ID: 976050456

View in Genome Browser
Species Human (GRCh38)
Location 4:81006118-81006140
Sequence GAACCATTCATGACCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976050452_976050456 1 Left 976050452 4:81006094-81006116 CCTTGAACATCCTCTTCATGCTA No data
Right 976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG No data
976050451_976050456 5 Left 976050451 4:81006090-81006112 CCTTCCTTGAACATCCTCTTCAT No data
Right 976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG No data
976050454_976050456 -9 Left 976050454 4:81006104-81006126 CCTCTTCATGCTAGGAACCATTC No data
Right 976050456 4:81006118-81006140 GAACCATTCATGACCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976050456 Original CRISPR GAACCATTCATGACCCTGTA GGG Intergenic
No off target data available for this crispr