ID: 976026803

View in Genome Browser
Species Human (GRCh38)
Location 4:80697725-80697747
Sequence ACAGTCAAGGGTAAGATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976026800_976026803 26 Left 976026800 4:80697676-80697698 CCGTGGTGAAATGTAAGAGCGAT 0: 1
1: 0
2: 0
3: 6
4: 69
Right 976026803 4:80697725-80697747 ACAGTCAAGGGTAAGATTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976026803 Original CRISPR ACAGTCAAGGGTAAGATTTG TGG Intronic
901228118 1:7626291-7626313 TCAGTCAAGGGAGAGCTTTGGGG + Intronic
904607823 1:31707776-31707798 AAGGCCAAGGGAAAGATTTGGGG - Intergenic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
907641561 1:56195766-56195788 ACATTGAAGGGAAAAATTTGTGG - Intergenic
907660588 1:56388996-56389018 ACAATTCAAGGTAAGATTTGAGG + Intergenic
908882272 1:68745538-68745560 ACAGAGAAGGGCTAGATTTGTGG + Intergenic
909819507 1:80043591-80043613 AGAAGAAAGGGTAAGATTTGGGG - Intergenic
910898749 1:92096411-92096433 ACAGTTGAATGTAAGATTTGGGG - Intronic
914830183 1:151165448-151165470 ATACTCAAGGGACAGATTTGTGG - Exonic
915438357 1:155926663-155926685 CCAGTCAGGGGTATGTTTTGGGG - Exonic
916225793 1:162488584-162488606 TGAGTCAAGGTCAAGATTTGGGG - Intergenic
918112240 1:181466973-181466995 ACAGCACAGGGGAAGATTTGAGG + Intronic
919390070 1:196972904-196972926 ACAGTCAGGGGTGAGATTACTGG - Intergenic
919829828 1:201532459-201532481 AGAGAAAAGGGGAAGATTTGGGG + Intergenic
920492000 1:206423579-206423601 AGCATCAAAGGTAAGATTTGGGG - Intronic
924497823 1:244607197-244607219 ATACTTAAGGGTGAGATTTGGGG + Intronic
1066353528 10:34660073-34660095 ACAATAGAGGGGAAGATTTGGGG - Intronic
1070946247 10:80394300-80394322 ACACTCAAAGCTAAGATTTTTGG + Intergenic
1076979506 11:197186-197208 ACACTGAAGGGTAAGACCTGCGG - Intronic
1079709353 11:23662176-23662198 ACCCTCAAGGATAAGATCTGAGG + Intergenic
1082680363 11:56160732-56160754 ATAATGAAGGTTAAGATTTGGGG + Intergenic
1084974274 11:72788013-72788035 ACAGTCTAGGCTATGTTTTGGGG - Intronic
1086890955 11:92257642-92257664 ACAGGCAAGGGGAAGACATGTGG + Intergenic
1090263882 11:125342146-125342168 AAAGTCAAGAGTCAGAGTTGTGG - Intronic
1091048764 11:132349288-132349310 ACAGTCAAGGGGTCCATTTGAGG - Intergenic
1091059206 11:132445710-132445732 ACAGTCAGGGGTGAGAATTCAGG + Intronic
1093075596 12:14755295-14755317 AGAAACAAGGGTAAGTTTTGGGG + Intergenic
1094331598 12:29300235-29300257 AGAAACAAGGGTAAGATGTGGGG - Intronic
1094550044 12:31441981-31442003 ACAGTAAAGTGAAAGAATTGTGG - Intronic
1095124516 12:38460607-38460629 AGAGTCATAGGTAAGTTTTGGGG + Intergenic
1096983218 12:55740942-55740964 CCAGTTAAGGGTAGGAATTGTGG + Intergenic
1100006617 12:89902303-89902325 ACAGTAAAGGGTAAAATGTGGGG - Intergenic
