAAGG - Intergenic
1110160901 13:72377443-72377465 ATGTACAGAAAAATGAAAATGGG + Intergenic
1110509994 13:76338312-76338334 AAGCATACAGATATGAAAACAGG + Intergenic
1110662427 13:78072831-78072853 ATTTAGAGAGAAATCAAAAGAGG - Intergenic
1110985423 13:81961199-81961221 AGGTATCCAGATAGGAAAAGAGG + Intergenic
1111047982 13:82840821-82840843 TTTTATACAGAAATGAAAATAGG + Intergenic
1111134736 13:84026593-84026615 AAGCATACAGAAATGATCAGAGG - Intergenic
1111251675 13:85609062-85609084 AGTTTTACAGATATGAAAAGGGG - Intergenic
1111397557 13:87684852-87684874 ATATATACAGAAAATTAAAGAGG + Exonic
1111867648 13:93789664-93789686 ATGTAGGCAGAAATGATTAGAGG + Intronic
1112117617 13:96374209-96374231 ATCAATAAAGAACTGAAAAGAGG + Intronic
1112457311 13:99574599-99574621 GTGTATACAGAAATGTGAAGAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113461213 13:110483661-110483683 AAGTTTACAGAAATGAAAAGTGG + Intronic
1114920972 14:27328087-27328109 TTATATACAGAACTGGAAAGTGG + Intergenic
1115036398 14:28862020-28862042 GTACATACAGACATGAAAAGTGG - Intergenic
1115462495 14:33676935-33676957 TTGTATAGAGGAATGAACAGAGG + Intronic
1115762235 14:36586191-36586213 ATCTATACAGTATTGAAGAGAGG + Intergenic
1116450690 14:45061350-45061372 ATGCATACAGATTTGAAAGGAGG - Intronic
1116466184 14:45235233-45235255 ATGGATACAGAAGTGTTAAGAGG - Intronic
1117036699 14:51737645-51737667 ATGTACACAGAAAAAAATAGAGG + Intergenic
1117158377 14:52963278-52963300 ATGTATGTAGAGAAGAAAAGAGG - Intergenic
1117250947 14:53937040-53937062 ATGTAAGCAGAATTGAAAATCGG + Intergenic
1117601869 14:57384526-57384548 ATGTATATACCAATAAAAAGAGG + Intergenic
1117979823 14:61331554-61331576 TTGTATAACGAAATAAAAAGAGG - Intronic
1118003801 14:61547470-61547492 GTGTTTACAGAAAAGAAAACTGG + Intronic
1118258906 14:64229419-64229441 ATTTACACAGATATGAAAGGTGG + Intronic
1118782314 14:69017065-69017087 ATGCATAAAGGAATGCAAAGGGG - Intergenic
1118986790 14:70762893-70762915 TTATATGCAGAAATTAAAAGTGG - Intronic
1119070890 14:71582804-71582826 GAGAATACAGAAATGAAAGGAGG + Intronic
1119267937 14:73275834-73275856 ATGCCTACTGAAATAAAAAGAGG - Exonic
1119312804 14:73664043-73664065 CTGTGTACATAACTGAAAAGGGG + Intronic
1119356273 14:74009505-74009527 ATGTATAAAGGAAGGAATAGGGG + Intronic
1119811123 14:77520391-77520413 ATGTTTACTGAAATGAATATGGG - Intronic
1121707944 14:96013834-96013856 ATAAAATCAGAAATGAAAAGAGG + Intergenic
1124957429 15:34368376-34368398 ATCTATACAAAAATAAAATGTGG - Intergenic
1125015943 15:34935577-34935599 ATATATACAGAAATGTTAACTGG + Intronic
1125032926 15:35090832-35090854 ATGTAAAGAAAAATGCAAAGAGG - Intergenic
1126157477 15:45578684-45578706 ATGTAAATACAAGTGAAAAGTGG + Intergenic
1126269357 15:46795716-46795738 ATAAAATCAGAAATGAAAAGGGG + Intergenic
1127404600 15:58629151-58629173 ATATTTACTGAATTGAAAAGTGG - Intronic
1127915517 15:63451678-63451700 AGGTAGAAAGAAAGGAAAAGAGG - Intergenic
1128209227 15:65882168-65882190 GTGAATATAGAAAGGAAAAGTGG - Intronic
1128375511 15:67071819-67071841 ATAAATAAATAAATGAAAAGTGG + Intronic
1128588504 15:68873477-68873499 ATATATACAGAAATAAAAATTGG + Intronic
1128590359 15:68890068-68890090 TTGTAAAAAGAAAGGAAAAGAGG - Intronic
1129426427 15:75466799-75466821 ATCTATATAGAAATGAGAAAGGG + Exonic
1129596698 15:76970159-76970181 AAGGATAAAGCAATGAAAAGTGG + Intergenic
1130003776 15:80073112-80073134 AAATATACTGAAATTAAAAGGGG - Intronic
1130676345 15:85955490-85955512 ATGTAACTAGAAAAGAAAAGAGG - Intergenic
1131124656 15:89848877-89848899 TTTTAGAAAGAAATGAAAAGAGG + Intronic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1133112352 16:3555970-3555992 ATGAAAACAGAACAGAAAAGTGG + Intronic
1133488634 16:6245408-6245430 ATGAATAGATAAATGAAAACTGG - Intronic
1133958087 16:10464715-10464737 ATGTTTACAGAGATGGAAAGGGG + Intronic
1134102762 16:11463566-11463588 ATGTATACGGATGTGTAAAGAGG + Intronic
1135003438 16:18797627-18797649 ATGAATACAGAAAAGGAAACTGG - Intronic
1136015176 16:27393507-27393529 AAATATACAGAAAAGAAATGAGG + Intergenic
1136670488 16:31852335-31852357 ATGGAAAGATAAATGAAAAGAGG - Intergenic
1137043211 16:35632802-35632824 ATATATACAGACATGTAAAAGGG - Intergenic
1137778984 16:51080966-51080988 ATTTATACATAAAAGAAAACTGG + Intergenic
1137953007 16:52801465-52801487 CTGTTTACATAGATGAAAAGTGG - Intergenic
1138033775 16:53581785-53581807 ATGTACACATAAATGAAAGATGG - Intergenic
1138508566 16:57493539-57493561 ATCTAAAAAGAAAAGAAAAGAGG - Intergenic
1140089238 16:71823813-71823835 ATGTATACATAAATCTGAAGAGG - Intergenic
1140105680 16:71957782-71957804 ATGTAAACAGCAATCAAAAAAGG + Intronic
1140997336 16:80273796-80273818 ATTTACACAGAACTGAACAGGGG + Intergenic
1141122263 16:81369158-81369180 ATATATTCAGGAATCAAAAGAGG - Intronic
1141236578 16:82223410-82223432 ATGTATACAAAAAAGATAGGAGG - Intergenic
