ID: 976046439

View in Genome Browser
Species Human (GRCh38)
Location 4:80953947-80953969
Sequence ATATGGGTCCCTTTTACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976046439_976046446 -2 Left 976046439 4:80953947-80953969 CCAAAAGTAAAAGGGACCCATAT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 976046446 4:80953968-80953990 ATGGCCTAGGGATATAAGGATGG 0: 1
1: 0
2: 0
3: 13
4: 207
976046439_976046448 10 Left 976046439 4:80953947-80953969 CCAAAAGTAAAAGGGACCCATAT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 976046448 4:80953980-80954002 TATAAGGATGGAGAGATTTGAGG 0: 1
1: 0
2: 0
3: 22
4: 337
976046439_976046445 -6 Left 976046439 4:80953947-80953969 CCAAAAGTAAAAGGGACCCATAT 0: 1
1: 0
2: 1
3: 16
4: 189
Right 976046445 4:80953964-80953986 CCATATGGCCTAGGGATATAAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976046439 Original CRISPR ATATGGGTCCCTTTTACTTT TGG (reversed) Intronic
906288076 1:44601348-44601370 ATATGGCACCCTTTTACTAATGG - Intronic
909493355 1:76250128-76250150 ATTTGTGTCACTTGTACTTTGGG + Intronic
910510780 1:88001707-88001729 ATGTGGGTCAATTTTATTTTGGG + Intergenic
916658792 1:166901849-166901871 GTATGGGTCCCTTTGATATTAGG + Intergenic
918798781 1:188942804-188942826 ATGTGGGTCACTTTTACTACAGG + Intergenic
919952826 1:202381561-202381583 ATGTGGGTCCCTATTAGCTTAGG - Intronic
920527731 1:206680176-206680198 ATATCTGTCACTTTTGCTTTGGG + Intronic
920997378 1:211008134-211008156 ATATGAGTTGCTTCTACTTTTGG - Intronic
1064239975 10:13618271-13618293 ATATGGGTCCAATTTTCTTATGG - Intronic
1065409015 10:25400828-25400850 ATATGGGTCACTTGTAAATTTGG - Intronic
1065996517 10:31064292-31064314 ATTTGGATCCCTTTTCTTTTGGG + Intergenic
1066605831 10:37169508-37169530 ATATATGTCCCTTTTCTTTTAGG + Exonic
1066606614 10:37181300-37181322 ATATATGTCCCTTTTCTTTTAGG + Intronic
1067544424 10:47182803-47182825 ATATAGTTCCCTTCTACTTATGG + Intergenic
1070199495 10:74190004-74190026 ATATGGGTTATTTTCACTTTTGG + Intronic
1070350274 10:75584882-75584904 TTAAGGGTCCCTCTAACTTTGGG + Intronic
1073907050 10:108294692-108294714 ATATGAGTACCTTTTTCTTAGGG + Intergenic
1074239006 10:111617676-111617698 AAATGGGTGCATTTTAATTTTGG + Intergenic
1075184774 10:120245817-120245839 ATCTGGGTCCCTTTGACCTGAGG - Intergenic
1075191595 10:120314737-120314759 ATATGTGTCCCTTTCACTCTAGG + Intergenic
1075491663 10:122876509-122876531 ATATGGTGCCCTTACACTTTTGG - Intronic
1076395306 10:130134510-130134532 AAATTGGTCTCTTTTACCTTTGG - Intergenic
1076562405 10:131375771-131375793 GGATGGGTCCTTGTTACTTTAGG + Intergenic
1077660962 11:4068356-4068378 ATAAGGATACCTTTGACTTTTGG + Intronic
1077966128 11:7135458-7135480 ATATAGTTCCCTTTTCCCTTTGG + Intergenic
1078123560 11:8535743-8535765 ATATTGGTTTCTTTTCCTTTGGG - Intronic
1078539672 11:12203171-12203193 ATTTAGGTTGCTTTTACTTTGGG + Intronic
1079084272 11:17433973-17433995 ATCTGGGTCCCTTTTGCTGTGGG - Intronic
1083354365 11:62055000-62055022 ATATGGAGCCCATTCACTTTAGG - Intergenic
1083357630 11:62078761-62078783 ATTTGGGTCCTTTCTAGTTTGGG + Intergenic
