ID: 976063871

View in Genome Browser
Species Human (GRCh38)
Location 4:81161610-81161632
Sequence CTGTCAGTCAGTAAGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 13, 3: 64, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976063871_976063876 -5 Left 976063871 4:81161610-81161632 CCCATTTCCTTACTGACTGACAG 0: 1
1: 0
2: 13
3: 64
4: 343
Right 976063876 4:81161628-81161650 GACAGTGGGAACTGCTCATGAGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976063871 Original CRISPR CTGTCAGTCAGTAAGGAAAT GGG (reversed) Intronic
900715799 1:4142688-4142710 CTGGCAGCCAGGATGGAAATGGG - Intergenic
900788429 1:4664335-4664357 GTGCCAGGCAGCAAGGAAATTGG - Intronic
900994892 1:6115624-6115646 CTGACAGCCAGCAAGGAAATGGG + Intronic
901289639 1:8113952-8113974 CTGACAGGCAGCAAGGAAAGGGG - Intergenic
903688731 1:25153856-25153878 CTGACAGCCAGTAAGGAAATGGG - Intergenic
904312360 1:29637100-29637122 CTGGCAGTCAGCAAGGAAATAGG - Intergenic
904593611 1:31629008-31629030 CTGCCAGTCATGGAGGAAATGGG + Intronic
905506402 1:38483318-38483340 GTGTGAATCAGTAAGGAAATAGG + Intergenic
905808736 1:40896561-40896583 CTGAAAGACAGAAAGGAAATTGG - Intergenic
906007392 1:42487733-42487755 CTGACAGTCAGTGAGGAGATGGG + Intronic
908042539 1:60130164-60130186 CTGACAGCCAGCAAGGAAACAGG + Intergenic
908502541 1:64758589-64758611 CTGACAGCCAGCAAGAAAATAGG + Intronic
909277688 1:73709258-73709280 CTGTCATTTAATATGGAAATTGG - Intergenic
909610410 1:77546016-77546038 CTGACAATCAGGAAGGAAAGGGG - Intronic
909731732 1:78900184-78900206 CTCACAGCCAGCAAGGAAATGGG + Intronic
909780949 1:79546359-79546381 CTGACAGCCAGTAAGAAAATGGG + Intergenic
910914231 1:92272099-92272121 CTGACAGCCAGCAAGAAAATGGG + Intronic
911766931 1:101688543-101688565 CTGACAGCCAGCAAGGAAACAGG + Intergenic
915679092 1:157562801-157562823 CTGTCAGTCAGTTTGGAGAGTGG + Intergenic
916077886 1:161213251-161213273 ATGTCAGTCAGTAAGCAGAGAGG - Intronic
916602249 1:166304473-166304495 CTGACAGCCAGGAAGGAAACTGG - Intergenic
916793166 1:168142014-168142036 CTGCCAGCCAGCAAAGAAATGGG - Intergenic
917375136 1:174343992-174344014 CTGTCAGTCAGGGATGAAACAGG - Intronic
921280340 1:213560469-213560491 CTGACAGCCAGTAAGGAAAACGG + Intergenic
921952482 1:220945017-220945039 CTGTCAGTCAGGCAAGAACTAGG + Intergenic
922534398 1:226369162-226369184 TTCTCAGTCAGTAAGGAACAAGG + Intronic
922881723 1:228986124-228986146 CTGTCAGGCAGTAGGCATATCGG + Intergenic
922976189 1:229785401-229785423 GTGCCAGGCAGTTAGGAAATAGG + Intergenic
1063448464 10:6134978-6135000 CTGACAGCCAGCGAGGAAATGGG + Intergenic
1064006145 10:11700685-11700707 GTGTCCGTCAGTAGGGGAATGGG + Intergenic
1064893108 10:20202406-20202428 CTGAAAGTCAGTGAGGAATTCGG + Intronic
1066035944 10:31483986-31484008 CCTTCAGCCAGCAAGGAAATGGG - Intronic
1066554170 10:36592984-36593006 GTGACAGCCAGCAAGGAAATGGG + Intergenic
1067454238 10:46404863-46404885 CTGACAGCCAGCAAGGAAGTGGG - Intergenic
1067632965 10:47979769-47979791 CTGACAGCCAGCAAGGAAGTGGG + Intergenic
1067779940 10:49194434-49194456 CTGACTTTCAGTAAGCAAATGGG + Intergenic
1068691996 10:59926092-59926114 CTGACAGTCAGCAGAGAAATGGG + Intergenic
1069011176 10:63374690-63374712 ATGTCAAACATTAAGGAAATGGG + Intronic
1069803722 10:71103489-71103511 CTGTCCGTCAGTAAGGGATTGGG + Intergenic
1073172128 10:101519438-101519460 CTGACAGCCAGTAAGAAAATGGG - Intronic