1142172507 16:88630340-88630362 TTTTATAAAGAAATAAAAAGGGG - Intronic
1142707382 17:1704659-1704681 AGGAACCCAGAAATGAAAAGAGG - Exonic
1143584802 17:7845725-7845747 AGGGATACAGAGATGGAAAGAGG - Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1144305563 17:13966700-13966722 ATGGAGATAGAAAAGAAAAGGGG - Intergenic
1144692044 17:17273548-17273570 ATCTCTACAGAAAAAAAAAGTGG + Intronic
1147506713 17:41025445-41025467 ATGGAGACAAGAATGAAAAGGGG - Intergenic
1147851506 17:43446993-43447015 ATGAATAGATAAATGAAATGTGG - Intergenic
1147891383 17:43719856-43719878 ATGAAAGCAGAAAAGAAAAGAGG - Intergenic
1148703096 17:49603351-49603373 ATGTATTGAGAAAGGATAAGAGG - Intronic
1149015564 17:51904884-51904906 AAGTATACTGAACTAAAAAGTGG - Intronic
1149462560 17:56842737-56842759 ATGAATATAAAAAAGAAAAGAGG - Intronic
1149677741 17:58481344-58481366 ATGTAAAAAGGAATAAAAAGTGG + Intronic
1151294256 17:73172582-73172604 ATCCATACAAAAATAAAAAGAGG + Intergenic
1152273780 17:79341914-79341936 ATGTGAAAAGAGATGAAAAGTGG + Intronic
1153017285 18:595678-595700 ATTTATAAAGATATAAAAAGGGG + Intergenic
1153694703 18:7628209-7628231 TGGTATACAGAAATGAATAGTGG - Intronic
1154026792 18:10715506-10715528 AAATATACAGAAAAGCAAAGGGG + Intronic
1154293192 18:13128458-13128480 ATTAATACTGAATTGAAAAGGGG - Intergenic
1154405737 18:14089565-14089587 ATGTTAACAGAAATCAAAACAGG + Intronic
1154958368 18:21282434-21282456 ATATAAACAAGAATGAAAAGAGG - Intronic
1155209589 18:23588990-23589012 AAGCATACCGAAAAGAAAAGCGG - Intergenic
1155561163 18:27078713-27078735 CTTTATACAGAGATGACAAGAGG - Intronic
1155739650 18:29272313-29272335 ATGTATTCACAAGTCAAAAGGGG - Intergenic
1155936608 18:31761184-31761206 GTGTATACATACAAGAAAAGTGG + Intergenic
1155948573 18:31883658-31883680 ATGTTTTCAAAAAAGAAAAGAGG + Intronic
1156699768 18:39811829-39811851 ATATAATCAGAAATGATAAGAGG - Intergenic
1156781628 18:40857508-40857530 ATGTTTATATAAATGCAAAGAGG + Intergenic
1157691850 18:49689687-49689709 ATGAATACAGAAATTAATAGAGG + Intergenic
1157999467 18:52599501-52599523 ATTTATAAACAAATCAAAAGAGG - Intronic
1158055939 18:53280305-53280327 ATGTAAACAGAAATGAGACTAGG - Intronic
1158380537 18:56925261-56925283 ATGTCTACTCAAATGAAAACAGG - Intronic
1158683625 18:59592655-59592677 ATGTTTACAAAAATGAACATGGG + Intronic
1159141813 18:64405648-64405670 GTGTGTGCAGAAATGAGAAGTGG - Intergenic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1160418770 18:78729917-78729939 CTGAATACAGAAAGCAAAAGAGG - Intergenic
1160593813 18:79960961-79960983 AAGTATAAAGAAACAAAAAGGGG - Intergenic
1168180150 19:54656774-54656796 ATGTATACACAATGGAAGAGGGG - Intronic
1168366924 19:55796258-55796280 AGGAATTCAGAAATGAAAAGAGG + Intronic
925524592 2:4786088-4786110 ATGGATATAGAAATGAAATGTGG - Intergenic
925617577 2:5758343-5758365 ATGTATAGAGAAATGTTAATGGG + Intergenic
926656531 2:15413355-15413377 ATATATACAGAAAGCAAAGGGGG + Intronic
927236663 2:20881145-20881167 AAGTCTGCAGAAATGAAGAGAGG - Intergenic
928441441 2:31295546-31295568 ATGGATGCAGAGCTGAAAAGGGG - Intergenic
928675928 2:33651265-33651287 TTGAATATAGAAAGGAAAAGTGG + Intergenic
928835070 2:35533823-35533845 GTGAATACATAAATGAAATGTGG + Intergenic
929177498 2:38995838-38995860 ATACATACACAAATGAAAATTGG - Intronic
929362230 2:41105911-41105933 GTTTATACAGATATGCAAAGTGG + Intergenic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
929836653 2:45407540-45407562 AAGTATATAAAAATGAATAGAGG - Intronic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930483308 2:51977669-51977691 ATGTATATAGAAAGGCAAAGAGG + Intergenic
930602899 2:53461916-53461938 AAGGATACAGACAAGAAAAGAGG - Intergenic
931002424 2:57802248-57802270 AAGTAAAAAAAAATGAAAAGGGG + Intergenic
932018655 2:68059813-68059835 ATGTAGACAGAAAAGAGAAGGGG - Intronic
933353114 2:81181068-81181090 ATGTATATAGATATATAAAGAGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
934897297 2:98129967-98129989 AAGTATAGAGAAAGAAAAAGGGG + Intronic
935034847 2:99359602-99359624 ATGGATCCAGAAATGAAACCAGG + Intronic
935446499 2:103162328-103162350 AAGTTTACATAAAAGAAAAGGGG - Intergenic
935575313 2:104703346-104703368 ATGTACAGAGAAATGAAACGTGG - Intergenic
935765585 2:106364169-106364191 ATGGATATTGAAATAAAAAGAGG - Intergenic
935950282 2:108322464-108322486 ATGTACACGGACATGAGAAGAGG + Intergenic
936654023 2:114463393-114463415 AGGTATACATACATGAAGAGTGG + Intronic
936671227 2:114659274-114659296 ATATAAACAGATATGAGAAGAGG + Intronic
936922237 2:117700820-117700842 ATGAAGAGAGAAATGAGAAGAGG + Intergenic
936924112 2:117719281-117719303 TTTTACACAGAACTGAAAAGTGG + Intergenic
936936663 2:117845622-117845644 ATGAATCCAGAAATAAAATGAGG + Intergenic
937842392 2:126536768-126536790 TTCTATTCAGAAATGAGAAGGGG - Intergenic
938209972 2:129459188-129459210 ATTTATACTGAACTGAGAAGGGG - Intergenic
