ID: 976037807

View in Genome Browser
Species Human (GRCh38)
Location 4:80845257-80845279
Sequence CAGTGTGGGACTTGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976037807 Original CRISPR CAGTGTGGGACTTGAGCAGA TGG (reversed) Intronic
900420220 1:2553022-2553044 CAGAGTGGGGCTGGAGGAGAGGG + Intergenic
900424210 1:2568636-2568658 CAGAGTGGGGCTGGAGGAGAGGG - Intergenic
901119438 1:6878726-6878748 CAGTAAGGGACGTGGGCAGATGG + Intronic
902556469 1:17249828-17249850 AACTGTGTGACTTGAGCAAATGG - Intronic
903374420 1:22856916-22856938 CAGTGAGTGACTTGAGGGGAGGG - Intronic
903739543 1:25550729-25550751 AAGTGAGGGGCTTGAGCTGAGGG + Intronic
903745673 1:25585046-25585068 CAGTGTGGCACATGGGGAGATGG + Intergenic
903848154 1:26290661-26290683 GAGTGTGGGGCTTGAGAGGAAGG + Intronic
904027594 1:27514209-27514231 CAGTCTGTGGCTTGAGAAGATGG - Intergenic
904310878 1:29628801-29628823 CAGTGCAGAACTAGAGCAGAAGG + Intergenic
905613728 1:39378449-39378471 CAGTATGGAACCTGAGCAGAAGG - Exonic
905907095 1:41626414-41626436 GAGTATGGGACTTGCCCAGAGGG - Intronic
906051562 1:42878899-42878921 CAGTCTGGGACCTGGGCTGATGG - Intergenic
907663093 1:56411625-56411647 GACTGTGGGAATTGACCAGAAGG - Intergenic
907759143 1:57340858-57340880 CAGTGTGGGACTTGTGCAGGAGG - Intronic
908155513 1:61348757-61348779 ATGTGAGGGACTTGATCAGACGG - Intronic
908952363 1:69577108-69577130 CAATGTGGGACGTGAACACAGGG + Intronic
910028823 1:82690456-82690478 CAGCATTGGCCTTGAGCAGAGGG - Intergenic
911253673 1:95609481-95609503 CACTGTGAGACTGGAGAAGATGG + Intergenic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
916124327 1:161555908-161555930 AAGTGTGGGTCCTGAGGAGATGG + Intergenic
916134210 1:161637266-161637288 AAGTGTGGGTCCTGAGGAGATGG + Intronic
918854483 1:189733158-189733180 CAGTCTGAGACTTGAGAAGATGG - Intergenic
919548205 1:198949736-198949758 TGGTGTGGGTCTTGAGGAGATGG - Intergenic
922702870 1:227771907-227771929 GAGTGTGGGACCTGTGCTGAGGG + Intronic
923144466 1:231188194-231188216 CTGTGTGGGACAGGAGCAGGAGG + Intronic
923291608 1:232551587-232551609 CAGTGGGGGAGGTGAGAAGAAGG + Intronic
1070758083 10:79005883-79005905 CAGGGTGGGAGATGAGGAGAGGG - Intergenic
1071531407 10:86392491-86392513 CAGGGTGGGAGTAGAGGAGAAGG + Intergenic
1071940465 10:90586143-90586165 CATTTTGTGACTTGGGCAGACGG + Intergenic
1072720719 10:97779424-97779446 CACTGAGGGGCTTGAGCTGAAGG - Intergenic
1075644869 10:124090934-124090956 CAGGGTTGGACTTCTGCAGAGGG + Intronic
1076417818 10:130304141-130304163 GAGTGTGGGAATGAAGCAGATGG + Intergenic
1078015539 11:7610487-7610509 CAGGCTGGGAGTTGACCAGATGG - Intronic
1083963020 11:66025038-66025060 CAGTGGGGGACCTGTGCAGGAGG + Intronic
1084462870 11:69306071-69306093 CAGTGTGGACCTTGCCCAGAAGG + Intronic
1084636404 11:70395913-70395935 CAGTGAGGGACTTGAGAGGAGGG + Intergenic
1085731637 11:79004346-79004368 AAGTGTGTGCCTTGTGCAGATGG - Intronic
1086986524 11:93255995-93256017 CAGTGTGGCTCAGGAGCAGATGG + Intergenic
1092112646 12:5974736-5974758 CAGTGAGGAGCTGGAGCAGACGG + Intronic
