ID: 976022502

View in Genome Browser
Species Human (GRCh38)
Location 4:80646134-80646156
Sequence CTGGAGGCACTGTTGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976022502_976022506 2 Left 976022502 4:80646134-80646156 CCAAGCCACAACAGTGCCTCCAG 0: 1
1: 0
2: 0
3: 15
4: 226
Right 976022506 4:80646159-80646181 TCTGTCATCTTGCTCTGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976022502 Original CRISPR CTGGAGGCACTGTTGTGGCT TGG (reversed) Intronic
901012874 1:6211057-6211079 CTGGAGCCACTGCTGCTGCTGGG + Exonic
901788567 1:11641113-11641135 CTGGAGGCACATTAGTGCCTGGG + Intergenic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
905075211 1:35264611-35264633 TTGGAGGCAGGGTTTTGGCTGGG - Intergenic
911015801 1:93330733-93330755 CTGAAGGAACTGTTGTGGAGAGG - Intergenic
912374881 1:109201870-109201892 CTGGAGGATCTCTTGAGGCTGGG + Intronic
912864890 1:113248139-113248161 CTGGAGGGAGTGATGAGGCTCGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
916310651 1:163395192-163395214 GTGGAGGAAGTCTTGTGGCTAGG + Intergenic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920301891 1:204994028-204994050 CTGGAGGCCCTGTCTTGCCTTGG + Intronic
920404251 1:205697215-205697237 CTGGAGCCAGAGATGTGGCTGGG - Intergenic
921204147 1:212833702-212833724 CTTAAGGAAATGTTGTGGCTGGG + Intronic
922896774 1:229106867-229106889 CTGGAGGCAGTATGATGGCTGGG + Intergenic
923269136 1:232339027-232339049 CTGGGGGCCATGGTGTGGCTTGG - Intergenic
924122019 1:240810389-240810411 CTTGAGGCATTTTAGTGGCTAGG - Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063386866 10:5621280-5621302 CTGGAGGGACAGTTGAGTCTGGG - Intergenic
1068079718 10:52305426-52305448 CTGGAGGATCTCTTGAGGCTAGG + Intergenic
1068912896 10:62397621-62397643 CTGCATGCACTTTTGTGGCTGGG - Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069738218 10:70671478-70671500 CTGGATGCTCTGATGTAGCTTGG + Intergenic
1072641032 10:97211459-97211481 GTGGAGGGGCTGGTGTGGCTGGG - Intronic
1074297496 10:112204098-112204120 CTGGAGGCACTGATTAGGCACGG - Intronic
1075189885 10:120297374-120297396 CTGGAGGAATTGTTGTGACTGGG - Intergenic
1076006244 10:126949933-126949955 CAGCATGCAGTGTTGTGGCTAGG + Intronic
1076693639 10:132236669-132236691 CTGGAGCCACTGGGGTGGGTGGG - Intronic
1077321017 11:1942025-1942047 ATGGAGGCACTGTTGAGCCCTGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078862975 11:15270022-15270044 CTCCAGGCACTGTTGTGGGGTGG - Intergenic
1079875213 11:25847785-25847807 CTGGACGCATTGTTATTGCTTGG - Intergenic
1081802581 11:45869975-45869997 CTGGGGGCACTGTGGTGACTTGG + Intronic
1081804272 11:45881839-45881861 CTGGCAGCACTGTGGTGCCTTGG - Exonic
1082627194 11:55500422-55500444 CTCCAGGGACTGTTGTGGGTTGG + Intergenic
1083333137 11:61908279-61908301 CGGGAGGCCCTGGTCTGGCTGGG + Exonic
1083688623 11:64392697-64392719 CGGGGGGCCCTGTTGGGGCTGGG + Intergenic
1085739515 11:79066998-79067020 AAGGAGGCACTGAGGTGGCTTGG - Intronic
1089376074 11:117995745-117995767 CTGGAAGCTCGGGTGTGGCTGGG - Intronic
1089672776 11:120067987-120068009 ATGGAGGCACTGGTGGGGTTGGG - Intergenic
1092357057 12:7804679-7804701 CTGGAGTGAGTGTAGTGGCTTGG - Intergenic
1093241839 12:16686365-16686387 CTGGTGTCACTGTGGTAGCTGGG + Intergenic
1095435313 12:42180471-42180493 CTGCAGTCAGCGTTGTGGCTGGG - Intronic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1104037030 12:125104654-125104676 CTGCAGGCAAAGTGGTGGCTTGG + Intronic