938652411 2:133397289-133397311 ATGAATTCAAACATGAAAAGAGG - Intronic
938856628 2:135319049-135319071 GTGTATACAGAGTTGAGAAGAGG + Intronic
939338904 2:140867990-140868012 ATGTATACATATATTAAAATTGG - Intronic
939338918 2:140868162-140868184 ATCTATAAAGACATGAAAACTGG - Exonic
939860686 2:147416656-147416678 AGGTATACACAAAGGAGAAGAGG + Intergenic
939894864 2:147779237-147779259 ATGTATACAGAAAGTACAACAGG - Intergenic
939975897 2:148717085-148717107 ATATAATCAGAAATGATAAGGGG - Intronic
940126373 2:150330485-150330507 ATATATCCAGAAGTAAAAAGAGG + Intergenic
940265830 2:151835765-151835787 AAGTATGCAGGTATGAAAAGAGG + Exonic
940379110 2:152994008-152994030 ATGCATAGAGAAATGAAAACTGG + Intergenic
940535571 2:154937262-154937284 ATGAATAAATAAATGAAATGTGG - Intergenic
940629748 2:156222957-156222979 ATGCAGTCAGAAATGATAAGAGG + Intergenic
941003549 2:160224855-160224877 ATGTATGCTGCAATGAAATGAGG - Intronic
941843089 2:170108538-170108560 AACTATAGAGAAATGGAAAGGGG + Intergenic
942331260 2:174827295-174827317 ATCTATACAAAAATAAAAAGGGG + Intronic
942371065 2:175285679-175285701 ATGTTTTCATAAAAGAAAAGTGG + Intergenic
943113580 2:183638305-183638327 CTGTATTCAGAATTTAAAAGAGG - Intergenic
943387072 2:187214820-187214842 ATGTATACACAAATGCTAAGAGG + Intergenic
943390553 2:187262116-187262138 ATGAATACAAGAATTAAAAGAGG - Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943891389 2:193290764-193290786 ATATATATTGAAAAGAAAAGGGG - Intergenic
943977619 2:194504428-194504450 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
944055498 2:195518157-195518179 AAGTAAAGAGAAAAGAAAAGTGG + Intergenic
944429819 2:199620973-199620995 TTGTCTCCTGAAATGAAAAGGGG + Intergenic
945327282 2:208497057-208497079 ATGAATACAGAAATTATAATGGG - Intronic
945404403 2:209426786-209426808 ATGTAGCCAGAAATGAAACTTGG + Intronic
945740416 2:213653434-213653456 CTGTATATAGAAGGGAAAAGTGG - Intronic
945999412 2:216468563-216468585 ATTTAACCAAAAATGAAAAGGGG - Intronic
946071670 2:217039491-217039513 CTATCTACAGAAATGAATAGCGG + Intergenic
946108987 2:217397519-217397541 ATGTAAAGAGAAATTATAAGAGG + Intronic
946780750 2:223191335-223191357 AAGTATAGAGAAAGAAAAAGGGG - Intronic
946804583 2:223458892-223458914 TTTTATACAGAATTGCAAAGAGG - Intergenic
946866370 2:224044517-224044539 ATGAATAAAAAAAAGAAAAGGGG - Intergenic
947937052 2:234016223-234016245 ATCTACACAGAAAAAAAAAGAGG + Intronic
948116453 2:235497048-235497070 AGTTCTACAGAAATGAAAAGTGG - Intronic
1169225356 20:3853181-3853203 ATGTTTACAGAAATTAAAGATGG + Intronic
1169492745 20:6084999-6085021 ATGCAAACAGAAATAAAAGGAGG - Intronic
1169592993 20:7165133-7165155 ATTTATAAAGAAAAAAAAAGAGG - Intergenic
1169652309 20:7882900-7882922 AGGTATGCAGAAAGGAAACGAGG + Intergenic
1169652756 20:7888017-7888039 ATGTATAGAAAGCTGAAAAGAGG - Intronic
1170541959 20:17398169-17398191 ATGGATGCAGAAAGGAAAAGCGG + Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1172974696 20:38897153-38897175 ATAAATAAATAAATGAAAAGTGG + Intronic
1173011353 20:39185815-39185837 GTGTATTCAGAAATGATGAGGGG + Intergenic
1173271269 20:41537889-41537911 ATATACACAGAATTGAAAACAGG + Intronic
1175357775 20:58382538-58382560 ATGTTTAAAGAAATAAAAAAGGG + Intergenic
1175748871 20:61481121-61481143 ATGTGTAGAGAAAAGGAAAGAGG - Intronic
1176888089 21:14281026-14281048 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
1176921923 21:14698024-14698046 ATTTCTACTGAAATAAAAAGAGG + Intergenic
1177083101 21:16666671-16666693 ATGTTTTCAAAAATGTAAAGAGG + Intergenic
1177156353 21:17505099-17505121 ATGTTTAAAGAAATGATAACTGG + Intergenic
1178148286 21:29765083-29765105 AGGGAGACAGAAATGCAAAGAGG - Intronic
1178522501 21:33298311-33298333 ATGTATATAGAAATAAAATTTGG + Intergenic
1178527697 21:33346169-33346191 ATGAATAGAGAAAAGAGAAGAGG + Intronic
1178982262 21:37274416-37274438 ATTTATAGAGAAATGAAGACTGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1181872235 22:25909002-25909024 GTATTTACAGACATGAAAAGAGG - Intronic
1182001205 22:26921292-26921314 ATGGAGACAGAAAACAAAAGAGG - Intergenic
1182306117 22:29369714-29369736 TTGTTGAAAGAAATGAAAAGGGG + Intronic
1182309603 22:29395207-29395229 ATGTATATAGAAAGGCACAGCGG - Intronic
1182513290 22:30835668-30835690 ATGTATACAGAAATCAATTCTGG - Intronic
1182610967 22:31547250-31547272 AATTATATAGAAATGAAAATCGG - Intronic
1183107613 22:35626168-35626190 ATGATTACAGAAATAAACAGAGG + Intronic
1184081556 22:42224953-42224975 ATGTAAATAGAAATGAAAAGGGG - Intronic
949135282 3:557265-557287 GTGTCTCCTGAAATGAAAAGTGG + Intergenic
949248581 3:1955260-1955282 TTTTATGTAGAAATGAAAAGTGG + Intergenic
949286807 3:2416423-2416445 AAATATACAGAAATGAAAATTGG + Intronic
949547112 3:5081713-5081735 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
949703617 3:6788537-6788559 ATTTAGATAGAAATGAAAAAAGG - Intronic