1092957901 12:13566790-13566812 CTGTGTGGGATTTGGGCAGTTGG - Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096965062 12:55619426-55619448 CAGTTTGGGAAGTAAGCAGATGG - Intergenic
1100010571 12:89947906-89947928 GAGTGTGGGGGTTGAGCAGGAGG - Intergenic
1100443282 12:94637835-94637857 TACTGTGGGACTTGAGAAGCTGG - Intronic
1105466804 13:20651039-20651061 CAGTGTGGTACTGCTGCAGAAGG - Intronic
1106243143 13:27925785-27925807 CAGTGTGGAACTGGAGCACAGGG - Exonic
1106603545 13:31207887-31207909 CTGTTTGGCACTTGAGCAAAAGG + Intronic
1107214802 13:37903808-37903830 CATTGTGTGACTTGAGGAGTAGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108813301 13:54257642-54257664 CAGTGTGGAAGTGGAGGAGAAGG - Intergenic
1110169456 13:72483534-72483556 CTGTCTGGGTCTTGAGAAGAAGG + Intergenic
1111673465 13:91358003-91358025 GAGTGTGTGACATGAGAAGATGG + Intergenic
1112155831 13:96815982-96816004 CTGAATGGGAATTGAGCAGAAGG + Intronic
1112616800 13:101014790-101014812 AAATGGGGCACTTGAGCAGAGGG - Intergenic
1115502543 14:34062484-34062506 CAGGGTGGGGTTAGAGCAGAGGG - Intronic
1116048650 14:39776748-39776770 AACTTTGGGACTTGAGGAGAAGG - Intergenic
1118450988 14:65902000-65902022 CTGTGTGGCACTGGAGCAGCCGG + Intergenic
1118478554 14:66141517-66141539 CAGTGTGGGAAGGGAGCAGGTGG - Intergenic
1122285952 14:100652957-100652979 CAGACTGTGACTTGAGCTGAAGG + Intergenic
1122703752 14:103607551-103607573 CAGTGTGAGATCTGAGCCGAGGG + Intronic
1122716068 14:103697862-103697884 CAGTGTGGGACTGCAGGACAGGG + Exonic
1123047252 14:105524999-105525021 CAGTGTGGGACGTGGGCAGTGGG + Intergenic
1123183121 14:106488478-106488500 CAGTGTGGGAGTGGAGCTAATGG - Intergenic
1125323559 15:38513742-38513764 CAGACTGTGATTTGAGCAGAGGG - Intronic
1125328113 15:38557457-38557479 CCGTGAGGGACTTGAACAAATGG + Intronic
1128787233 15:70406799-70406821 CAGTGTGGTCATTCAGCAGAGGG - Intergenic
1129321026 15:74775114-74775136 CAGTGAGGGACAATAGCAGAGGG + Intergenic
1129326916 15:74805043-74805065 CAGTGTGAGAGTGGAGGAGAGGG + Intergenic
1130994828 15:88897876-88897898 CAGCGTGGGACTGGAGGAGGGGG - Intergenic
1132029917 15:98430925-98430947 CAGGGTGGGCCAAGAGCAGATGG + Intergenic
1133080387 16:3314456-3314478 CAGTGTGGGTCTTGGGCAGCAGG - Intronic
1135153610 16:20032382-20032404 CCGTGTGGTACTTGAGCGGGTGG + Exonic
1135914774 16:26595977-26595999 CAGTGTGAGACTCGATCTGAAGG - Intergenic
1137494668 16:48960620-48960642 CAATGTGGACCTTGAGCAGAGGG - Intergenic
1137843220 16:51660328-51660350 CAGTGTTAGACCTGAGCTGAAGG + Intergenic
1140328190 16:74026530-74026552 CAGAGTGGGACTGGAACAAAAGG + Intergenic
1140504558 16:75463573-75463595 CAATGAGGGACCAGAGCAGAGGG - Intronic
1140512103 16:75516356-75516378 CAATGAGGGACCAGAGCAGAGGG - Intergenic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1142401515 16:89861057-89861079 CAGTGTGGGGTTAGGGCAGACGG + Intronic
1149609926 17:57952796-57952818 CTGTGGGGGACTTGAGCCTAAGG + Intronic
1149611702 17:57962261-57962283 CTGTGTGGGACTTGGGGAGCAGG + Intergenic
1153200575 18:2643444-2643466 CAGTGGTGGAGCTGAGCAGAAGG - Intergenic