1073780868 10:106837200-106837222 GTGTCATTCAGCATGGAAATTGG - Intronic
1074786181 10:116843513-116843535 ATATTAGTCAGTGAGGAAATGGG + Intergenic
1074967294 10:118502535-118502557 TTGTCATTCAGCAAGGAATTAGG + Intergenic
1075971751 10:126660490-126660512 CTAACAGCCAGTAAGAAAATGGG + Intronic
1076072587 10:127502826-127502848 CTGACAGGCAGCAAGGACATGGG + Intergenic
1078540332 11:12208000-12208022 CTGTCAGGCAGGAAGGAGAGAGG - Intronic
1079545918 11:21631719-21631741 CTGTCAGGCAGCAAGGAACAAGG + Intergenic
1079674687 11:23211603-23211625 CTGACAGCCAGCAAGGAAACAGG - Intergenic
1079724950 11:23869135-23869157 ATGTCAGTCAGTCAGGGAGTTGG + Intergenic
1080302808 11:30803272-30803294 CTGGCAGCCAGTAAGAAAAGAGG + Intergenic
1082798410 11:57395443-57395465 CTGACAGTCAGCAAGAAAACAGG + Intronic
1083028163 11:59568201-59568223 CTGACAGCCAGCAAGGAAATTGG + Intergenic
1083112068 11:60420585-60420607 TTGACAGCCAGCAAGGAAATGGG - Intergenic
1084193004 11:67507424-67507446 CTGTCAGTCATAGAGGAGATGGG - Exonic
1087715235 11:101601275-101601297 CTGTCAGTCATAGAGAAAATAGG + Intronic
1088341791 11:108776819-108776841 CTGACAGCCAGCAAGAAAATGGG + Intronic
1088400281 11:109416129-109416151 CTGACAGCCAGCAAGGAAATGGG - Intergenic
1089754425 11:120676083-120676105 CTGACAGCCAGCAAGAAAATGGG - Intronic
1090394783 11:126411689-126411711 CTGACAGCCAGCAAGGAAATGGG - Intronic
1090476168 11:127022807-127022829 ATGTCTGTCAATAAGGTAATGGG + Intergenic
1091110232 11:132959750-132959772 CTGGAAGGCAGAAAGGAAATTGG + Intronic
1091622047 12:2096423-2096445 CTGTCCTTCAGGAAGGAGATGGG - Intronic
1092347942 12:7731734-7731756 CTGTCACTTAGCAAAGAAATAGG - Intronic
1093660476 12:21750864-21750886 CTGTCAGTTGGTGGGGAAATGGG + Intronic
1093730022 12:22556636-22556658 CTGATAGCCAGGAAGGAAATGGG + Intergenic
1095400086 12:41804398-41804420 CCATCAACCAGTAAGGAAATGGG - Intergenic
1097408051 12:59215444-59215466 CTGACAGTCTGTAAGGAAATGGG + Intergenic
1097482428 12:60146612-60146634 GTGTCAGGGAGTGAGGAAATTGG - Intergenic
1098813883 12:75131726-75131748 CTGACAGCTAGTAAGGAAAGAGG + Intronic
1099657351 12:85510032-85510054 CTGACAGCCAGCAAGGAAACAGG - Intergenic
1100139541 12:91600264-91600286 CTCACAGCAAGTAAGGAAATGGG - Intergenic
1100896812 12:99191687-99191709 CTGTCAGGGAGTAGGGAACTAGG + Intronic
1102413371 12:112739522-112739544 CTGTCATTCCATATGGAAATGGG - Intronic
1103024707 12:117564081-117564103 CTGTCAGTCCCTAATGAATTTGG + Intronic
1104047172 12:125171651-125171673 CAGACAGCCAGCAAGGAAATGGG - Intergenic
1105616028 13:22013519-22013541 CTGACAGTCTGGAAGGAGATGGG - Intergenic
1106844044 13:33718474-33718496 CTGACTGCCAGCAAGGAAATGGG + Intergenic
1107396101 13:40019106-40019128 GTTTCAGTCAGTAAAGAAATAGG - Intergenic
1107421187 13:40248376-40248398 CTGACAGCCAGCAAGGCAATGGG + Intergenic
1107525108 13:41222696-41222718 CTGACTGTCAGCAAGGGAATGGG + Intronic
1109658442 13:65426737-65426759 CTGACAGCCAATAAGGAAACGGG - Intergenic
1109817350 13:67602604-67602626 TTGACAGTCAGCAAGAAAATAGG + Intergenic
1110274818 13:73631677-73631699 CTGACAGCTAGTAAGGAAATGGG + Intergenic
1110571587 13:77010670-77010692 CTGACAGCCAATAAGGAAACTGG + Intronic
1110751664 13:79122021-79122043 CTGTGAGTCAGGCAGTAAATGGG - Intergenic
1111186344 13:84741339-84741361 CTGACAGCCAGCAAGGAGATGGG - Intergenic