949913455 3:8936044-8936066 TTGTGAACAGAACTGAAAAGGGG + Exonic
950279753 3:11696729-11696751 ATGTTTAAAAAAATAAAAAGAGG - Intronic
950588554 3:13916832-13916854 ATGAATACAGAAATAAAATGTGG + Intergenic
951089401 3:18554767-18554789 ATGTACACAGAAGAGAAAGGGGG + Intergenic
951295269 3:20926166-20926188 ATTTATAAAGAAAAGAAAAGAGG + Intergenic
951669579 3:25165313-25165335 ATGTATACAGAAAAGCAAGGTGG - Intergenic
951946140 3:28138609-28138631 ATGTATAAACAAATGAGAAAGGG + Intergenic
952019944 3:29006389-29006411 ATGTATACAAAAATTAAAGATGG + Intergenic
952411046 3:33050189-33050211 AAAAATACAGAAATGTAAAGTGG + Intronic
952881515 3:37988865-37988887 ATAAATACATAAATAAAAAGGGG + Intronic
954467093 3:50661977-50661999 ATGTGCAGAGAGATGAAAAGGGG + Intergenic
954522322 3:51239803-51239825 ATACAATCAGAAATGAAAAGGGG - Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955591636 3:60542040-60542062 ATGTACACAAACATGTAAAGAGG - Intronic
956939674 3:74143250-74143272 ATGTTTTGAGAAAAGAAAAGAGG + Intergenic
956999430 3:74868112-74868134 AGGTATATAGAAATGAAAGTGGG - Intergenic
957169435 3:76719281-76719303 ATGTCTACATAATTGAAAAAGGG - Intronic
957475283 3:80714502-80714524 AAGGATACAGTAATGAAAACAGG + Intergenic
957637311 3:82802981-82803003 AAGTATTGAGAAATTAAAAGTGG - Intergenic
957849925 3:85794478-85794500 ATATTTACACAAATGATAAGAGG + Intronic
958002595 3:87770074-87770096 ACGTATTCAGAAATGAAAAAAGG - Intergenic
958551747 3:95622479-95622501 AGATATACAGAAATCAAGAGAGG + Intergenic
958984437 3:100763915-100763937 ATGAAAACACAAATGAAAAGTGG + Intronic
959305219 3:104655099-104655121 ATTAATACAGAACTGAAGAGGGG - Intergenic
959620419 3:108393734-108393756 ATTGATTCACAAATGAAAAGTGG + Intronic
959720003 3:109475627-109475649 GTGCATACAAAACTGAAAAGAGG - Intergenic
959852866 3:111110977-111110999 ATGAATACAGAAATGCAGAAGGG - Intronic
959949144 3:112159887-112159909 ATGCAAACAGAAACCAAAAGAGG - Intronic
960152661 3:114266291-114266313 ATTTATACAGAACCAAAAAGGGG - Intergenic
960259113 3:115545441-115545463 AATTTTACAGATATGAAAAGTGG - Intergenic
960883584 3:122371385-122371407 ATGTACAAAGGAATGAAAGGAGG - Intronic
960976781 3:123183482-123183504 ATATATTTAGAAGTGAAAAGGGG - Intronic
962684577 3:137834866-137834888 GTGTGTGTAGAAATGAAAAGAGG - Intergenic
963096612 3:141548798-141548820 ATGTAGAAAGAAGTGAAAACAGG - Intronic
963450595 3:145476407-145476429 ATATATACAGAAATAAATATAGG + Intergenic
963689885 3:148486122-148486144 ATTTATATGGAAATGCAAAGGGG + Intergenic
964088272 3:152844750-152844772 ATGTAGACAGAGAAGAAAAAAGG + Intergenic
964091461 3:152881191-152881213 AGGTATCAAGAAATGAAAACAGG + Intergenic
964583935 3:158274704-158274726 ATGGAAACAGAAATGCAATGTGG + Intronic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965769934 3:172171105-172171127 AAGCCTACAGAAATGGAAAGTGG + Intronic
965856589 3:173096258-173096280 AACTAAACAGAAATTAAAAGGGG + Intronic
965861184 3:173152721-173152743 AGGTATACAGATTGGAAAAGGGG - Intergenic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
966234758 3:177688174-177688196 AGGTCCACAGAAAGGAAAAGAGG - Intergenic
967217332 3:187221459-187221481 ATGTATACAAAAATGAAGTTTGG + Intronic
967535567 3:190598319-190598341 AAGTATATAGAAAAAAAAAGAGG - Intronic
967838131 3:193981462-193981484 CTGTATACAGAACTGAAGATGGG - Intergenic
968312870 3:197698511-197698533 ATTTATAGGGAAATGAAAACAGG + Intronic
968785162 4:2616310-2616332 ATGTACACACTAATGAAAAAAGG - Intronic
969157312 4:5222803-5222825 ATGTATACAGTAAAAAAATGTGG + Intronic
970232290 4:13923100-13923122 ATTTAGACACAAATGAACAGAGG - Intergenic
970925750 4:21449898-21449920 ATTTATACAGAGATGGAAAGTGG - Intronic
971607306 4:28674372-28674394 ATGTGTAAAGAAAGAAAAAGTGG - Intergenic
972041543 4:34607252-34607274 ATGTATACAGATATATAAAAGGG - Intergenic
972746825 4:41941859-41941881 ATGTATTTAGAAAAGATAAGAGG - Intronic
972903304 4:43712226-43712248 ATGAATAAAGAAATTAAAAAAGG + Intergenic
973172796 4:47166120-47166142 ATGTTTACAGAAATAAGCAGAGG - Intronic
973304173 4:48625287-48625309 ATGTATACACATTTGCAAAGAGG + Intronic
974793392 4:66718090-66718112 GTGTATTCAGATAGGAAAAGAGG + Intergenic
974822593 4:67086220-67086242 ATTCATACAGAAATCAAGAGTGG - Intergenic
974858230 4:67486149-67486171 ATGTTTACAGAAATGAGGAGAGG - Intronic
975592558 4:76015415-76015437 AAATATACAGAAAAGAAAAGAGG + Intronic
976020192 4:80614103-80614125 ATGTATACAGAAATGAAAAGGGG - Intronic
976502793 4:85811828-85811850 ATGTATAGAGAAATAAAAGCTGG + Intronic
976907388 4:90256703-90256725 ATGGATTGACAAATGAAAAGTGG + Intronic
977026783 4:91829719-91829741 AGGTATAAAGCAATAAAAAGTGG + Intergenic
977263623 4:94828577-94828599 GTGTATACTGAAATGTTAAGAGG + Intronic
978156402 4:105494060-105494082 AGGTATACAAATATGAAGAGAGG - Intergenic
978194146 4:105950937-105950959 ATGTGTACACAAATTACAAGGGG + Intronic