1106134624 13:26964910-26964932 GTGCAGGCACTGGTGTTGCTGGG + Intergenic
1106756429 13:32827003-32827025 CTGGAGGTGCTGTTGTCTCTTGG + Intergenic
1107875686 13:44788914-44788936 CTGGTGGCACTGATGTGGTCTGG - Intergenic
1108640312 13:52377655-52377677 CTTGAGACACTCTTGTGACTGGG + Exonic
1110055774 13:70968200-70968222 CTGGAGTCACTGTTCTAGGTAGG + Intergenic
1110572143 13:77016756-77016778 CAGGAGGTTCTGTTGTGGCCAGG - Intronic
1112052845 13:95661295-95661317 CTGGAGTCATTGCTCTGGCTGGG + Intergenic
1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG + Intronic
1113150457 13:107257663-107257685 CTGGAGGCCCTGAGGTGGCCAGG + Intronic
1114503347 14:23188695-23188717 CTGGAGGAACTCTTCAGGCTAGG - Intronic
1114696336 14:24630776-24630798 CTGGAGAAACTGGTGTGGATAGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120105439 14:80488969-80488991 CTCCAGGGACTGTTGTGGGTTGG + Intronic
1122941257 14:104982428-104982450 CTGGATGCAAGGCTGTGGCTGGG - Intergenic
1123510462 15:20993515-20993537 CTCGGGGGACTGTTGTGGGTTGG - Intergenic
1123567677 15:21567261-21567283 CTCGGGGGACTGTTGTGGGTTGG - Intergenic
1123603936 15:22004558-22004580 CTCGGGGGACTGTTGTGGGTTGG - Intergenic
1123767622 15:23497081-23497103 TTGAAGGCAATGTTGTGCCTGGG + Intergenic
1123921331 15:25071840-25071862 TTGCAGGCATTGTTGTGGGTGGG + Intergenic
1124570644 15:30860226-30860248 TTGAAGGCAATGTTGTGCCTGGG - Intergenic
1127310092 15:57744818-57744840 CTGAAGGCACAGTTTTGCCTTGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128322327 15:66702412-66702434 CGGGAGGCACTTTTGTGGAGGGG + Exonic
1129347629 15:74933787-74933809 CATGAAGCACTGTTGTGGATGGG - Intronic
1129412744 15:75358971-75358993 CTGTGGGCAGTGTTGTGGCAAGG + Intronic
1130301029 15:82680098-82680120 CTGGAGGCGTTGTCGGGGCTGGG - Intronic
1202976040 15_KI270727v1_random:294355-294377 CTTGGGGGACTGTTGTGGGTTGG - Intergenic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1132971548 16:2691653-2691675 CTGGAGGCACTGGGGCGGCGGGG + Intronic
1133114261 16:3567250-3567272 CTGGAGGGGCTGCTGTGGCCAGG - Intronic
1133277548 16:4647927-4647949 CTGGAATCACTGTTGGGGCCCGG + Intronic
1134080521 16:11321547-11321569 CTGGAGGATCTCTTGAGGCTAGG + Intronic
1135550990 16:23398223-23398245 CTGGAGGCACTGTCTTTGGTTGG + Intronic
1135819529 16:25670319-25670341 CTTAAGGGAATGTTGTGGCTTGG - Intergenic
1136539475 16:30921331-30921353 CGGGAGGCACACTTGTGGCCAGG + Intergenic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1139923879 16:70475192-70475214 CCAGAGGCCCTTTTGTGGCTTGG + Intronic
1140629344 16:76832961-76832983 CTGCAGCCACTGGGGTGGCTTGG + Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1142140881 16:88472187-88472209 CTGGAGGCACGGTGGTGGGCAGG + Intronic
1143195415 17:5072617-5072639 CAGGAGGCACTGGTGGTGCTGGG - Intergenic
1145275320 17:21425638-21425660 CAGGAGGCAGTTTTGGGGCTTGG + Intergenic
1147920154 17:43911385-43911407 CTGGATGCCCTGTTGAGGCGGGG - Intergenic
1148588530 17:48798192-48798214 CAGGAGGATCTGTTGAGGCTAGG + Intronic
1151440557 17:74126234-74126256 CTGGAGGCACGGCTGTGTTTTGG - Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152530209 17:80914298-80914320 CTGGATCCAGAGTTGTGGCTGGG - Intronic
1152773803 17:82187579-82187601 CGGGGGGCACTGGTGGGGCTCGG + Intronic
1153953782 18:10078801-10078823 CCAAAGGCACTGCTGTGGCTAGG - Intergenic
1157171196 18:45407397-45407419 CTTAAGGGAATGTTGTGGCTGGG + Intronic