1111220811 13:85204538-85204560 CTGTGATTCAGTATGGACATTGG - Intergenic
1111231601 13:85351188-85351210 CTGACAGTCTGCAAGAAAATGGG + Intergenic
1111730491 13:92070181-92070203 CTGACAGCCAGCAAGGAAATGGG + Intronic
1112232321 13:97601810-97601832 CAGTCAGTCAGTCAGTCAATGGG - Intergenic
1112406929 13:99129290-99129312 CTGTACTTCAGTAAGTAAATGGG + Intergenic
1112657001 13:101462046-101462068 CTGACAGCCAGCAAGGAACTGGG - Intronic
1113215328 13:108033672-108033694 CTGTCAGCCAGAAAGGACTTGGG + Intergenic
1113342532 13:109440948-109440970 CAGTCAGGAAGTAAGGAAAATGG - Intergenic
1114220943 14:20695894-20695916 CTGTCATTCCTTAAGAAAATAGG + Intronic
1114738647 14:25070243-25070265 CTGACAGCCAGCAAGGAAACGGG - Intergenic
1115878724 14:37891603-37891625 ATGTCAGTCAGCAAGAAAATGGG + Intronic
1116370522 14:44124996-44125018 CTGACAGTCAGCAAGGAAACCGG - Intergenic
1117095724 14:52295482-52295504 CTGTCAATAATTATGGAAATGGG + Intergenic
1117278402 14:54213049-54213071 CTGTCAGGAAGAAAGGAAAAAGG - Intergenic
1117410244 14:55443818-55443840 TTGACAGCCAGCAAGGAAATGGG + Intronic
1117598536 14:57349183-57349205 CTGACAGACAGTAAGAATATGGG - Intergenic
1119276218 14:73358730-73358752 CAGTCAACCATTAAGGAAATAGG - Intronic
1120079753 14:80202581-80202603 CTGTCTTTCAGTAAGCCAATAGG + Exonic
1121288550 14:92755854-92755876 CTGACAGCCAGCAAGGAAATGGG + Intergenic
1121863846 14:97343948-97343970 CTGACAGTCAGTAAGGCAGCGGG + Intergenic
1123669103 15:22636827-22636849 CTGACGGCCAGCAAGGAAATGGG + Intergenic
1124229271 15:27928633-27928655 GTGACAGCCAGTAAGGAAACAGG - Intronic
1124525073 15:30443302-30443324 CTGACGGCCAGCAAGGAAATGGG + Intergenic
1124555150 15:30718538-30718560 CTTTCAGTCAGTAACCAATTGGG + Intronic
1124676102 15:31687145-31687167 CTTTCAGTCAGTAACCAATTGGG - Intronic
1124717357 15:32077186-32077208 ATGTCATTCAGTAGGTAAATGGG - Intronic
1124773581 15:32564411-32564433 CTGACGGCCAGCAAGGAAATGGG - Intergenic
1125091182 15:35794702-35794724 CAGAAAATCAGTAAGGAAATTGG - Intergenic
1125347588 15:38733681-38733703 CTGTCAGTGAGCCAGGAAGTGGG - Intergenic
1127894193 15:63280333-63280355 CTTTCAGGCAGTCATGAAATTGG + Intronic
1128949943 15:71868213-71868235 CTAATAGTCAGCAAGGAAATAGG - Intronic
1130350504 15:83087258-83087280 TTGTCAGCCAGTATTGAAATTGG - Intergenic
1130757127 15:86776212-86776234 CTGTCTCTCAGTAAAGAAAATGG - Intronic
1131198680 15:90378260-90378282 CTGATAGTCAGCAAGGAAACAGG - Intergenic
1131723769 15:95201210-95201232 ATGTCAGTCACCAAGAAAATGGG + Intergenic
1132812483 16:1808019-1808041 CAGTCAGTCAGTCAGTGAATAGG + Exonic
1133435298 16:5774230-5774252 CTGTCTGTCAGTAAGGTAATGGG - Intergenic
1138836923 16:60448725-60448747 CTGACAGCCAGTAAGGAAACAGG - Intergenic
1140766752 16:78166884-78166906 CTGTCAGTGGGAATGGAAATTGG - Intronic
1140817867 16:78637583-78637605 ATGTCAGTGAGTAAGGAAAGGGG - Intronic
1141257292 16:82414706-82414728 ATGACAGCCAGCAAGGAAATGGG - Intergenic
1141258071 16:82422134-82422156 CTGACAGCCAGCAAGGAAATGGG - Intergenic
1143061726 17:4207398-4207420 CTGACAGCCAGCAAGAAAATGGG + Intronic
1147036558 17:37685958-37685980 CTCTCAGTCACTAAGTGAATGGG - Intergenic
1150839484 17:68594680-68594702 CTGACAGCCAGCAAGGAAACAGG - Intronic
1150936046 17:69636869-69636891 CTGAAAGCAAGTAAGGAAATGGG - Intergenic
1151035099 17:70789641-70789663 CTGACAGTCAGCAAGGAAATGGG - Intergenic