978363238 4:107953534-107953556 ATGTAAAAAGAAAAGAAAATAGG + Intergenic
978931541 4:114319697-114319719 ATTTATAAAGAAAAGAAAAGAGG - Intergenic
979474269 4:121136292-121136314 ATAGATACAAAAATGAGAAGGGG - Intronic
979567580 4:122172821-122172843 AAGTAAACAGAAATGAAAGCAGG + Intronic
979777252 4:124605625-124605647 ATGTAGATAGAGAAGAAAAGAGG + Intergenic
979915703 4:126431050-126431072 ATTTATAAAGAAAACAAAAGGGG + Intergenic
980321249 4:131279646-131279668 ATATATGAAGACATGAAAAGGGG - Intergenic
980475759 4:133313333-133313355 AGCTCTACAGAAATCAAAAGGGG - Intergenic
981220402 4:142225692-142225714 TTGTATATAGGAATGAAAGGGGG + Intronic
981733383 4:147922962-147922984 CTGTATTTAGAAATGAGAAGAGG - Intronic
981770814 4:148305439-148305461 CTGTATACAGACCTGGAAAGTGG - Intronic
981854186 4:149267917-149267939 ATGCATACATAAATGAATAAGGG + Intergenic
982018425 4:151178967-151178989 AAGGATAAAGAAAGGAAAAGAGG - Intronic
982567720 4:157007450-157007472 ATATATGCAGAAATCAGAAGTGG + Intergenic
983075895 4:163326251-163326273 ATGTGTAGACAAATGTAAAGGGG + Exonic
983403134 4:167290880-167290902 AAGTATTCAGAAATCACAAGGGG - Intergenic
983861461 4:172712291-172712313 AAGTATACTAAAAAGAAAAGTGG - Intronic
983914976 4:173282207-173282229 AGTTATACAGAAAAGAGAAGTGG - Intronic
983945756 4:173583844-173583866 AGGTATCCAGAAATAAAAAGCGG - Intergenic
984214273 4:176889008-176889030 ATCTATAGAGAAAGAAAAAGAGG - Intergenic
984230067 4:177085189-177085211 ATGCAGACAAAAATGAAAAGGGG + Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984555947 4:181213933-181213955 AAGTATACAGGAAGAAAAAGGGG - Intergenic
985803848 5:2024472-2024494 AAGTATATAGAAATTAAAAATGG + Intergenic
986868782 5:12021927-12021949 ATATACACAGAAATTAAAACTGG - Intergenic
987214436 5:15718741-15718763 ATGTTTAAAGAAAAGAAAAAAGG - Intronic
987265418 5:16248417-16248439 ATGTATTCAAAAATGTTAAGAGG + Intergenic
987461372 5:18215242-18215264 ATATATACATAAATTAAAAATGG + Intergenic
987563923 5:19560385-19560407 AAGCAAACAGAAATGTAAAGTGG + Intronic
987740335 5:21899660-21899682 ATTTATAAAGAAATGTATAGAGG + Intronic
987882681 5:23769641-23769663 ATGTATGCATAAATAAAATGTGG - Intergenic
988106448 5:26755413-26755435 ATGACTACAGAGCTGAAAAGAGG - Intergenic
988369120 5:30344990-30345012 ATTTATGCAGGAATGAAATGAGG + Intergenic
989188568 5:38647848-38647870 ATGTACCCAGAAATTGAAAGCGG + Intergenic
989300365 5:39884533-39884555 TTCTATACTGAAATGATAAGGGG + Intergenic
989717967 5:44487878-44487900 TTGTTTACAGAAGTGAAAACTGG - Intergenic
989837339 5:46009039-46009061 AAGTATAAAGAAAGAAAAAGGGG + Intergenic
992224407 5:74605676-74605698 ATACATATAGAAAAGAAAAGAGG - Intergenic
993325250 5:86526510-86526532 ATGTAAACCAAAATGAAACGTGG - Intergenic
993519285 5:88880710-88880732 ATGTTTACAAAGAAGAAAAGAGG + Intronic
993653987 5:90556023-90556045 AAATATAAAGAAATGAAAAATGG + Intronic
993681059 5:90878744-90878766 ATTTATACAGATATGAAAGGAGG + Intronic
994068201 5:95567366-95567388 ATGTACACAGAAATGGGAAAAGG + Intronic
994322306 5:98407580-98407602 ATTTATAAAGAAAAAAAAAGAGG - Intergenic
994435475 5:99725414-99725436 ATATATATAGGAATGAAATGAGG - Intergenic
994531934 5:100983135-100983157 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
994813452 5:104553796-104553818 TTGTATAAAGAAAATAAAAGTGG - Intergenic
995739909 5:115345109-115345131 ATGTCCACAGAAATGAAGAAAGG - Intergenic
995819682 5:116215787-116215809 AAGTATAAACAAATGAGAAGAGG - Intronic
996280318 5:121722337-121722359 ATGTATTCAGATATGAAGAGAGG - Intergenic
996283892 5:121766226-121766248 ACGTGGACAGAAATGCAAAGGGG - Intergenic
996778251 5:127156398-127156420 ATACATTCAGAAATGATAAGGGG - Intergenic
996791882 5:127302112-127302134 ATGTCAACAGAATTGAAAACAGG + Intronic
996924661 5:128810213-128810235 GTTCATTCAGAAATGAAAAGGGG + Intronic
996979713 5:129475864-129475886 ATGTATATAGAAATATAAAGAGG - Intronic
996999534 5:129742918-129742940 ATGTATACATAAAGAAAATGTGG + Intergenic
997259351 5:132454236-132454258 ATGAATACAGGGATGAAAACAGG - Intronic
997809053 5:136949152-136949174 ATGTATTCAGATAGGAAGAGAGG - Intergenic
998616266 5:143743947-143743969 TTGAAGTCAGAAATGAAAAGGGG - Intergenic
998737541 5:145159764-145159786 ATGTAGACAGAAGTGAATGGAGG - Intergenic
999469565 5:151840682-151840704 ATGTAAACAGTAACCAAAAGAGG + Intronic
999614478 5:153407491-153407513 AAATGTACAGAAATGAAAAGGGG + Intergenic
999650962 5:153767078-153767100 ATGTATACAGGAAGGGAAACTGG + Intronic
999684209 5:154087992-154088014 ATCTACTCAGAAATGAAATGAGG - Intronic
999892268 5:155991959-155991981 ATATAGACAGAAATGAAGAAAGG - Intronic
1000160117 5:158589303-158589325 ATGTATTCTGAAATTAATAGAGG - Intergenic
1000239807 5:159398970-159398992 ATGCTTACAGAAATGAGACGGGG + Intergenic
1000728983 5:164807373-164807395 ATGTATACAAAAGTAAAAATTGG + Intergenic