1157905225 18:51563698-51563720 CAGGAGGCACTGGAGAGGCTGGG - Intergenic
1158298559 18:56027014-56027036 GTGGAGGCACTGTCCTTGCTGGG - Intergenic
1160183221 18:76654061-76654083 CTTCAGGAACTGTTGTGGTTTGG - Intergenic
1160986962 19:1843515-1843537 CTGGAGGGACGGTTGGTGCTAGG - Intronic
1164321074 19:24147683-24147705 CTCTGGGGACTGTTGTGGCTTGG - Intergenic
1166061870 19:40330899-40330921 CTGGAGACAATGTGGTGGCTGGG + Intronic
1166957467 19:46474488-46474510 ATGGAAGCACTGATGTGGCTTGG + Intergenic
1167649369 19:50721091-50721113 CTGGAGGTGCTGTTGGAGCTGGG - Intergenic
1168412864 19:56150736-56150758 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412877 19:56150814-56150836 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412891 19:56150892-56150914 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412905 19:56150970-56150992 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412919 19:56151048-56151070 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412933 19:56151126-56151148 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412946 19:56151204-56151226 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412958 19:56151282-56151304 CTGGAGGCGCTGCTGTGGATTGG + Intronic
1168412972 19:56151360-56151382 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168412986 19:56151438-56151460 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168413000 19:56151516-56151538 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168413014 19:56151594-56151616 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1168413049 19:56151798-56151820 CTGGGGGCGCTGCTGTGGATTGG + Intronic
1202633158 1_KI270706v1_random:18779-18801 CTGGAAGGACTCTAGTGGCTGGG + Intergenic
1202659424 1_KI270708v1_random:54468-54490 CTGGAAGGACTCTAGTGGCTGGG + Intergenic
927760179 2:25745521-25745543 CTGGAGTCACTGTGTTGGCCAGG - Intronic
928467458 2:31535679-31535701 TTGTAGGCACTGTTGTGATTGGG - Intronic
928990772 2:37231422-37231444 CTGGAGGAAGTGTTACGGCTCGG - Exonic
929573917 2:43040359-43040381 GTGGGGTCACTGGTGTGGCTTGG - Intergenic
930260795 2:49143868-49143890 CTGGAGGCACTGGTATCTCTAGG + Intronic
930290783 2:49490787-49490809 ATGGAGCCACTGGTGTGGCCAGG + Intergenic
931343145 2:61422262-61422284 TTTTAGGCACTGTTATGGCTGGG - Intronic
935794100 2:106624156-106624178 CTGGAGGTGCTGATGTGACTTGG + Intergenic
936491927 2:112979353-112979375 CTGTTTGCACTGCTGTGGCTGGG + Intronic
937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG + Intergenic
937643682 2:124242227-124242249 CTGGAGCCACTGTTGAGCATTGG - Exonic
940251560 2:151682721-151682743 CTGGATGAAAGGTTGTGGCTGGG - Exonic
940999850 2:160190189-160190211 CTTCAGGGACTGTTGTGGGTTGG + Intronic
946593028 2:221272472-221272494 CTGGAAGCTCTGTAGTGGCAGGG + Intergenic
947846534 2:233248783-233248805 CTGTAGGCAGTGGTGTTGCTGGG - Intronic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172835967 20:37873252-37873274 ATGAAGGCACAGTCGTGGCTTGG + Intergenic
1172929947 20:38579454-38579476 CTGGAGGTCCTGTTGTGCGTGGG - Intergenic
1174849600 20:53979628-53979650 GTGGTGGCAGTGGTGTGGCTTGG + Intronic
1176599430 21:8778378-8778400 CTGGAAGGACTCTAGTGGCTGGG + Intergenic
1176628628 21:9116693-9116715 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
1177889896 21:26792460-26792482 CTCCAGGGACTGTTGTGGCGTGG - Intergenic
1178817771 21:35947003-35947025 CAGGAGGTTCTCTTGTGGCTGGG - Intronic