1151555541 17:74844690-74844712 GGGTCAGTGAGCAAGGAAATAGG + Intronic
1153833943 18:8947752-8947774 CTGACAGCCAGTAAAGAAACAGG + Intergenic
1154058472 18:11034941-11034963 CTGTCTGGCAGTCAGGAAGTTGG - Intronic
1155317838 18:24590061-24590083 CTGATAGTCAGCAAGGAAACAGG + Intergenic
1155437008 18:25824114-25824136 CTGACAGCCAGCAAGGAAACAGG - Intergenic
1155831593 18:30522421-30522443 CTGACAGCCAATAAGGCAATAGG - Intergenic
1155974691 18:32116477-32116499 TTTTTAGTCAGTAAGAAAATTGG + Intronic
1156195795 18:34772943-34772965 CTGACAGCCAGCAAGGAAACGGG - Intronic
1156805993 18:41182984-41183006 TTGTCAGTTAGTAAGGATATAGG - Intergenic
1158044348 18:53137346-53137368 GTATCAGTCAGCAAGGACATGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158320007 18:56251933-56251955 TTGGCAGCCAGCAAGGAAATGGG + Intergenic
1159118400 18:64140973-64140995 CTGTCAGCCAGCAAGGCGATGGG + Intergenic
1159266247 18:66083751-66083773 CTTCCAGTGAGTAAGGAAATGGG + Intergenic
1159834321 18:73319077-73319099 CTGGCAGTCAGTAAGGTAATGGG + Intergenic
1159844351 18:73440531-73440553 CTGACAGCCAGTAAGGAAATGGG + Intergenic
1160063298 18:75551328-75551350 CTGACAGCCAGCAAGTAAATGGG - Intergenic
1161123376 19:2542455-2542477 CTGACAGCCAGCAAGGAAAGGGG + Intronic
1161752810 19:6110175-6110197 CGTTCAGTCAATAAGGAAAGTGG + Intronic
1161906854 19:7163200-7163222 CTGTCAGGGAGAAAGGAAATGGG + Intronic
1162184657 19:8895481-8895503 CTCTCAGTCAGTTTGGAAGTGGG + Intronic
1164270236 19:23666198-23666220 CTGTGAGGCAGATAGGAAATTGG + Intronic
1165398880 19:35584996-35585018 CTGACAGCCAGCAAGGAAACGGG - Intergenic
1167024164 19:46902639-46902661 GTTACAGTCAGTAAGGAAAATGG + Intergenic
926798248 2:16636541-16636563 CTGAAAGTCAGTAAGAAACTCGG - Intronic
927023650 2:19043297-19043319 CTGGCAGCCAGCAGGGAAATGGG - Intergenic
927817888 2:26236218-26236240 ATGTCAGTCAGTAGGAAAATGGG - Intronic
929108752 2:38388743-38388765 GTGTCATTTAGTATGGAAATTGG - Intergenic
929373625 2:41257181-41257203 CTGACAGCCAGCAAGCAAATGGG + Intergenic
932512714 2:72311346-72311368 CTGGCAGCCTGCAAGGAAATGGG - Intronic
932546157 2:72712526-72712548 CTGACAGCCAGCAAGAAAATGGG - Intronic
933087449 2:78074032-78074054 TTCTCAATCAGTGAGGAAATTGG + Intergenic
933992979 2:87646968-87646990 CTATCTGCCAGTAAGGAAAGTGG + Intergenic
936300877 2:111303911-111303933 CTATCTGCCAGTAAGGAAAGTGG - Intergenic
936348596 2:111694976-111694998 CTGCCAGCCAGTAGGAAAATGGG - Intergenic
936595732 2:113845753-113845775 ATGTCAGACAATTAGGAAATTGG + Intergenic
936717565 2:115206166-115206188 CTCATAGTCCGTAAGGAAATAGG - Intronic
936907894 2:117558180-117558202 TTGCCAGTCAGTAAACAAATTGG + Intergenic
937153991 2:119705468-119705490 CTGACAGCCAGCAAGAAAATAGG - Intergenic
937798061 2:126049087-126049109 CTGCAAGTCAGTAAGGGGATGGG + Intergenic
939380664 2:141431374-141431396 ATGACAGCCAGCAAGGAAATGGG + Intronic
939435688 2:142174545-142174567 CTCACAGTCAGAAAAGAAATAGG - Intergenic
939561215 2:143734238-143734260 CTGAAGGTCAGTAAGTAAATTGG - Intronic
939868344 2:147500012-147500034 CTGTCAATCAGTTAAGAATTAGG - Intergenic
940020619 2:149152712-149152734 GTGTCATTCAGTATGGAAATTGG + Intronic
940807146 2:158200481-158200503 CTGTCAATATGTAAGCAAATGGG - Intronic
940900973 2:159125894-159125916 CTGACAGCCAGTAAAGAAATGGG - Intronic
943026584 2:182636859-182636881 CTGACAGCCAGCAAGGAAATAGG - Intergenic