1085191452 11:74628360-74628382 TTATTGTTTCCTTTTACTTTGGG + Intronic
1085760771 11:79239328-79239350 ATATGACTCCCTTTTCCTTCTGG - Intronic
1085830094 11:79890768-79890790 ATATGGGTCACATTTGCATTTGG + Intergenic
1089699761 11:120237530-120237552 ATATGGGCCTCTCTGACTTTTGG + Intronic
1090888648 11:130902486-130902508 ATTTGGCTTCCTCTTACTTTGGG + Intronic
1095462184 12:42454915-42454937 GCATGGGTCCCTTTCAGTTTGGG - Intronic
1095714401 12:45326621-45326643 ATATTTCTCCCTTTTCCTTTTGG + Intronic
1095775422 12:46004451-46004473 TTCTGGGTCTCTTCTACTTTCGG - Intergenic
1096193566 12:49634879-49634901 ATACTGGGCCCTTTTCCTTTGGG - Intronic
1100174450 12:92013463-92013485 ATATGGGTGCCTATGTCTTTTGG + Intronic
1100761921 12:97816938-97816960 CCATGGGTCCCCTTTATTTTTGG + Intergenic
1101067259 12:101035126-101035148 ATTTGGGTCCTTTATAGTTTGGG - Intronic
1101086043 12:101237663-101237685 AAATGGGTGCTTTTTTCTTTAGG + Intergenic
1101819991 12:108176182-108176204 AAATGGGTGCATTTTACTGTAGG - Intronic
1101856001 12:108443595-108443617 ATATGTGTTCCTTTTGCTTCTGG - Intergenic
1103821039 12:123699015-123699037 ATATAGGTTACTTTTACTGTTGG + Intronic
1106030877 13:26001293-26001315 ATTTGGGTCGTTTCTACTTTTGG + Intronic
1106662296 13:31812172-31812194 ATAAGTGTCCATCTTACTTTTGG - Intergenic
1109212697 13:59552393-59552415 ATTTGGGTCTTTTTTATTTTGGG - Intergenic
1109656290 13:65395230-65395252 ATATGTTTCCCTTTTCTTTTGGG + Intergenic
1110168521 13:72472744-72472766 ATAGGGCTTGCTTTTACTTTGGG - Intergenic
1112204533 13:97310828-97310850 ATATGTTTCTCTTTTCCTTTGGG - Intronic
1118625771 14:67657624-67657646 AGCTGGGTCCCTTTTGATTTTGG - Intronic
1120901798 14:89581733-89581755 ACATGGGTCTCTTCTACTTCAGG + Intronic
1121898812 14:97673473-97673495 ATATGGTTGCCTTTTACAATGGG - Intergenic
1125553350 15:40564649-40564671 ATAGCTGTCCCTTTTACTTCCGG - Intronic
1126044760 15:44628691-44628713 ATATTGCTCTCCTTTACTTTGGG + Exonic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1126752831 15:51894781-51894803 ATATGGGTTCCTTCCAGTTTGGG + Intronic
1128191980 15:65710273-65710295 ATATTGTTCCCTTTTATTTTTGG - Intronic
1128604156 15:69023433-69023455 TTATAGGTGCCATTTACTTTGGG + Intronic
1128905016 15:71459646-71459668 TTCTGGGTCATTTTTACTTTGGG - Intronic
1131713890 15:95087500-95087522 AAATGGCTTCCTTTTCCTTTTGG + Intergenic
1131776195 15:95801638-95801660 ATTTGGGTTCTTTCTACTTTTGG + Intergenic
1132771183 16:1564444-1564466 AAAAGGGTCCCTTTTGCTTTGGG - Intronic
1133596117 16:7294384-7294406 CTCTGGGTACCTTTTAATTTGGG + Intronic
1138415548 16:56869583-56869605 AAATGGGTCTCTGTCACTTTGGG - Intronic
1140871343 16:79109419-79109441 TTATGGCTCTTTTTTACTTTAGG + Intronic
1144110295 17:12023971-12023993 TTAATGGTCCCTTTTACTATTGG + Intronic
1145737565 17:27243707-27243729 AAAGGTGTCCCTTTTACTTATGG - Intergenic
1148349621 17:46930746-46930768 ATATAGGTCTCTTTTCCTTTGGG - Intronic
1149399629 17:56282065-56282087 ATTTGGGTTGCTTTCACTTTGGG - Intronic
1150190840 17:63236977-63236999 ATATGGATTTCTTTTCCTTTGGG + Intronic
1151115813 17:71733612-71733634 ATATTGATTCCTTTAACTTTGGG - Intergenic
