ID: 976055774

View in Genome Browser
Species Human (GRCh38)
Location 4:81064238-81064260
Sequence ATCTAGGTAGATATGCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976055771_976055774 23 Left 976055771 4:81064192-81064214 CCACTTTTGCAAGAAACTGATCT No data
Right 976055774 4:81064238-81064260 ATCTAGGTAGATATGCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976055774 Original CRISPR ATCTAGGTAGATATGCAGGT AGG Intergenic
No off target data available for this crispr