1154023270 18:10683922-10683944 CAGTGTGAGGGCTGAGCAGAAGG - Intronic
1155924867 18:31644828-31644850 CACTGTGGGACTTGAAAAGTTGG - Intronic
1157682860 18:49620508-49620530 CAGTGTTGGTCCTGAGGAGAAGG - Intergenic
1158623866 18:59055286-59055308 CAGTGTGGGTTTTCAGCTGAAGG - Intergenic
1159105625 18:63999905-63999927 CACTGAGGGACCTGAGCAGTGGG - Intronic
1160007173 18:75076018-75076040 CAGTGGTGGACTTGAGCAGAGGG + Intergenic
1160200530 18:76792173-76792195 CAGTGTGGGGCCTGAGCAGGCGG + Intergenic
1160593701 18:79960143-79960165 CATTGTAGAATTTGAGCAGAGGG + Intergenic
1161512447 19:4679224-4679246 GAGGGTGGGACTTCTGCAGAGGG - Intronic
1163746479 19:19051801-19051823 CATTGAGGGACTGGAGCAGAAGG - Exonic
1164770806 19:30807351-30807373 GAGTGTGGAACTTCTGCAGAGGG + Intergenic
1166752120 19:45169234-45169256 CAGTGTGGGACCTGGGCCAATGG + Intronic
1167284778 19:48592857-48592879 GAGTGTGGGGTGTGAGCAGAGGG - Intronic
1167677193 19:50894680-50894702 AGGGGTGGGGCTTGAGCAGAGGG - Intergenic
925161340 2:1686149-1686171 CAGTGAGAGACTTGGGCAAAGGG - Intronic
926094603 2:10073094-10073116 CTGTGTGGGAGTGGTGCAGATGG + Intronic
926530761 2:14041668-14041690 AAGTCTGGGGCTTGAGCAAAGGG - Intergenic
926614678 2:14984156-14984178 CATCGTGGGGCTTGGGCAGAGGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927496443 2:23554732-23554754 CCATGTGGGGCTGGAGCAGAGGG - Intronic
929049137 2:37819854-37819876 TACTGTGGGACTTGAGCATGTGG - Intergenic
930743418 2:54857045-54857067 AAGTTTGGGACTTGAGCAGTGGG + Intronic
930858260 2:56042308-56042330 CAGAATGGGACTTGGGAAGAAGG - Intergenic
931178178 2:59874230-59874252 AAGTGTTGGAATTGGGCAGAGGG - Intergenic
932111259 2:69003197-69003219 CAGTGAGGGAATAGAGCTGAAGG + Intergenic
936540815 2:113349523-113349545 CTGTGTGGGGGTAGAGCAGATGG - Intergenic
936993337 2:118388588-118388610 CAGTGTTGGAGTTGTGCATAAGG + Intergenic
937206505 2:120240056-120240078 CTGTGTGGGATTTCAGCAGCGGG + Intronic
940906022 2:159170696-159170718 CAATGTGGGATTTGGGAAGACGG + Exonic
942527768 2:176873600-176873622 CAGTCTGGGACCTGGGCAGCAGG + Intergenic
946993247 2:225359913-225359935 CAGGGTGGGAGGTGTGCAGAGGG - Intergenic
947840788 2:233206685-233206707 CACTGTGGGACAAGAACAGAAGG - Exonic
948218357 2:236249264-236249286 CATTGTGGGAGGAGAGCAGAAGG - Intronic
1169017637 20:2304744-2304766 CAGTGTGAGAATTGAGTTGAAGG - Intronic
1169754282 20:9026658-9026680 CAGTCAGGGACTTGAGCTGCAGG - Intergenic
1169793997 20:9441791-9441813 TAGTGTGTGGCTGGAGCAGACGG + Intronic
1169906568 20:10610500-10610522 CACTGTGGGAACTGGGCAGATGG + Intronic
1170014724 20:11767740-11767762 CAGTGTGTGACTTGAGCATTGGG + Intergenic
1175187807 20:57190555-57190577 CAGTGGGGGATTTGGGCAGGGGG + Intronic
1176021528 20:62964625-62964647 CAGCGTGGGTCTGGAGCACATGG - Intronic
1177851837 21:26358296-26358318 CAGCCTTGGACTTGTGCAGAAGG - Intergenic
1178229648 21:30766910-30766932 CAGTGTGGCACTTAAGAACATGG + Intergenic
1178823658 21:35997506-35997528 CACTGTGAGACCTGAGTAGATGG + Intronic
1179574019 21:42295744-42295766 CAGGGCAGGACTGGAGCAGAGGG + Intronic