943033296 2:182711326-182711348 CTGTCTGACAGTAAGGAAACTGG - Intergenic
943564933 2:189506074-189506096 CTGACAGGGATTAAGGAAATGGG + Intergenic
944580259 2:201125966-201125988 CTGGCAGTCAGGAGGGAAAAAGG + Intronic
944851707 2:203726279-203726301 ATATCACTCAGTCAGGAAATTGG + Intronic
945447600 2:209956450-209956472 CTGACAGCCAGCCAGGAAATGGG - Intronic
945627278 2:212226194-212226216 CTGTTGGCCAGTAAGAAAATGGG + Intronic
945679891 2:212901483-212901505 ATGTCAGTCAGTAACTAAATTGG - Intergenic
946465202 2:219905668-219905690 CTGACAGCCAGCAAGGAAGTGGG - Intergenic
947082410 2:226413157-226413179 CTATCATTCAGTAATAAAATTGG - Intergenic
947274790 2:228378260-228378282 CTGACAGCCAGCAAGGAAATGGG + Intergenic
947322891 2:228942174-228942196 CAGTCAGTAAGTATAGAAATGGG + Intronic
947596483 2:231415232-231415254 CTGGCAGCCAGCAAGGAAATGGG + Intergenic
1169464670 20:5827013-5827035 CAGTCAAGCAGCAAGGAAATGGG - Intronic
1169485727 20:6030244-6030266 TTCCCATTCAGTAAGGAAATAGG + Intronic
1170062018 20:12269140-12269162 TCGTCATACAGTAAGGAAATGGG + Intergenic
1170252634 20:14302265-14302287 CTGACAGTCAGCAAGAAAACAGG - Intronic
1170725794 20:18925080-18925102 ATGTCTGTCATTAAGGTAATTGG + Intergenic
1173074807 20:39807518-39807540 CTGACAGCCAGTGAGGAAACAGG + Intergenic
1173085344 20:39910754-39910776 CTGACAGCCAGTGAGGAAACAGG + Intergenic
1173673240 20:44812147-44812169 CTGACAGCCAGCAAGGAAACAGG - Intergenic
1174942598 20:54947081-54947103 CTGACAGCCAGCAAGGTAATGGG - Intergenic
1175518980 20:59587711-59587733 CTGACAGCCAGCAAGAAAATAGG - Intronic
1175534983 20:59703811-59703833 CTTTCATTCAGTCAGTAAATTGG - Intronic
1175695487 20:61100044-61100066 CTTTCAGTCAGCCAAGAAATTGG - Intergenic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1177141143 21:17359477-17359499 CTGACAGCCAGTAAAGAAATGGG + Intergenic
1177188372 21:17822188-17822210 CTGGTAGCCAGCAAGGAAATGGG + Intergenic
1177368315 21:20168034-20168056 CTGACAGCCAGTGAGAAAATAGG + Intergenic
1177955517 21:27593579-27593601 CTGACAGCCAGCAAGGAAATTGG - Intergenic
1179155023 21:38842138-38842160 CTGACAGCCAGCAAGGAAACAGG + Intergenic
1180632499 22:17239419-17239441 CTGACAGCCAGCAAGGAAAGAGG + Intergenic
1181086886 22:20444202-20444224 CTGACAGCTAGCAAGGAAATGGG + Intronic
1181096792 22:20510609-20510631 CTAACAGCCAGTAAGGAAAGAGG - Intronic
1181930233 22:26394933-26394955 TTGTCAGTCAGTAAAAGAATGGG + Intergenic
1182983210 22:34692207-34692229 CTGTCAGTGGGAAAGTAAATTGG - Intergenic
1183763537 22:39848072-39848094 TTGCCAGCCAGCAAGGAAATGGG - Intronic
1185234944 22:49706384-49706406 GTGTCCATCAATAAGGAAATAGG + Intergenic
949436320 3:4033317-4033339 TTGACAGTCAGCAAGGAAACAGG + Intronic
951236202 3:20239772-20239794 CTGTAATTCAGGAAGGAAAATGG + Intergenic
951641221 3:24838092-24838114 CGGACAGCCAGCAAGGAAATAGG - Intergenic
951897710 3:27626134-27626156 CTGACAGCCAGCAAGGAAATGGG + Intergenic
951940866 3:28077574-28077596 CTGTCAGACAATATGAAAATAGG - Intergenic
953201048 3:40779082-40779104 CTCTGAATCAGAAAGGAAATAGG + Intergenic
954449569 3:50564339-50564361 GTGTCAGTCCCTAAGGATATGGG - Intronic
955452454 3:59084387-59084409 TTGTCAGTCAGCATGTAAATAGG + Intergenic
955471442 3:59290583-59290605 CTCACAGCCAGCAAGGAAATTGG - Intergenic
955639619 3:61068312-61068334 CTGACAGGCAATAAGGAAACAGG - Intronic