1101458815 12:104867510-104867532 TCAGTCAAAGATAAGAGTTGGGG - Intronic
1101458832 12:104867816-104867838 TCAGTCAAAGATAAGAGTTGGGG - Intronic
1102702516 12:114851844-114851866 ACAGTAAAGTTTAAGACTTGTGG - Intergenic
1103679466 12:122681742-122681764 ACAGTCCAGGGGGAGCTTTGTGG + Intergenic
1104199131 12:126570485-126570507 ACAGTCAATGGTAAAACATGAGG - Intergenic
1104511402 12:129382739-129382761 AAAGTCAAAAGTGAGATTTGAGG + Intronic
1108139785 13:47408254-47408276 ACAGCCAAGGGGAAAATATGAGG + Intergenic
1109089017 13:58015373-58015395 ACATTGAAGGGAAAGGTTTGAGG + Intergenic
1109318084 13:60775889-60775911 ACAATCCAAGGTGAGATTTGTGG + Intergenic
1110533963 13:76629627-76629649 ACAGATAAAGGTAAGAATTGAGG + Intergenic
1110913065 13:80987696-80987718 GCAGTCCAGGGAAAGATTGGAGG + Intergenic
1118529609 14:66688346-66688368 ACACTCAAGTGTAACATTTATGG + Intronic
1125237078 15:37527605-37527627 AAACTCAGAGGTAAGATTTGAGG + Intergenic
1128403877 15:67315022-67315044 AAAGTCAAGGGTTAGATCTTGGG - Intronic
1133644579 16:7752267-7752289 AGAGAGAAGGCTAAGATTTGAGG + Intergenic
1136669869 16:31846540-31846562 TCAGGCAAGGGTCAGATTTATGG + Intergenic
1138423429 16:56914732-56914754 AGTGGCAAGGGTAAGATTTCAGG + Exonic
1138460318 16:57144012-57144034 ACAGTCCAGGGCAACATTTCTGG - Intronic
1144859888 17:18294690-18294712 ACACTCAAGGGTAAGTATTTTGG - Exonic
1145081473 17:19897935-19897957 ACAGTCCAGGCTGAGACTTGCGG - Intergenic
1146963911 17:37008945-37008967 ACAGGAAAGGTTAAGGTTTGTGG + Intronic
1147040072 17:37711620-37711642 ACAGTCAAGGACAAGGTTGGGGG + Intronic
1151364593 17:73609020-73609042 AGAGTCAAGGGTTAGCCTTGAGG + Intronic
1153028070 18:689146-689168 ACAGCCTAGGGTAAGATTCCTGG - Intronic
1157451863 18:47795158-47795180 AGAGTCAAGGTTAGGATCTGAGG + Intergenic
1158171416 18:54604816-54604838 ACAGAAAAGGGGAAGATGTGAGG - Intergenic
1159259680 18:65997167-65997189 AAAGTAAAGTCTAAGATTTGGGG + Intergenic
1160354048 18:78211351-78211373 ACAGTCATTTGTCAGATTTGTGG + Intergenic
1164259651 19:23558418-23558440 ACAGAAAAGGGGAAGATGTGGGG + Intronic
1165366240 19:35367621-35367643 ACATTCAAGGTTAATATGTGAGG - Intergenic
1166009989 19:39934914-39934936 ACAGTCAGGGGCAAGAGTAGGGG + Intergenic
929442227 2:41973288-41973310 AAAGCCACAGGTAAGATTTGAGG - Intergenic
929983989 2:46708121-46708143 ACAGTCAAGGATGACATTTAAGG + Intronic
930884064 2:56304199-56304221 ACAGTCAAAGGTCAGCTTTATGG - Intronic
933056893 2:77681638-77681660 TCAGTCAAGTAGAAGATTTGTGG - Intergenic
933927025 2:87102782-87102804 TCAGTCAAGTAGAAGATTTGTGG - Intergenic
939519933 2:143217459-143217481 ACAGTCCAGGCAAAGATTTAAGG - Intronic
941952273 2:171168069-171168091 AATGTCCAGGGTAAGATTTTGGG - Intronic