1179578825 21:42325208-42325230 CACTGTGGGACTTGGACAGAGGG - Intergenic
1179997437 21:44980478-44980500 CAGTGAGGGGCCTGAGAAGAAGG - Intergenic
1184635357 22:45824176-45824198 CAGTGTGGGATATTAGAAGAGGG - Intronic
1185088520 22:48753416-48753438 CAGTGGGGGCCCTGGGCAGAGGG - Intronic
949149482 3:748000-748022 CAGGGTGGAAACTGAGCAGATGG + Intergenic
950461617 3:13125535-13125557 CAGTGTGGCGCTTGAGAACAAGG + Intergenic
950591264 3:13937064-13937086 CAGTTTGAGACTTAAGCTGAGGG - Intergenic
953741794 3:45544903-45544925 CAGGGAGGTACTGGAGCAGAGGG + Intronic
953983358 3:47423904-47423926 CAGTGGGAGAGTTGGGCAGAGGG - Intronic
954229221 3:49203437-49203459 CAGTGGAGGATTTGAGCAGAAGG + Intronic
954317546 3:49809423-49809445 CTGTTTGGGACCTGACCAGAAGG + Exonic
954602268 3:51878773-51878795 CACTTTGGGACTGGAGGAGAAGG + Intergenic
956984387 3:74680318-74680340 CAGTCTGGGACCTGAGTAGTGGG - Intergenic
959916985 3:111827346-111827368 CAGAGTGGGATTTGGCCAGAAGG - Intronic
960073912 3:113462248-113462270 CAGTATGGGACTAGAGTAGGTGG - Intronic
961533832 3:127557155-127557177 CAGTGTTGGCCTAGAGGAGAGGG + Intergenic
961561320 3:127732395-127732417 CAGGGAGGGACTTGAGTACAGGG + Intronic
965550179 3:169956496-169956518 CAGTGTGGGACATAAGAGGAAGG - Intergenic
967488051 3:190057056-190057078 AAGTGGGGAACTGGAGCAGAAGG + Intronic
968078954 3:195833638-195833660 CAGAGGGGGATTGGAGCAGAGGG + Intergenic
968768580 4:2488508-2488530 CATTTTAGGGCTTGAGCAGAAGG + Intronic
972444257 4:39128460-39128482 CAGTGTGGAACATGTGCAGAAGG + Intergenic
972607806 4:40630148-40630170 GATTGGGGGACTTGACCAGACGG + Intronic
973026223 4:45275446-45275468 CAGTTTGGGACATGATAAGAAGG - Intergenic
973082061 4:46005484-46005506 CAATGTGGCCCTTAAGCAGAAGG - Intergenic
974107018 4:57481146-57481168 CAATGTGGGACTTGAGGGGGCGG + Intergenic
974156438 4:58079353-58079375 GAGTGTGAGACTTGGGCAGAGGG + Intergenic
974744168 4:66048649-66048671 CAGTGTAGGAATTAAGCAGAAGG + Intergenic
976037807 4:80845257-80845279 CAGTGTGGGACTTGAGCAGATGG - Intronic
981774921 4:148355444-148355466 CAGTGTGGGAGTGGGGTAGAGGG - Intronic
985023462 4:185716147-185716169 CTGTCTGGGAGTTGAGCAGCAGG - Intronic
991435605 5:66595271-66595293 CAGAATGGGACTAGAGCTGAAGG + Intergenic
992365096 5:76083129-76083151 CGGTGTGGGACTGGGGCAGGGGG - Intergenic
992951081 5:81858390-81858412 TAGTGGGGGATTTGAGCTGATGG + Intergenic
994597404 5:101857551-101857573 CAGTGTGGATCTTGAGTAAATGG - Intergenic
995906594 5:117131458-117131480 CACTGGGGGACCTGAGCAAAGGG - Intergenic
997211551 5:132079896-132079918 CAGTGTGGGACCTGGGGAGGAGG + Intergenic
1001851552 5:174971380-174971402 CTGTGTGGGAGTTGGGCAGAAGG + Intergenic
1001981694 5:176042405-176042427 CTGGGTGGGCCTTGAGTAGAGGG - Intergenic
1002235773 5:177801655-177801677 CTGGGTGGGCCTTGAGTAGAGGG + Intergenic
1002436288 5:179233944-179233966 GAGTGTGGGATTTGAGCCGCAGG + Intronic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1006297857 6:33177989-33178011 CAGTGTGGGGCCAGAGCAGGGGG + Intronic
1006505888 6:34488318-34488340 CAGTGTGAGGCTTGTACAGAAGG + Intronic