955958901 3:64318985-64319007 CTGACAATCAGCAAGAAAATGGG - Intronic
956134064 3:66081751-66081773 CTGACAGTCAGCAAAGAAGTGGG + Intergenic
956789041 3:72666555-72666577 CAGCTAGTAAGTAAGGAAATTGG - Intergenic
957514284 3:81230928-81230950 ATGTCAGTCAGTAAAGGAAGAGG - Intergenic
957668046 3:83262288-83262310 CTGTCAATGAGTCAGGAAAGAGG - Intergenic
959930155 3:111971748-111971770 CTGTCTGTCAGTGAGGGAAATGG + Intronic
960496405 3:118380788-118380810 CTGTGAGTCAGACAGGAAACTGG + Intergenic
960522470 3:118671340-118671362 CTGACAGCCAGCAAGGAAATGGG - Intergenic
960882451 3:122358837-122358859 CTGACAGTCAGCAAGGAAATGGG + Intergenic
961580408 3:127876064-127876086 CTGACAGCCAGTAAGGAAATGGG + Intergenic
961738553 3:129017553-129017575 CTGACAGCCGGCAAGGAAATAGG - Intronic
963122358 3:141787003-141787025 CTGACAGCCAGCAAGGAAACAGG + Intronic
963287946 3:143454794-143454816 CTGACAGCCAGAAAGGAAAAGGG - Intronic
963389795 3:144646423-144646445 CTGTCAGTCAAAATGTAAATTGG - Intergenic
964169529 3:153753181-153753203 CTTTCAGTCACTAAGGATAGAGG - Intergenic
964976900 3:162633060-162633082 CTGACAGCCAGTAAGAAAACAGG - Intergenic
965112080 3:164439301-164439323 CTGGAAGTCAGCAAGGAACTGGG + Intergenic
965651657 3:170939641-170939663 CTGACAGTAAGCAAGGAAACAGG - Intergenic
965982510 3:174710716-174710738 CTGATAGCCAGCAAGGAAATAGG + Intronic
966206033 3:177407494-177407516 CTGTCAATCAGTATCCAAATGGG + Intergenic
966591153 3:181684260-181684282 CTGTCAGAGAGTAATGAAAATGG - Intergenic
968937480 4:3619682-3619704 CTGACATTCATTAAGGAAAATGG - Intergenic
970000922 4:11365245-11365267 ATGTCAGCCAGCAAGGAAAGTGG + Intergenic
970992536 4:22229551-22229573 CTGACAGCCAGCATGGAAATGGG - Intergenic
971631422 4:28998335-28998357 ATGTTAGTCACTAAGAAAATGGG + Intergenic
972551611 4:40140420-40140442 CTGTGAGTCATTATGGTAATAGG + Intronic
973334603 4:48943224-48943246 CTGGCAGACAGCAAAGAAATGGG + Intergenic
973662839 4:53125774-53125796 CTGCCAGTCAGACATGAAATTGG - Intronic
974792249 4:66707307-66707329 CTGACAGCCAGTGAGGAAAAAGG - Intergenic
974978789 4:68926089-68926111 CTGTCATTCAGAATGGAAAATGG - Intergenic
975548351 4:75584344-75584366 CTGTTAGCCAGCAAGGAAATAGG + Intronic
976063871 4:81161610-81161632 CTGTCAGTCAGTAAGGAAATGGG - Intronic
977079931 4:92512451-92512473 CTGTCAGCCAGTAAAGAATCTGG + Intronic
978827200 4:113039738-113039760 CTCTCAGTAAGTAAGAAAATTGG - Intronic
980658834 4:135828812-135828834 CTGACAGTCAGCAAAGAAACAGG + Intergenic
981498532 4:145420907-145420929 CTATCAGCCAGCAAGGAAATGGG - Intergenic
982460604 4:155665258-155665280 CTGACAGTCAGAAAGGATAGAGG + Intergenic
983188989 4:164734559-164734581 CTGAAAGCCAGCAAGGAAATGGG - Intergenic
983420344 4:167508073-167508095 CTGACAGCCAGCAAGAAAATGGG - Intergenic
983718673 4:170817538-170817560 CTGACAACCAGCAAGGAAATGGG + Intergenic
984068206 4:175076918-175076940 CAGTCAATAAATAAGGAAATAGG + Intergenic
984068221 4:175077184-175077206 CAGTCAATAAATAAGGAAATAGG - Intergenic
985261721 4:188120507-188120529 TTGACAGTCAGCAAGAAAATGGG + Intergenic
986790601 5:11155737-11155759 CTGTCTGTCACTGAGGAAAAAGG - Intronic
986989438 5:13534744-13534766 CTGACAGACAGCAAGGAAATGGG + Intergenic
986990100 5:13542367-13542389 CTAACAGTCAGCAAGGAAACGGG - Intergenic
987517767 5:18935836-18935858 ATGGCAGCCAGCAAGGAAATGGG - Intergenic
987543282 5:19282775-19282797 CAGTCAGTCAGGAAGCAAAAGGG + Intergenic
