ID: 976058915

View in Genome Browser
Species Human (GRCh38)
Location 4:81103320-81103342
Sequence CTTCATAAGACGGCCTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976058915_976058919 -3 Left 976058915 4:81103320-81103342 CCACAACAGGCCGTCTTATGAAG 0: 1
1: 0
2: 0
3: 0
4: 55
Right 976058919 4:81103340-81103362 AAGGTTATCAATGGCTCTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976058915 Original CRISPR CTTCATAAGACGGCCTGTTG TGG (reversed) Intronic
915708000 1:157864922-157864944 CTTCAGCAGAGGGCATGTTGAGG - Intronic
917053302 1:170949726-170949748 CTTCATCAGCAGGGCTGTTGGGG + Intronic
918845141 1:189600309-189600331 CCTCAGCAGACGGCCTATTGTGG - Intergenic
922360418 1:224816704-224816726 TTTTAACAGACGGCCTGTTGTGG - Intergenic
1064790682 10:18954764-18954786 CTTCATGACACAGCCTTTTGGGG + Intergenic
1068164501 10:53311395-53311417 CTTCCTAAGCCGGACTGTTTTGG + Intergenic
1071183155 10:83010247-83010269 CTTCAGCAGATGGCCTTTTGTGG - Intergenic
1075701130 10:124470087-124470109 CTTCAATAAAGGGCCTGTTGGGG - Intronic
1086776505 11:90841759-90841781 CTTCATAAGAGGGCTTGGTAAGG + Intergenic
1092020486 12:5198553-5198575 CTCCCTGAGACTGCCTGTTGTGG + Intergenic
1092277392 12:7072067-7072089 TTTCCTAAGACGCCCTGTTAGGG - Intergenic
1102061160 12:109932266-109932288 CTTCATGAGATGTCCTGTGGTGG + Exonic
1106028898 13:25980435-25980457 TTTGATAAGAAGGCCTGTAGGGG + Intronic
1113341484 13:109430347-109430369 CTTAATAAGACGGCCAAGTGTGG - Intergenic
1124110362 15:26779726-26779748 CTTGATAAGGTGACCTGTTGTGG + Intronic
1126571335 15:50155872-50155894 CTTCATTAGATGACCTATTGGGG - Intronic
1127838463 15:62809734-62809756 CTGCATCAGAGGGCCTGCTGTGG + Intronic
1129453567 15:75664117-75664139 CTTCAAAAGGCAGCCTGGTGCGG - Intergenic
1143215960 17:5225172-5225194 CTGCATAACACGGCCAGGTGCGG + Intronic
1148601699 17:48899212-48899234 CTTCAGAAGTCGACCTGTGGCGG + Intergenic
1153505007 18:5787966-5787988 CTTAATAAGAAGTCTTGTTGTGG - Intergenic
1167807964 19:51802244-51802266 CTACAGCAGACGGGCTGTTGAGG + Intronic
925355100 2:3235307-3235329 CTTCAGATGAAGGCCGGTTGAGG - Intronic
927730563 2:25467647-25467669 CTTTATAAGTCAGCATGTTGTGG - Intronic
927939601 2:27095305-27095327 CTTCTTAAGAAGGGCTGTGGGGG + Intronic
928037428 2:27837907-27837929 CTGCATATGAAGGCCTGGTGCGG + Intronic
928098330 2:28419516-28419538 CAACCTAAGACGGTCTGTTGGGG + Intergenic
939536213 2:143432802-143432824 CTTCAAAATACGACCTGGTGTGG + Intronic
943504990 2:188743840-188743862 CATCACAACAGGGCCTGTTGAGG + Intronic
947868816 2:233420824-233420846 GTACCTAAGACGTCCTGTTGTGG + Intronic
1176220326 20:63966613-63966635 CACCATCAGCCGGCCTGTTGGGG - Exonic
1182230274 22:28832526-28832548 AATCATAAGAAGGCCTGGTGCGG + Intergenic
1185050332 22:48550992-48551014 CATCATAAGATGGGCTGCTGTGG + Intronic
950358362 3:12430771-12430793 CTTCAAAATACAGCCTGTGGTGG - Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
966913985 3:184574957-184574979 CTCCATATGACTGCCTGTGGAGG - Intronic
970544244 4:17110772-17110794 CCTCTTAAAACGGTCTGTTGAGG + Intergenic
973791988 4:54386219-54386241 CTTCATACGAGGGCCCATTGGGG - Intergenic
976058915 4:81103320-81103342 CTTCATAAGACGGCCTGTTGTGG - Intronic
982661294 4:158210245-158210267 CTTCATAGGACAGCAGGTTGGGG - Exonic
992912775 5:81414684-81414706 CTTCAAAAGAAGGCCTAATGTGG + Exonic
995775645 5:115722440-115722462 CTTCATCAGACTGCATGTGGTGG + Intergenic
1005575186 6:27183627-27183649 ATACTTAAGACGGCCTATTGGGG - Intergenic
1009780558 6:68263424-68263446 TTTCATAAAACTGCCTGTTTTGG - Intergenic
1012385254 6:98673656-98673678 CTTCATAACATTTCCTGTTGTGG - Intergenic
1017949331 6:159122757-159122779 CTTCTTAAGACTGCATGTTAAGG + Intergenic
1018906225 6:168077804-168077826 GGTCATAAGAGGACCTGTTGTGG - Intronic
1027207849 7:76117066-76117088 ATTCATAAGACTGCCTGTAAAGG - Intergenic
1028178632 7:87687838-87687860 CTTCAAAAGATGGCCTCATGGGG - Intronic
1043344282 8:79281621-79281643 CTTCAAAAGATGACCTGTTAAGG - Intergenic
1048522349 8:135168554-135168576 CTTGATAAGAAGGCATGTTTGGG - Intergenic
1058901855 9:109449085-109449107 CTTCATAGGACAGCCTGTGCTGG - Intronic
1190202050 X:48370405-48370427 CTTCATAAGATTACCTATTGAGG + Intergenic
1190208488 X:48425008-48425030 CTTCATAAGATTACCTATTGAGG - Intergenic
1198225243 X:134639202-134639224 CTTAAGAAGATGGCCTTTTGAGG - Intronic
1199973738 X:152879204-152879226 CTTCAGAAAACGGCCAGCTGTGG + Intergenic