ID: 976055771

View in Genome Browser
Species Human (GRCh38)
Location 4:81064192-81064214
Sequence AGATCAGTTTCTTGCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976055771_976055772 7 Left 976055771 4:81064192-81064214 CCACTTTTGCAAGAAACTGATCT No data
Right 976055772 4:81064222-81064244 TTTCTGAACATTTAGAATCTAGG No data
976055771_976055773 19 Left 976055771 4:81064192-81064214 CCACTTTTGCAAGAAACTGATCT No data
Right 976055773 4:81064234-81064256 TAGAATCTAGGTAGATATGCAGG No data
976055771_976055774 23 Left 976055771 4:81064192-81064214 CCACTTTTGCAAGAAACTGATCT No data
Right 976055774 4:81064238-81064260 ATCTAGGTAGATATGCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976055771 Original CRISPR AGATCAGTTTCTTGCAAAAG TGG (reversed) Intergenic
No off target data available for this crispr