1179454684 21:41490929-41490951 CCGGAGGCACAGGTGTGGCCAGG - Intronic
1179723032 21:43326012-43326034 CTAGGGGCACCGTGGTGGCTTGG - Intergenic
1180326886 22:11437994-11438016 CTGGAAGGACTCTAGTGGCTGGG + Intergenic
1180367571 22:11954575-11954597 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
1180419000 22:12796523-12796545 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
1180986300 22:19905776-19905798 CTCGAGGCACTGTTCTCACTCGG - Intronic
1181910717 22:26236120-26236142 CTGGAGGGACAGTCATGGCTGGG - Intronic
1183059743 22:35328768-35328790 CTGGAGGCAACGCTGAGGCTCGG - Intronic
1183333610 22:37234467-37234489 CCGGAGGCACAGCTGTGGCCTGG - Intronic
1184268000 22:43360289-43360311 CTGGAGGCAACGCTGTGGGTGGG + Intergenic
1184464925 22:44663328-44663350 CTGGAGGCTGTGGTGTGGGTGGG + Intergenic
1184926319 22:47642280-47642302 CTGCTGGCACTGTGGTGGGTGGG - Intergenic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
950421764 3:12903662-12903684 CAGGAGGGACTGTGGAGGCTGGG - Intronic
950472797 3:13197021-13197043 GTGGAGGCAGTGTCGTGGCAAGG - Intergenic
950631476 3:14284868-14284890 CTGGAGGCACTGGGAGGGCTTGG + Intergenic
953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG + Intergenic
955827367 3:62962490-62962512 CTGGAGGCACTGTGGGCTCTTGG + Intergenic
957094943 3:75769385-75769407 CTGGAAGGACTCTAGTGGCTGGG - Intronic
957822879 3:85400988-85401010 ATTGAGCCACTGTTGTGGGTTGG - Intronic
958878025 3:99638009-99638031 CTGGAGGCACTGACATGGCCTGG - Intergenic
959991745 3:112638816-112638838 ACCGAGTCACTGTTGTGGCTGGG + Exonic
960683638 3:120274803-120274825 CTGGAGGCACTGTTGATTCTGGG - Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962396313 3:135017947-135017969 CTGCAGCTGCTGTTGTGGCTGGG + Intronic
966277093 3:178186599-178186621 CTGGAGCCTCTGTTGTGGTGGGG + Intergenic
967210355 3:187162798-187162820 GAGGAGGCCCTGTTGTGGGTAGG + Intronic
967734924 3:192941963-192941985 TTGGAGGGACTATTCTGGCTGGG + Intergenic
1202741511 3_GL000221v1_random:60410-60432 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
972930267 4:44063725-44063747 CTGGAGGCAGTCTTCTGTCTAGG - Intergenic
973362784 4:49180750-49180772 CTGGAAGGACTCTAGTGGCTGGG + Intergenic
973398313 4:49616103-49616125 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
986055808 5:4135782-4135804 CTGGAGACAGTGTTGTGGCAGGG + Intergenic
987310034 5:16673163-16673185 CTGGAGTCTCTGTTGTTCCTTGG - Intronic
990240673 5:53813376-53813398 CTGGAGGAAGTGAGGTGGCTAGG - Intergenic
990529558 5:56660139-56660161 ATGGGGGCACTGTTTAGGCTTGG - Intergenic
992342540 5:75840139-75840161 CTCCAGGGACTGTTGTGGGTTGG - Intergenic
993446582 5:88020120-88020142 CTAGAGCTACTGTTGTGACTTGG - Intergenic
996526314 5:124483909-124483931 CTGAAAGGAATGTTGTGGCTGGG + Intergenic
996799930 5:127391934-127391956 CTGGAGGATCTGTTGAGGCCTGG + Intronic
997600772 5:135136912-135136934 ATGGAAGCACTGTGGTGGCATGG + Intronic
998462095 5:142317344-142317366 CTGGAGGAAAGGGTGTGGCTTGG + Intronic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1000949816 5:167467060-167467082 CTAGACTCACTGTTATGGCTTGG + Intronic
1001340296 5:170837321-170837343 CTGGAGGCAGGGTTGTGGACTGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005365755 6:25075158-25075180 CTTAAGGGAATGTTGTGGCTGGG + Intergenic
1006939543 6:37742710-37742732 CTGGAGGAACAGTTACGGCTTGG + Intergenic
1007398484 6:41590404-41590426 CTGGAGGCAGGGGTGTGGCGGGG - Intronic