1000966553 5:167664479-167664501 CTGAAAGCAGAAATGAAAAGAGG + Intronic
1002299922 5:178252214-178252236 ATTAATACAGAAAAGAAAATGGG - Intronic
1002365683 5:178708453-178708475 AAATATACATAAATGAAAATAGG + Intergenic
1002920263 6:1564182-1564204 ATGATTACCTAAATGAAAAGGGG - Intergenic
1003001534 6:2339608-2339630 ATAAAATCAGAAATGAAAAGGGG + Intergenic
1003288287 6:4754345-4754367 ATGTCTTCTGAAATGAAAATCGG - Intronic
1003304266 6:4912328-4912350 TTGTCTACACAAATGAGAAGCGG - Intronic
1003724358 6:8743385-8743407 ATGTAACAAAAAATGAAAAGTGG - Intergenic
1003851510 6:10227541-10227563 ATGTTTAAAGAAATAAAAAGGGG + Intergenic
1004124361 6:12857846-12857868 AAGTCTACAGAAATGAAACAAGG + Intronic
1004124683 6:12861474-12861496 ATATATGCTGAATTGAAAAGAGG + Intronic
1004213184 6:13673749-13673771 TTTTATACAGAAAAGAAAAATGG + Intronic
1004366383 6:15016781-15016803 AAGTCTACAGAAATTAAATGAGG - Intergenic
1004381141 6:15133578-15133600 ATGTCAACAGAAAGAAAAAGGGG + Intergenic
1004479953 6:16009537-16009559 ATTTATAAAGAAAAGAAAATTGG + Intergenic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005206282 6:23408966-23408988 ATGTGAACAGAAATGCAAATTGG - Intergenic
1006236808 6:32640612-32640634 ATTTCTTCTGAAATGAAAAGTGG - Intronic
1006246827 6:32744477-32744499 ATTTCTTCTGAAATGAAAAGTGG - Intronic
1006888931 6:37406818-37406840 ATGCATACAGAAACAAAAAGAGG - Intergenic
1007459674 6:42009050-42009072 AGGTATACAGAAGTGTAAGGGGG + Intronic
1007876134 6:45103437-45103459 ATGTATCCATAATTCAAAAGGGG + Intronic
1008597691 6:53059656-53059678 ATGCATGCTGAAATGAAAAGAGG + Intronic
1008710299 6:54217677-54217699 ATGTATACTGAAATTGAAAGAGG + Intronic
1009476911 6:64103987-64104009 ATTGAGACAGAAATGAAAATGGG + Intronic
1009711166 6:67323001-67323023 ATTTATAAAGAAAATAAAAGAGG + Intergenic
1009855564 6:69258422-69258444 ATGTATATAGAAGTGAAGAACGG + Intronic
1009940267 6:70281792-70281814 AAGGATACAAAAATGAAAATGGG + Intronic
1010456887 6:76066377-76066399 ATGTAAACAGAAACCAAAAGTGG + Intronic
1010466544 6:76173583-76173605 ATGAGTACAGAAGTGAGAAGTGG + Intergenic
1010631496 6:78204239-78204261 ATGCATACATTAATGGAAAGTGG + Intergenic
1010879509 6:81150572-81150594 ATATATATATATATGAAAAGAGG + Intergenic
1011181123 6:84622055-84622077 ATGTGGACAGAGAGGAAAAGGGG - Intergenic
1011693547 6:89891657-89891679 AAGTATAGAGAAAGAAAAAGGGG - Intergenic
1011714455 6:90089994-90090016 AAGTTTTCAGAAATCAAAAGGGG - Intronic
1011777003 6:90742047-90742069 AATTTTACAGAAATGAAAAAAGG - Intergenic
1012251071 6:96981402-96981424 ATGCAATCAGAAATGAAAAAGGG - Intronic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012523637 6:100150923-100150945 ATGAAAAAAAAAATGAAAAGAGG + Intergenic
1013570881 6:111424323-111424345 AAGTATATAGGACTGAAAAGAGG + Intronic
1014208069 6:118678560-118678582 AAGAATACAGAAAAGTAAAGAGG - Intronic
1014313604 6:119835878-119835900 ATATATACATAAAAAAAAAGAGG + Intergenic
1014396709 6:120932311-120932333 AAGTATAGAGAAAGAAAAAGGGG - Intergenic
1014737289 6:125108786-125108808 ATAAAATCAGAAATGAAAAGGGG - Intergenic
1014965894 6:127749977-127749999 TTCTATACAGAAATGAGCAGTGG - Intronic
1015070932 6:129092059-129092081 ATGAAAACAGAGGTGAAAAGTGG - Intronic
1015980983 6:138838416-138838438 ATATATAGAGAAATGAAGCGTGG - Exonic
1016052071 6:139540070-139540092 CTGTTTACAGAAAGGAAGAGCGG - Intergenic
1016086108 6:139917060-139917082 ATGTATACAGTTTTAAAAAGAGG + Intergenic
1016156165 6:140811148-140811170 ATGAAGAAAGAAATGAACAGAGG + Intergenic
1016498853 6:144694735-144694757 ATGCAATCAGAAATGACAAGAGG - Intronic
1017308366 6:152947749-152947771 ATGTATACAGGTAAGAAAAATGG - Intergenic
1017759611 6:157557701-157557723 GTGGTTACAGAAATGAAACGAGG - Intronic
1017945060 6:159089812-159089834 GTGTAATGAGAAATGAAAAGGGG - Intergenic
1018620921 6:165728898-165728920 ATATACACATAATTGAAAAGAGG + Intronic
1018674900 6:166211244-166211266 ATGCATATATATATGAAAAGAGG + Intergenic
1018965493 6:168484708-168484730 ATGAATAGATAAATGAAATGTGG + Intronic
1019971175 7:4542098-4542120 ATTCATACAGAAATGCAAATGGG - Intergenic
1019980227 7:4615964-4615986 ATGTACAGAGAAAAGACAAGAGG - Intergenic
1020867612 7:13587263-13587285 ACGCAATCAGAAATGAAAAGGGG - Intergenic
1021059336 7:16090835-16090857 ATGTATATACCAATGAAAACTGG + Intergenic
1022186519 7:27974787-27974809 ATTTATAAAGAAAAGAAAAGAGG + Intronic
1022312134 7:29207320-29207342 ATGAATGTGGAAATGAAAAGGGG - Intronic
1022580312 7:31546872-31546894 ATGTAGACAGAAAAGATAAAGGG + Intronic
1024128748 7:46327660-46327682 ACAAATACAGAAATGGAAAGTGG + Intergenic
1024197769 7:47076364-47076386 ACGTAGACAGTAATGAAATGAGG - Intergenic
1024366523 7:48526968-48526990 ATATATACAAAAATGAAATTGGG - Intronic
1024563232 7:50661779-50661801 AGGTATGCAGAAATGTGAAGTGG - Intronic
1025217324 7:57069801-57069823 ACGTATTCAGAAATGAATACGGG - Intergenic