1152789536 17:82271683-82271705 ATATGGGTGGCTCATACTTTCGG - Intronic
1153440828 18:5117459-5117481 ATATGGGGCCCTTTTACTTGTGG - Intergenic
1154205396 18:12331979-12332001 GTAGGGGTCCCTTTTTCTGTAGG - Intronic
1155109567 18:22700375-22700397 ATATGGGTACTTCTTACTTTGGG + Intergenic
1156649549 18:39208939-39208961 ATAAGTGTTCCTTTGACTTTGGG - Intergenic
1156920700 18:42519133-42519155 ATATAGGTCCACTTTGCTTTGGG - Intergenic
1157838540 18:50932155-50932177 ATATTGGTCTATTTTACTTCAGG + Intronic
1157856470 18:51109862-51109884 TTATGCGTCCCTTTCACTTTCGG - Intergenic
1158067065 18:53423359-53423381 AGATGGGTCACTGTTGCTTTGGG + Intronic
1159441132 18:68482282-68482304 ATTTGAGTCCCTTGTAATTTTGG - Intergenic
1164470778 19:28529734-28529756 ATTTGGGCCCCTTATACTTCTGG - Intergenic
1164923791 19:32109982-32110004 ACATGCTTCCCTTTTACTTGGGG + Intergenic
925864566 2:8215288-8215310 ATGTGGTTTCCTTTGACTTTGGG - Intergenic
926947624 2:18205093-18205115 ATATGTGTCTATTTTCCTTTTGG + Intronic
931023465 2:58078408-58078430 ATTTGGGTTGCTTCTACTTTTGG + Intronic
931235477 2:60409218-60409240 ATTTGGGTCCCTTTCAGTGTGGG - Intergenic
931812789 2:65870903-65870925 ATGTGGGTCCCTTTCATTTGGGG - Intergenic
933380044 2:81530911-81530933 TTATGGGTCCTTTTTACTAAAGG - Intergenic
933468984 2:82695756-82695778 ATATGGGGCCCTTCTAATCTTGG - Intergenic
935563323 2:104580797-104580819 ATGTTAGTCCCTTTTACTTTAGG - Intergenic
935825487 2:106944501-106944523 AAATGGGTGACTTTTACTTCTGG + Intergenic
936841137 2:116770881-116770903 ATTTGGGTTGCTTTTACTTTTGG - Intergenic
937137858 2:119570791-119570813 ATATGGGTTGTTTCTACTTTGGG + Intronic
939198847 2:139008670-139008692 ATAAGTGTGCCTTTTCCTTTTGG - Intergenic
940057733 2:149530699-149530721 ATTTGGGTTCTTTTTAGTTTGGG - Intergenic
941007686 2:160264415-160264437 ATGTGGTTCCCTTTTGCTTCTGG + Intronic
941397611 2:164992567-164992589 ATATGGGTCTCTTTTTCTGTCGG - Intergenic
942017894 2:171835646-171835668 ATATGGGTTCCTCTGACTTCTGG - Intronic
942476854 2:176335709-176335731 ATAGTGGTGCCTTTTATTTTGGG + Intronic
942544106 2:177044805-177044827 ATATAGGTTCCTTTGATTTTAGG + Intergenic
943518536 2:188918032-188918054 ACATGGGTAACTTTCACTTTTGG + Intergenic
946923680 2:224604581-224604603 ATAGTGGTCCCTTTTAGTTTGGG + Intergenic
1169712730 20:8582603-8582625 ATTTGGGTTGCTTCTACTTTTGG - Intronic
1169851494 20:10056731-10056753 AAATGGATGCCTTTTATTTTAGG - Exonic
1170869516 20:20192383-20192405 TTATGGGTACCTTTGCCTTTTGG + Intronic
1171126185 20:22603801-22603823 ACATGGCTCCCTTTCACCTTAGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1176015270 20:62927623-62927645 CTCTGGGCCCCTTTTACTCTTGG - Intronic
1184065225 22:42114963-42114985 ATTTAGGTCCCTCTTACCTTTGG + Intergenic
1184985277 22:48128445-48128467 ATTTGGGTCACTTTTATGTTGGG - Intergenic
949769726 3:7566832-7566854 AAATGGGTCTGTTTTACTTAGGG + Intronic
950864344 3:16176698-16176720 ATTTAGGTCCCTTTTCCTATAGG + Intronic
951462388 3:22965262-22965284 ATATTGGTCCATGTAACTTTTGG - Intergenic
952941449 3:38447756-38447778 ATATTGATTCCTTTTCCTTTGGG - Intergenic