942624554 2:177885741-177885763 ACACTCAAGGGGAAGAGATGGGG - Intronic
943292984 2:186099377-186099399 ATAGTGGAAGGTAAGATTTGTGG - Intergenic
943327887 2:186523481-186523503 ACAGTCTAAGGTAAGTTATGTGG + Intergenic
1170559690 20:17546398-17546420 ACAATTAAAGATAAGATTTGGGG + Intronic
1171187004 20:23129885-23129907 ACACTGTAGGGTGAGATTTGTGG - Intergenic
1172797046 20:37547452-37547474 AGAGTGAAGGGTGAGATTTGGGG + Intergenic
1177848199 21:26316462-26316484 ACAGTTGAGGTTAAGATTTAAGG + Intergenic
1179268827 21:39832083-39832105 ACAGCCAAGGTTAAGATATCAGG + Intergenic
953853852 3:46485645-46485667 ACAGGCAAGGGTTAGGGTTGAGG - Intergenic
955997501 3:64692303-64692325 ACAGTCAAAGGAAAGATTAGTGG - Intergenic
956004908 3:64768522-64768544 TCTGTCCAGGGTGAGATTTGAGG - Intergenic
956832850 3:73070271-73070293 ACAGTAGAGGGTAAGATCTGTGG + Intergenic
957108483 3:75922974-75922996 ACAGCAAAGGGTATGCTTTGAGG - Intronic
957510095 3:81176701-81176723 AAAGTAAATGGTCAGATTTGAGG - Intergenic
964024425 3:152054988-152055010 ATAATCAAGGGTTAAATTTGAGG + Intergenic
967071302 3:185964650-185964672 ACAGACAAGGGTACAATTAGTGG - Intergenic
967724098 3:192845371-192845393 AGAGCCAAGGGTGAGCTTTGTGG + Intronic
974441706 4:61926709-61926731 ACAGTAACGGTTAATATTTGTGG - Intronic
976026803 4:80697725-80697747 ACAGTCAAGGGTAAGATTTGTGG + Intronic
976375061 4:84337075-84337097 ACATTCAAGGTTAATATATGAGG + Intergenic
978210529 4:106131001-106131023 ACAGTTCAAGGTGAGATTTGGGG - Intronic
980831205 4:138131156-138131178 ACAGTCAGGGGTCAGATTGCAGG + Intergenic
983384022 4:167035149-167035171 ACAAACAAGGGTAAAGTTTGGGG + Intronic
990319369 5:54614387-54614409 ACAGTTTAGAGTAAGATTTATGG + Intergenic
994056959 5:95427847-95427869 AGAGTCACGGGTAACAGTTGTGG + Intronic
995674867 5:114652058-114652080 ACAGTTAAGGGTCAGAAATGAGG + Intergenic
995723199 5:115158279-115158301 ACCTTCAAAGGAAAGATTTGTGG - Intronic
996268365 5:121571163-121571185 ACAATTAACGATAAGATTTGTGG + Intergenic
997081545 5:130745855-130745877 ACAGTTCAGGTTGAGATTTGAGG - Intergenic
999527698 5:152425598-152425620 TAAGTCAAGGCTAACATTTGAGG - Intronic
999945853 5:156594648-156594670 ACAGTCAAGGATTAGTTTGGAGG + Intronic
1000359998 5:160438268-160438290 GCTGTCAAGGGTGAGATTTCTGG + Intergenic
1001228565 5:169966335-169966357 ACAGGCACAGCTAAGATTTGGGG - Intronic
1001404044 5:171463039-171463061 ACAGTCATGCGCAGGATTTGGGG - Intergenic
1006407723 6:33855043-33855065 ACAGGCAGGGTTTAGATTTGGGG + Intergenic
1006995912 6:38259988-38260010 ACAGACTAGGATAATATTTGAGG - Intronic
1008399571 6:51049160-51049182 AAAGTCAAGTGGAGGATTTGTGG - Intergenic
1010784686 6:79986416-79986438 AGTGTAAAGGGTAAGCTTTGTGG - Intergenic
1011163489 6:84419340-84419362 ACAGTCAAGGTTAGGAACTGTGG + Intergenic