1006716316 6:36122980-36123002 CAGTGGGGGTCTTGGGGAGAGGG + Intergenic
1007316264 6:40991817-40991839 CCCTGTGTGACTTGAGAAGAAGG - Intergenic
1008469307 6:51865433-51865455 CAGTGAGGGACAGGAACAGAAGG + Intronic
1009633486 6:66232181-66232203 CAGTGAAGGACTTTGGCAGATGG + Intergenic
1009924883 6:70108337-70108359 CAGTATGAGAATTGAGCAGTGGG + Intronic
1010870110 6:81026463-81026485 CAATGTGGGGCTTGAGAAGATGG - Intergenic
1011777920 6:90752652-90752674 GAGAGTGGGAAGTGAGCAGATGG + Intergenic
1013976016 6:116079702-116079724 CACTGTGTGCCCTGAGCAGATGG + Intergenic
1018444112 6:163839591-163839613 CAGTTTGGGCCTTGACCAGAAGG + Intergenic
1019363383 7:617574-617596 CTGGGTGGGACTTGACCAGCTGG - Intronic
1020018980 7:4850794-4850816 CCGTGTGAGACCTGGGCAGAGGG + Intronic
1022044997 7:26615723-26615745 CAGGGTGGGACAGGAGCATATGG + Intergenic
1022108330 7:27212772-27212794 AAGTGGGGGACTTCAGCGGAAGG - Intergenic
1022182383 7:27933874-27933896 CAGTGTGGGACATTAGGAAATGG - Intronic
1022545044 7:31179069-31179091 CAGGGGGGGAGTTGTGCAGAAGG + Intergenic
1028470918 7:91205749-91205771 AAGTGGGGGAAATGAGCAGATGG + Intronic
1029202970 7:98851383-98851405 CCATGTGGCACTGGAGCAGAAGG + Intronic
1029968136 7:104762086-104762108 CAGTGTGTCACCTGAGCAGCAGG + Intronic
1030909758 7:115232515-115232537 CCGTGTGGGACCAGAGCAGCAGG - Intergenic
1035398605 7:158550816-158550838 CAGTGTTGGATTTCAGCAGCAGG - Intronic
1035901499 8:3462139-3462161 CAGTGTGGGTCCCGAGCAGCTGG - Intronic
1037858922 8:22390974-22390996 CAGTGTGGTTCTGGAGCAGGCGG + Intronic
1041487703 8:58396966-58396988 CTGTGCGGGACTGGAGGAGATGG + Intergenic
1042225243 8:66510125-66510147 CTGTGTGGGAATCGAGCATATGG + Exonic
1045146277 8:99347836-99347858 CAGTGTGGGCTTTTAGAAGATGG - Intronic
1045705957 8:104922998-104923020 CAAAGTGGGACTGGAACAGAAGG - Intronic
1049686998 8:143943030-143943052 CAGGATGGGACTTGGGCTGAGGG - Intronic
1049874152 8:145004331-145004353 CTCTGTGGGAGTTTAGCAGATGG + Intergenic
1051331582 9:16029628-16029650 CAGTCTGGGACAGAAGCAGAAGG + Intronic
1051480684 9:17556731-17556753 CAGTGAGGAGCTTGAGGAGAGGG - Intergenic
1057043578 9:91866072-91866094 CAGGGTTGGATTTGGGCAGAGGG - Intronic
1060107078 9:120879255-120879277 CTGTGTGGGACTAGAGCGGGGGG + Intronic
1060567068 9:124602360-124602382 CAATCTGGGTCTTGAGAAGAAGG - Intronic
1060743986 9:126117837-126117859 CTGTGTGGGGCTTGAGCCCAGGG + Intergenic
1188980082 X:36719801-36719823 CAGTGAGGGGCTGGAGCACAGGG + Intergenic
1193593598 X:83419673-83419695 CAGTGTGGGAGTTCACCACAAGG - Intergenic
1193787509 X:85777681-85777703 CAGTTTGGGAAATGTGCAGATGG - Intergenic
1194423610 X:93708400-93708422 CAGTGTGGGACTAGAATAAAAGG + Intronic
1197251816 X:124224947-124224969 CACTGTGGGACCTCTGCAGAGGG - Intronic
1197892112 X:131278467-131278489 CAGTGAGGCACTTGAGCTGGTGG - Exonic
1198971915 X:142291424-142291446 CAAGGAGGGACTTGAGAAGAGGG + Intergenic
1200118778 X:153780852-153780874 CAGGGTGGGCCTGGAGCAGGAGG + Intronic
1201243838 Y:11984245-11984267 CACTTTGGGAGATGAGCAGAAGG + Intergenic