953546609 3:43868134-43868156 ATTTGGGTTCCTTTTCCTCTTGG + Intergenic
955091186 3:55752213-55752235 ATAGCTGTCCCTTTTTCTTTTGG - Intronic
955267228 3:57456807-57456829 ATATGGGTGGCATTTACTCTGGG - Intronic
957323882 3:78667039-78667061 ATCTGGATACCTTTTATTTTTGG - Intronic
957861785 3:85961742-85961764 ATATGGTTTCTTTTTACTTCAGG + Intronic
960635394 3:119780164-119780186 CTTTGGGTCTCTTTTCCTTTGGG - Intergenic
960889018 3:122426664-122426686 ATGTGGCTCCCTTTTTCTTGTGG - Exonic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
963523508 3:146386591-146386613 ATATAGTTCTCTTTTACTTAGGG - Intergenic
967146038 3:186607136-186607158 TCTTGGGTCCCTTATACTTTTGG + Intergenic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
971912720 4:32815191-32815213 AGGTGGTTCCCTTATACTTTTGG - Intergenic
973167746 4:47098301-47098323 ATATGGGTATCATTTACTCTGGG + Intronic
974005392 4:56551349-56551371 TTCTGGGACCCTTTTTCTTTGGG + Intronic
975966692 4:79981815-79981837 ATCTGGGTCCATTTTAGTTTTGG - Intronic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
976714323 4:88107216-88107238 TTATAGGTGCCATTTACTTTGGG - Exonic
976991711 4:91375670-91375692 AAAAGAATCCCTTTTACTTTAGG + Intronic
979456343 4:120929879-120929901 ATATGTGTCTCTGTTTCTTTTGG - Intergenic
979703661 4:123695300-123695322 TTATGGGTCCATTTTTCTTGGGG + Intergenic
979949853 4:126878508-126878530 ATATGTGTCCCTTGTAACTTGGG - Intergenic
985157070 4:187000621-187000643 TTATGGGTCAATTCTACTTTTGG - Intergenic
988171204 5:27659105-27659127 ATATGTGTAGATTTTACTTTGGG - Intergenic
988722815 5:33895109-33895131 ATATAGGTCTGTTTTACTTCAGG + Intergenic
989703702 5:44301979-44302001 ATATGTGTCCATTTGAGTTTTGG - Intergenic
989973958 5:50559670-50559692 ATTTGGGTTCTTTTCACTTTGGG + Intergenic
990848585 5:60174575-60174597 ATATAGGTGCATATTACTTTGGG + Intronic
991431740 5:66555103-66555125 ATCTGGGTTCTTTTCACTTTTGG + Intergenic
992283513 5:75207723-75207745 ATTTTGGTACGTTTTACTTTAGG - Intronic
992805527 5:80333333-80333355 ATTTGGGTTCTTTTTAGTTTTGG + Intergenic
994172012 5:96668377-96668399 ATAAGGTTCCTTTGTACTTTAGG + Intronic
994520799 5:100832229-100832251 ATATGGGTTAGTTTTTCTTTTGG + Intronic
995796254 5:115944758-115944780 ACATGGATTCCTTTTACTGTGGG - Intergenic
996894826 5:128468341-128468363 ATCTGGGTTGTTTTTACTTTTGG + Intronic
1003888507 6:10542757-10542779 ATTTGGGTTGCTTCTACTTTTGG + Intronic
1005281037 6:24274034-24274056 ATGTGGCTCTCTTTCACTTTGGG - Intronic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1009531841 6:64828301-64828323 TTATCTCTCCCTTTTACTTTAGG - Intronic
1010035080 6:71316034-71316056 ATATGTTCCGCTTTTACTTTAGG - Intergenic
1011051155 6:83151356-83151378 ATCTGGGTTCCTTCCACTTTGGG + Intronic
1014353258 6:120370875-120370897 ATAAGGGTCCTATTTATTTTTGG - Intergenic
1014489602 6:122045704-122045726 AGATGGGTCCATTATAATTTGGG + Intergenic
1016112530 6:140242882-140242904 ATATGTGTCACTTTGAATTTTGG - Intergenic
1016304268 6:142666986-142667008 ATGTGTGTCCCTTCTATTTTTGG - Intergenic
1018538109 6:164845557-164845579 ATAAGTGTCCCCTTTACTTTTGG + Intergenic