1012118780 6:95337917-95337939 ACATTCAAGGTTAATATGTGAGG + Intergenic
1012437572 6:99230671-99230693 ATAGCCAAGAGTTAGATTTGTGG + Intergenic
1013241601 6:108251581-108251603 ACAGTCCAGGGTTAGTATTGTGG - Intronic
1013351639 6:109311293-109311315 ACAGGGAAGGGCAAGATTTAGGG - Intergenic
1013843117 6:114421507-114421529 AAAGTCAAGAGGAAGAATTGGGG + Intergenic
1016510875 6:144841782-144841804 ACAGACAAGGGTAAAATAAGAGG - Intronic
1016834218 6:148461167-148461189 ACAGTCAAGGCTTAGATTGGTGG + Intronic
1023914096 7:44575571-44575593 AAAGTCAAGGGTAGTATTGGGGG + Intergenic
1024182151 7:46907502-46907524 ACAGGCAGGGGTAACATGTGAGG - Intergenic
1024976549 7:55118828-55118850 ACACTGAATGGGAAGATTTGGGG - Intronic
1027402645 7:77824215-77824237 ATAGTAAAAGATAAGATTTGAGG + Intronic
1027648676 7:80837536-80837558 ACAGTGATGATTAAGATTTGTGG - Intronic
1027795017 7:82681619-82681641 ACAGAGATGGGTAAGATTGGGGG + Intergenic
1032785948 7:135199502-135199524 GCTGTCAAGGCTAAGATCTGGGG + Intronic
1035438974 7:158880069-158880091 CCAGACAAGGTTGAGATTTGTGG + Intronic
1035981182 8:4374184-4374206 CCAGTCCAGGGTTAGCTTTGAGG + Intronic
1036228412 8:6979937-6979959 ACAGTCAGAGGTCAGATTGGAGG + Intronic
1036230865 8:6999047-6999069 ACAGTCAGAGGTCAGATTGGAGG + Intronic
1036233311 8:7018146-7018168 ACAGTCAGAGGTCAGATTGGAGG + Intronic
1036445813 8:8821076-8821098 ACAGGCAGGGGGAAGATATGTGG - Intronic
1037792622 8:21959485-21959507 AGAGTAATGGGTAAGATTTTAGG - Intronic
1037846227 8:22284735-22284757 ACAGTCTAGGGTTAAATTTAGGG + Intronic
1038114453 8:24537596-24537618 ACAGAAGAGAGTAAGATTTGTGG - Intergenic
1038805801 8:30790223-30790245 GCAGTCAAGAGTAGGATGTGGGG - Intronic
1040533784 8:48288236-48288258 TGGGTCAAGGGTGAGATTTGGGG + Intergenic
1043560646 8:81489514-81489536 AGAGTCAAGGGAAAAATTTCAGG + Intergenic
1044871814 8:96627190-96627212 GCAGTTCAGGATAAGATTTGGGG - Intergenic
1046046333 8:108969094-108969116 ACATTCAAGGTTAAGAGTAGGGG + Intergenic
1047628615 8:126681733-126681755 ACAGTCTAGGGTAAGTTTCCAGG - Intergenic
1047859547 8:128949750-128949772 GTAGTTAAGGGTCAGATTTGTGG + Intergenic
1059085239 9:111294352-111294374 CCAGCCAAGGGTAAAATTTCAGG - Intergenic
1187455400 X:19436976-19436998 ACAATCAAGAGTTTGATTTGGGG - Intronic
1188051712 X:25495842-25495864 ACAGTGAAGGGTATGACTTGGGG + Intergenic
1191058752 X:56272106-56272128 ACACTCAAAGCTAAGAATTGTGG - Intronic
1197486470 X:127057076-127057098 TCAGTCAGGGGTAAGACTTTAGG + Intergenic
1199853378 X:151740763-151740785 ACAGACAAAGGCAAGGTTTGGGG - Intronic
1200208078 X:154332359-154332381 ACAGTCAAGAAGCAGATTTGGGG - Intergenic
1200225042 X:154412515-154412537 ACAGTCTTGGGAAAAATTTGGGG + Intronic