1025628242 7:63243453-63243475 ACGTATTCAGAAATGAATACAGG - Intergenic
1025654024 7:63500662-63500684 ACGTATTCAGAAATGAATACGGG + Intergenic
1025699454 7:63803919-63803941 ATGAAAAGAGAAATGAAAACAGG - Intergenic
1027525840 7:79267605-79267627 ATCTATACAGAAATCAAAATTGG + Intronic
1027748106 7:82104210-82104232 ATGAATAAATGAATGAAAAGAGG + Intronic
1030430141 7:109435045-109435067 ATGTATCCAAATAGGAAAAGAGG + Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1031256604 7:119458892-119458914 ATGTAGATGGAAATAAAAAGAGG - Intergenic
1031549299 7:123088751-123088773 ATGTGTATAGAAATGAAATATGG + Intergenic
1031970985 7:128064983-128065005 TTGGCTACAGAAGTGAAAAGGGG + Intronic
1033765566 7:144486348-144486370 ATATATGCAGAAAAGAAATGAGG - Intronic
1033954305 7:146825642-146825664 AAGTGTACAAATATGAAAAGTGG + Intronic
1033964127 7:146952455-146952477 ATGTATTCAAAAAGGAAAAGAGG + Intronic
1034225797 7:149480301-149480323 TTATTTACAGAAATAAAAAGGGG + Intronic
1034514951 7:151569201-151569223 ATGTCTACAAAAAAGAAAGGTGG - Intronic
1034622521 7:152467283-152467305 ATCTCTACAGAAAGGAAAAAAGG + Intergenic
1034656312 7:152732127-152732149 AAATATACAGAAATGAAACAAGG + Intergenic
1034706334 7:153148811-153148833 ATTTATACAAAAGAGAAAAGAGG + Intergenic
1035795444 8:2352313-2352335 ATCTATAAATAAGTGAAAAGAGG - Intergenic
1036768784 8:11565003-11565025 AGGTTTACAGAAAAAAAAAGTGG + Intergenic
1037080870 8:14784350-14784372 ATATATACATAATTGAAAAGGGG - Intronic
1038146116 8:24897672-24897694 ATGAATAGAGAAAGGAAGAGTGG + Intergenic
1038187046 8:25284602-25284624 GTGTTGACAGAAAGGAAAAGAGG - Intronic
1038876523 8:31556969-31556991 CTAAATACAGAAATAAAAAGTGG + Intergenic
1039320568 8:36425728-36425750 ATGGATACTGAAATTAAAATTGG - Intergenic
1039539057 8:38347581-38347603 ATGAAAGCAGAAAAGAAAAGAGG - Exonic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1039673480 8:39632161-39632183 ATGTATACATAAATGCAAAACGG - Intronic
1039709372 8:40040591-40040613 GTGTATATAGTAATGAAAACAGG + Intergenic
1040934693 8:52770321-52770343 AAGAATACAACAATGAAAAGGGG - Intergenic
1042839982 8:73113865-73113887 ATGGATAGAAAAATGAAATGTGG - Intronic
1042962317 8:74317006-74317028 ATATAATCAGAAATGGAAAGAGG - Intronic
1043190966 8:77222484-77222506 ACATATTCAGAAATGACAAGGGG - Intergenic
1043211091 8:77518981-77519003 ATATATATATAAATTAAAAGGGG + Intergenic
1043303095 8:78759542-78759564 ATGTAAACAGCAATGAGATGTGG + Intronic
1043620285 8:82182334-82182356 ATGAAGACAGAAAATAAAAGTGG + Intergenic
1044055946 8:87569850-87569872 ATCAATACAGATAGGAAAAGTGG + Intronic
1044188689 8:89286858-89286880 ATTTATAAAGCTATGAAAAGAGG - Intergenic
1044812677 8:96080143-96080165 ATGTTTTCAGAGATGATAAGAGG + Intergenic
1044914089 8:97093715-97093737 AAGAATACAGAAAGGAAGAGGGG - Intronic
1045040721 8:98221274-98221296 ATGTATAAAAGAATGAAATGAGG - Intronic
1045084700 8:98670065-98670087 CTGTATATAAAAATGAATAGAGG + Intronic
1045745701 8:105418538-105418560 ATTTTTTCTGAAATGAAAAGTGG - Intronic
1045783180 8:105891739-105891761 ATGAATAAATAAATAAAAAGAGG + Intergenic
1046648992 8:116816257-116816279 ATGTGTACAGAAATGAAATATGG - Intronic
1046847245 8:118931465-118931487 ATATGTAGAAAAATGAAAAGTGG - Intronic
1046895918 8:119473245-119473267 ACATATACAGAAATAAAAATAGG + Intergenic
1047042783 8:121016271-121016293 ACGAATAGAGAAATAAAAAGTGG - Intergenic
1047118256 8:121869833-121869855 AGGAAGACAGCAATGAAAAGTGG - Intergenic
1047846463 8:128811196-128811218 ATGAATAAAGAAATAAATAGGGG + Intergenic
1047952844 8:129949516-129949538 ATGTTTACAGAAAGGAAAACGGG - Intronic
1048172138 8:132117396-132117418 ATGTAGATAGAAATGAAAAGAGG - Intergenic
1048605749 8:135967014-135967036 ATGTAAACAGCAATGAAAACAGG + Intergenic
1048728797 8:137414432-137414454 AAGTATAGAGAAAGAAAAAGGGG + Intergenic
1049365771 8:142236199-142236221 ATGAAGACAAAAATGCAAAGAGG + Intronic
1050412081 9:5376749-5376771 GTATATACAGAAATGACAAAAGG - Intronic
1050715028 9:8514673-8514695 AGGTATTCAATAATGAAAAGAGG - Intronic
1050959488 9:11708909-11708931 ATGAATACAGAAATAACCAGTGG - Intergenic
1050960718 9:11726864-11726886 ATGTATACTGAAAAGAAAAGAGG - Intergenic
1051149437 9:14064408-14064430 AAGTATACAAAAAATAAAAGAGG + Intergenic
1051338388 9:16088397-16088419 ATGTATTCAGATAGGAAGAGAGG + Intergenic
1051490890 9:17663125-17663147 AGGAATAGAGAAATAAAAAGTGG - Intronic
1053225910 9:36356839-36356861 ATTTCTACAGGATTGAAAAGGGG - Intronic
1053277408 9:36793967-36793989 ATGGATAAATGAATGAAAAGTGG - Intergenic
1053409525 9:37906563-37906585 ATGTTTGCCGAAATGAAATGCGG + Intronic
1054832241 9:69638575-69638597 TTGTACACATAAATGAAGAGAGG - Intronic
1055088579 9:72339196-72339218 CTGTGTACAGCAAGGAAAAGTGG + Intergenic
1055226056 9:73997761-73997783 CTGTACACAGAAAAGAAAACTGG + Intergenic