987562917 5:19547485-19547507 CTGTCAGTCTGGAAGAAAATAGG + Intronic
987635479 5:20535225-20535247 CTGACAGTCAGCAAGCAAATCGG - Intronic
988452279 5:31355548-31355570 CTGACAGCCAGCAAGGAAACAGG - Intergenic
989069258 5:37493439-37493461 CTGACAGGCAGCAAGCAAATAGG + Intronic
989222020 5:38977169-38977191 CTGACAGCCAGTAAAGAAAAAGG + Intronic
989300389 5:39884739-39884761 CTGACAGCCAGCAAGGAAACAGG + Intergenic
989326417 5:40201221-40201243 CTGACAGCCAGCAAGGAAACGGG + Intergenic
989535032 5:42553342-42553364 CTGACAGCCAGCAAGGAAATGGG - Intronic
989828497 5:45887872-45887894 CTAACAGTCAGTAAGAAAGTGGG - Intergenic
991125473 5:63065326-63065348 CTGTCAAGGAGAAAGGAAATTGG + Intergenic
991178449 5:63719410-63719432 CTGACAACCAGTAAGGAATTGGG + Intergenic
992767684 5:80016152-80016174 ATGTCAATCAGAAAGGGAATTGG - Intronic
992780489 5:80122808-80122830 CTAACAGTCAGCAAGGAAAGAGG + Intronic
993127394 5:83852025-83852047 CTGACAGTCAGCAAGGAAACAGG + Intergenic
993752547 5:91688954-91688976 CTGTCACTAAGGAAGGACATTGG - Intergenic
994240231 5:97410838-97410860 GTGAGAGTCAGTAAGGACATGGG - Intergenic
995072256 5:107937827-107937849 CTGTCAGTCAGTATGCCATTAGG - Intronic
995404125 5:111774660-111774682 CTGACAGCCAGTAAGGAAATGGG + Intronic
995758005 5:115531799-115531821 CTCTCAGGCAGTACTGAAATGGG + Intronic
996015197 5:118525889-118525911 CTGACAGCCAGTAAGGAAATGGG + Intergenic
997315345 5:132929694-132929716 CGGTCAGTCAGTAATGAGAGAGG + Intronic
997801360 5:136865797-136865819 CTGCCAGTCACCAGGGAAATTGG - Intergenic
998649902 5:144106827-144106849 CTGACAGTCAGCAAGGAAATGGG + Intergenic
999514203 5:152284642-152284664 CTGTGAGGCAGTAAGGAAGCAGG + Intergenic
999801585 5:155043316-155043338 CTAACAGTCAGTGAGGAAATGGG - Intergenic
1003626679 6:7747487-7747509 CTGACAGCCAGCAAAGAAATGGG + Intronic
1003633928 6:7814004-7814026 CTGACAGTCAGCAAGAAAAGGGG - Intronic
1003699707 6:8448250-8448272 CTGACAGCCAGCAAGGAAACAGG - Intergenic
1004180552 6:13377449-13377471 CTGACAGCCAGCAAGGAGATGGG - Intronic
1005052080 6:21694320-21694342 CTCACAGCCAGTAAGTAAATTGG - Intergenic
1005070384 6:21856869-21856891 CTGACAGCCAGCAAGGAAGTGGG + Intergenic
1005499239 6:26415566-26415588 CTGTAAATCAGTAAGCAACTGGG - Intergenic
1005869626 6:29965120-29965142 GTGTGAGACAGAAAGGAAATGGG + Intergenic
1006698709 6:35954293-35954315 GTGTCAGTGAGGAAGGAAGTGGG + Intronic
1008161631 6:48083767-48083789 CTGACAGTCAGCAAAGAAATGGG + Intergenic
1008354963 6:50541886-50541908 CTGTCTGTCAGTAAGTTATTAGG - Intergenic
1010643882 6:78364079-78364101 TTGACAGCCAGCAAGGAAATGGG + Intergenic
1011431324 6:87289959-87289981 CTGGCAGTCTGCAAGGCAATTGG - Intronic
1011543496 6:88458941-88458963 CTGCCAGACAGAAAGTAAATCGG + Intergenic
1012616001 6:101281064-101281086 CTGACAGCAAGCAAGGAAATAGG - Intergenic
1012619128 6:101317621-101317643 CTGACATTCAGTAAGGAAAGAGG - Intergenic
1012806306 6:103898009-103898031 CTGCCAGCCAGCAAGGAAAGGGG - Intergenic
1013297746 6:108774718-108774740 CTGACAGTCAGCGAGGAAACTGG - Intergenic
1015081634 6:129232980-129233002 CTGACAAACAGCAAGGAAATGGG + Intronic
1015538996 6:134295863-134295885 CAGACAGTCAGTAAGGACATGGG + Intronic
1016722502 6:147318348-147318370 CTTTCAGTCAGTAAAAAAACTGG - Intronic
1016820884 6:148345103-148345125 TTTTCAGTCACTGAGGAAATTGG + Intronic