1018709521 6:166487957-166487979 AAATGGGTCCTTCTTTCTTTGGG + Intronic
1020731993 7:11892308-11892330 ATATGGGTCCCTTTGAGCTAAGG - Intergenic
1021539487 7:21741642-21741664 TTATGTGTCCCTCATACTTTAGG + Intronic
1022363217 7:29684335-29684357 ATTTGAGACCCTTTGACTTTTGG + Intergenic
1024067246 7:45750564-45750586 ATATGGGTTCTTTTTATTCTGGG - Intergenic
1024172625 7:46805817-46805839 ATATTTGTCCTTTTTAATTTTGG + Intergenic
1024408465 7:49010477-49010499 ATCTGTTTCCTTTTTACTTTTGG - Intergenic
1024777206 7:52801433-52801455 ATATGGGTCTCTGTCAGTTTGGG + Intergenic
1027750118 7:82132746-82132768 ATTTAGGCCACTTTTACTTTAGG + Intronic
1028859003 7:95626468-95626490 ATTTGGGTTGTTTTTACTTTTGG - Intergenic
1029862485 7:103588043-103588065 ATATTGGTTTCTTTTTCTTTGGG - Intronic
1030582535 7:111376236-111376258 TTATGGGGCTTTTTTACTTTTGG - Intronic
1030926406 7:115460816-115460838 ATCTGGGTTACTGTTACTTTTGG - Intergenic
1036584878 8:10114229-10114251 ATTTGGGTTCTTTTTACTATTGG + Intronic
1037427286 8:18770140-18770162 ACATCTGTCCCTTTTACTTTAGG + Intronic
1041704483 8:60831432-60831454 TTATGTGTGCCTTTTACTTTGGG - Intronic
1041814615 8:61955326-61955348 TTATGTTTCCCTTTTATTTTGGG - Intergenic
1045996509 8:108368064-108368086 ATTAGGGTCCATTTTCCTTTAGG + Intronic
1046337597 8:112810257-112810279 ATATTAGTTACTTTTACTTTGGG - Intronic
1048358813 8:133676662-133676684 ATATTGGTGACTTTTAATTTTGG - Intergenic
1049055747 8:140235822-140235844 ATGTGGGTGGTTTTTACTTTTGG - Intronic
1050383616 9:5059472-5059494 ATTTGGGTTGCTTTCACTTTGGG + Intronic
1050450105 9:5771437-5771459 ACTTGGGTTGCTTTTACTTTTGG + Intronic
1051415728 9:16838005-16838027 ATCTGGTTGCCTTTTCCTTTTGG - Intronic
1052629072 9:31013811-31013833 ATATGGGTGACTGTTTCTTTTGG - Intergenic
1053016032 9:34662686-34662708 ATCTGGGTGCCTTTTACCTGGGG + Exonic
1053467698 9:38322449-38322471 AATTAGGTGCCTTTTACTTTAGG - Intergenic
1054721015 9:68603857-68603879 ATATGGATACATTTTATTTTCGG + Intergenic
1055007241 9:71522064-71522086 ACCTGGGTCACTTTTACCTTTGG - Intergenic
1055287780 9:74747522-74747544 ATATGGGTGCCTTTTCCTGTAGG - Intronic
1055648363 9:78382421-78382443 AGAGGGCTCCCTTTGACTTTTGG - Intergenic
1055701176 9:78947503-78947525 ATTTGGATCCCTGTTACTTATGG - Intergenic
1060170352 9:121456297-121456319 TTAGGGGGCCCTTTTATTTTGGG - Intergenic
1061725928 9:132582079-132582101 ACTTGTGTCACTTTTACTTTGGG - Intergenic
1186917460 X:14238769-14238791 TTATGGTTACCTTTTACTTGTGG - Intergenic
1188764240 X:34072708-34072730 TTATAGGTTCATTTTACTTTTGG + Intergenic
1188876335 X:35434915-35434937 ATATAGGTTCCTTTTAAGTTGGG + Intergenic
1189175423 X:38952274-38952296 CGATGGCTCCCTTTTTCTTTTGG + Intergenic
1191954847 X:66633133-66633155 ATATGGTTAGCATTTACTTTTGG - Intronic
1194160711 X:90448848-90448870 ATTTGGGTCATTTCTACTTTTGG + Intergenic
1194777966 X:97989237-97989259 CAATGGATCCCTTTTACTCTTGG - Intergenic
1195070241 X:101272362-101272384 ATTTGGGTTGCTTTCACTTTTGG - Intronic
1200507001 Y:4025776-4025798 ATTTGGGTCATTTCTACTTTTGG + Intergenic
1201579946 Y:15500737-15500759 ATCTGGGTTGCTTTCACTTTAGG - Intergenic