1007609389 6:43139430-43139452 CTCCATGCACTGCTGTGGCTGGG - Exonic
1008976706 6:57435437-57435459 CTGTAAGCACAGTTTTGGCTGGG - Intronic
1010547358 6:77174138-77174160 CTGGAGCCACAGTTTTGCCTGGG - Intergenic
1013312831 6:108913467-108913489 CTGTATGCCCTGTTTTGGCTAGG + Intronic
1015865347 6:137721671-137721693 TTGGAGTCATTGTTGGGGCTCGG + Intergenic
1016314922 6:142774379-142774401 TTCGAGGCTCTGATGTGGCTTGG + Exonic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1017712807 6:157185079-157185101 CAGGCGTCACTGATGTGGCTCGG - Intronic
1017925085 6:158904127-158904149 CTGAAGCCACTGCTGTGCCTAGG + Intronic
1019515610 7:1438581-1438603 CTTGAGGGACTGGGGTGGCTGGG - Intronic
1019808911 7:3149839-3149861 CAGGAGGAAGTGCTGTGGCTGGG - Intronic
1022529723 7:31059493-31059515 CCTGAGCCACTTTTGTGGCTGGG + Intronic
1023168164 7:37363530-37363552 CTGGAGCCACTGATGTGGGATGG - Intronic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1024987213 7:55205670-55205692 ATGGAGGACCTGCTGTGGCTTGG - Exonic
1026939160 7:74276902-74276924 CTGGAGCCCCTGCTGTGACTGGG + Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1032077364 7:128842439-128842461 CTGGAGTCCCTGTTGTCCCTGGG + Intronic
1035744126 8:1949606-1949628 CTGGAGGCTCTGTATTCGCTCGG - Intronic
1037549798 8:19959115-19959137 ATGGAACCACTGGTGTGGCTTGG - Intronic
1041167462 8:55103289-55103311 CTGGAGGTACTGTAATGGGTGGG + Exonic
1042827370 8:72992466-72992488 CAGGAGGCTCTGTTGAGGCCAGG - Intergenic
1045048360 8:98300711-98300733 TTGGAGGCACAGGTGTGGCTGGG + Intergenic
1046554814 8:115761612-115761634 CTGCAGCCACTGTTGTGGCACGG + Intronic
1048520576 8:135150474-135150496 CTGCGGGGACTGTTGTGGGTTGG - Intergenic
1049439305 8:142601953-142601975 CTGGTGTCACTGCTGTGCCTTGG - Intergenic
1051106559 9:13587513-13587535 CTGGAGGCAGTGTTTTGGTGTGG - Intergenic
1051158139 9:14173887-14173909 CTAGAAGCACTGTGGAGGCTGGG + Intronic
1056576301 9:87858176-87858198 CCTGAGGCACTGTTGGAGCTGGG - Intergenic
1057831277 9:98409137-98409159 AGGGAGGCAGGGTTGTGGCTGGG + Intronic
1060237582 9:121876765-121876787 CAGGAGGCACTGATGCTGCTGGG - Intronic
1060826808 9:126692344-126692366 CGGGAGGCCCAGTGGTGGCTGGG + Intronic
1060985701 9:127817919-127817941 CTGGTGGGACTGCTGTGTCTGGG - Intronic
1061825943 9:133258258-133258280 CTGGAATCACTGTGGTTGCTTGG + Intronic
1061969959 9:134039623-134039645 CGGGAGCCCCTGCTGTGGCTGGG - Intronic
1062431804 9:136529688-136529710 CTGGAGCCTCTGCGGTGGCTAGG + Intronic
1203751475 Un_GL000218v1:84372-84394 CTGGAAGGACTCTAGTGGCTGGG - Intergenic
1186374323 X:8981913-8981935 CTGGAGTACCTGGTGTGGCTGGG + Intergenic
1187690017 X:21856917-21856939 CTGGTGGCACTCTTGCCGCTGGG - Exonic
1189348518 X:40260311-40260333 CTTGAGGCACTCTAGTGGCGGGG + Intergenic
1190504891 X:51117700-51117722 CTCTAGGGACTGTTGTGGGTTGG + Intergenic
1191134812 X:57052305-57052327 CTGTGGGGACTGTTGTGGCATGG - Intergenic
1193883794 X:86960290-86960312 CTAGGGGCACTGTTGGTGCTGGG + Intergenic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1195955296 X:110322569-110322591 TTGGAGGCACAGTTTTGGCAGGG + Intronic
1197650970 X:129063304-129063326 ATTGAGGCACTGTTGTTTCTTGG - Intergenic
1197764575 X:130051465-130051487 CTGCAGGCAGTGAGGTGGCTTGG + Intronic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1201057601 Y:10011391-10011413 CTGGATGCAGCATTGTGGCTGGG - Intergenic
1201697233 Y:16839522-16839544 CTTGAGCCACTGTTGTGGCCAGG - Intergenic