1055871976 9:80891494-80891516 ATTTATGCTGAAATGAAGAGAGG - Intergenic
1055884409 9:81043546-81043568 AAGTGTACAGCAGTGAAAAGGGG + Intergenic
1056083738 9:83124171-83124193 ATGAATGGAGAAATGAAATGTGG - Intergenic
1056427399 9:86490987-86491009 AGCTTCACAGAAATGAAAAGTGG - Intergenic
1056979562 9:91296573-91296595 ATGAAAACAGACATGAAAAGAGG - Intronic
1057248574 9:93480810-93480832 GTATTTACAGTAATGAAAAGTGG + Intronic
1057394481 9:94667531-94667553 ATGTACAGAGAAACCAAAAGAGG + Intergenic
1057895776 9:98907524-98907546 ATGCTTGAAGAAATGAAAAGGGG + Intergenic
1059627379 9:116081486-116081508 ATGCAAACAGACAAGAAAAGGGG + Intergenic
1059760071 9:117329419-117329441 ATGTAGACAGGAAAGGAAAGAGG + Intronic
1059767740 9:117399920-117399942 ATGAATACAGAAGTGGACAGTGG + Intronic
1185944013 X:4354213-4354235 ATGCAGACAAAAAAGAAAAGAGG - Intergenic
1186623195 X:11263385-11263407 ATTTATAAAGAAAGGAAAAGAGG - Intronic
1187632333 X:21187688-21187710 ATGTATAGAAAAATGGCAAGAGG + Intergenic
1187649765 X:21389767-21389789 AGGTTTACAAAAAAGAAAAGTGG - Intronic
1187743787 X:22386084-22386106 ATTTATACATAAGTGCAAAGAGG - Intergenic
1187747805 X:22428801-22428823 ATGTGCACAGAAATGAAAAAGGG - Intergenic
1187801261 X:23065713-23065735 ATTTGTACAGAAATAATAAGCGG + Intergenic
1188206404 X:27364313-27364335 ATGCATAGAGACATGAATAGAGG - Intergenic
1188418097 X:29962139-29962161 GTTTATACAGACATAAAAAGAGG - Intergenic
1188528672 X:31113601-31113623 GTGTAAACATAAATGAAAAGAGG + Intronic
1188547956 X:31330542-31330564 AGGAAAACAGAAATGGAAAGGGG + Intronic
1188548952 X:31340502-31340524 ATGTACACATAAAGGAAAAATGG - Intronic
1188578991 X:31687279-31687301 AAGTAGACAGAAAAGTAAAGGGG + Intronic
1188637711 X:32455758-32455780 ATCTTTACTGAAATGAAAAGTGG + Intronic
1188672780 X:32900248-32900270 ATAAATACAAAAATGAAAATTGG + Intronic
1188713294 X:33429069-33429091 ACATATACACAAATGCAAAGTGG + Intergenic
1188741904 X:33794234-33794256 AGGTGGAAAGAAATGAAAAGAGG - Intergenic
1189065546 X:37804585-37804607 ATGAATAGATAAATGAAAAGTGG + Intronic
1189120767 X:38392303-38392325 ATATTAATAGAAATGAAAAGAGG + Intronic
1189511976 X:41672007-41672029 ATGAATAAAGCAAAGAAAAGAGG - Intronic
1189979784 X:46497615-46497637 ATGTATACATATGTGAAAATGGG + Intergenic
1191216323 X:57935046-57935068 AGCTATGCAGAAATAAAAAGAGG + Intergenic
1191832053 X:65426307-65426329 AAATAAACAGAAATGATAAGGGG - Intronic
1192430961 X:71111308-71111330 ATGTGGGCAGAATTGAAAAGTGG - Intronic
1192459241 X:71303100-71303122 ATGTCCACAGAGATGAAAATTGG + Intronic
1192636209 X:72821310-72821332 ATGCTGACAGAAATGAAAAGGGG - Intronic
1192645505 X:72899504-72899526 ATGCTGACAGAAATGAAAAGGGG + Intronic
1193022056 X:76801578-76801600 AGTTATCCAGAAATAAAAAGTGG + Intergenic
1193114180 X:77759744-77759766 AAATAAACAGGAATGAAAAGTGG + Intronic
1193204195 X:78728626-78728648 ATGTAAACAGCTAAGAAAAGTGG - Intergenic
1193318499 X:80092914-80092936 ATGAATAGATAAATGAAATGGGG - Intergenic
1193749015 X:85320200-85320222 ATGCAATCAGAAATGAAAAGGGG - Intronic
1193756378 X:85414071-85414093 ATATAATCAGAAATGAAAAAGGG - Intergenic
1194174299 X:90628368-90628390 ATGTATTCAGGGAGGAAAAGAGG - Intergenic
1194233200 X:91349194-91349216 ATGTATACATATATGTGAAGGGG - Intergenic
1194330393 X:92577394-92577416 ACATATTCAGAAATGATAAGGGG - Intronic
1194575967 X:95614905-95614927 ATGTATTCAAATAGGAAAAGAGG - Intergenic
1194615049 X:96090008-96090030 ATGCAAATGGAAATGAAAAGTGG + Intergenic
1196250535 X:113454883-113454905 AAGCATACAAAAATGTAAAGTGG - Intergenic
1196431354 X:115630539-115630561 ATGGAAACTGAAATGCAAAGGGG - Intronic
1196481801 X:116158712-116158734 ATATCTAGGGAAATGAAAAGTGG + Intergenic
1196546634 X:116970881-116970903 ATATATTCAGTAATGAAATGTGG + Intergenic
1196642234 X:118075543-118075565 ATGGATGCAGGAGTGAAAAGTGG + Intronic
1196719231 X:118838458-118838480 ATTTATTGAGAAATGAAAAATGG + Intergenic
1196775715 X:119335017-119335039 AACTATACAGATATTAAAAGAGG - Intergenic
1197972361 X:132128670-132128692 ATCTATAAAGAAATGAAACAAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198804758 X:140483073-140483095 GTCTAAACAGAACTGAAAAGTGG - Intergenic
1199255533 X:145714959-145714981 GTGTATATAGAAATGAATAAGGG - Intergenic
1199313027 X:146343803-146343825 TTATATAGAGAAATGAAATGAGG + Intergenic
1199522751 X:148754728-148754750 ATGTATAAAGTGCTGAAAAGTGG + Intronic
1200331957 X:155307386-155307408 ATGTATAAAGAACTGAAAGAAGG + Intronic
1200639098 Y:5696462-5696484 ACATATTCAGAAATGATAAGGGG - Intronic
1200884870 Y:8257543-8257565 ATGTATACTGTGATGATAAGGGG - Intergenic
1200942424 Y:8799067-8799089 ATATAAACAGAAAAGAAAAGAGG + Intergenic
1201395454 Y:13543017-13543039 ATAAATACAGAAATGATAAAGGG + Intergenic
1201665489 Y:16448834-16448856 ATGTTGACAGAAAAGAAGAGAGG - Intergenic
1202091944 Y:21200479-21200501 ATGTATTCAAATAGGAAAAGAGG - Intergenic