1017287245 6:152690187-152690209 CTGACAGCCAGCAAAGAAATGGG - Intergenic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017526925 6:155249292-155249314 CTGTCAGTCAGTCATGTACTGGG + Intronic
1018364601 6:163106168-163106190 CTGTCAATCAGTTAGTAAAAGGG + Intronic
1018522037 6:164660093-164660115 ATATCAATCAGAAAGGAAATCGG - Intergenic
1018524585 6:164694643-164694665 CTTTCAGTCAATACTGAAATAGG - Intergenic
1019754304 7:2757447-2757469 CTGCCAGCTAGTAAGAAAATGGG + Intronic
1020699088 7:11455177-11455199 CTGTCTGCAAGTCAGGAAATAGG + Intronic
1021816240 7:24449999-24450021 CTAACAGTCAGCAAGAAAATGGG + Intergenic
1022483889 7:30763026-30763048 CTGTCACTCTGAATGGAAATGGG + Intronic
1024867911 7:53925118-53925140 CTGACATCCAGTAAGGATATAGG - Intergenic
1025758207 7:64366055-64366077 CAGTAATTCAATAAGGAAATTGG - Intergenic
1026422925 7:70259216-70259238 CTGTCAGGAAGTAAGGTATTTGG - Intronic
1027598205 7:80202858-80202880 CTGTAAATCAGTATGGAGATGGG - Intronic
1027621545 7:80493479-80493501 CTGCCAGTCAATAATGAAATTGG - Intronic
1028566691 7:92240703-92240725 CTGTCATTAAGTAAAGAAATAGG + Intronic
1028689471 7:93635411-93635433 CTGGCAGACAGCAAGGAAATGGG + Intronic
1030513241 7:110511197-110511219 CTGAAAGCCAGCAAGGAAATGGG - Intergenic
1031263193 7:119549028-119549050 ATGTCAGTCAGTGAGGAACAAGG - Intergenic
1031335117 7:120519405-120519427 CTGACAGCCAGCAAGGAAACAGG + Intronic
1031632221 7:124057573-124057595 ATGCCAGTCAGTGTGGAAATTGG + Intergenic
1032644335 7:133805658-133805680 GTGACAGTCAGGAAGGAGATAGG + Intronic
1032662653 7:134002863-134002885 CTGCCAGTAAGTAAGCAAAATGG + Intronic
1032802265 7:135326077-135326099 TTGTCAGAGAGTAAGGAAATGGG - Intergenic
1034035419 7:147815401-147815423 TTGACAGCCAGCAAGGAAATAGG - Intronic
1035718856 8:1775604-1775626 CTTTCAGTAAGTGAGGAAAATGG + Intronic
1037708324 8:21334428-21334450 CTGACAGCCAGCAAGGAAACAGG + Intergenic
1039016711 8:33157559-33157581 CTGACAGCCAGCAAGAAAATGGG - Intergenic
1039073105 8:33663882-33663904 CTGGCAGCCAGCAAGGAAATGGG + Intergenic
1040279914 8:46034944-46034966 CTGTCAGCCAGGAATGAATTGGG + Intergenic
1040491176 8:47923748-47923770 CCGTCAGTCAGCAAGGAGACAGG + Intronic
1040575193 8:48645828-48645850 TTGTCAGTCTGTAAGGACAGTGG + Intergenic
1040744205 8:50620165-50620187 ATGACAGCCAGAAAGGAAATCGG - Intronic
1041300924 8:56410510-56410532 CTGACAGCCAGCAAAGAAATAGG + Intergenic
1042409050 8:68441325-68441347 CTGAAAGTCAGTCAGAAAATAGG - Intronic
1042935785 8:74056742-74056764 CTGGCAGTCAGTGAGGAAACAGG + Intergenic
1043085007 8:75819122-75819144 CTGACAGCCAGCAAGGAAAAAGG - Intergenic
1044264547 8:90166483-90166505 CTGATAGCCAGAAAGGAAATGGG + Intergenic
1044270689 8:90239703-90239725 CTGACAGCCAGCAAGGAAATGGG + Intergenic
1044765086 8:95563064-95563086 CTGTCAGCCAGAAAGGAAATGGG + Intergenic
1044942587 8:97358529-97358551 CTGTCAGTCACTAGGGGTATGGG - Intergenic
1047044529 8:121037290-121037312 CTGACAGTCAGTGAGAAAATGGG + Intergenic
1047689347 8:127335505-127335527 ATGGCAGCCAGCAAGGAAATGGG - Intergenic
1048608932 8:136000891-136000913 CTGGCAGCCAGCAAGGAAATAGG + Intergenic
1051244249 9:15093156-15093178 CTGACAGCCAGCAAGAAAATGGG - Intergenic
1052416508 9:28184767-28184789 CTTTCAGTAAGAAAGCAAATTGG + Intronic
1052778825 9:32759779-32759801 CTGTCAGTCAGAAACAAAAGGGG + Intergenic
1053461101 9:38272176-38272198 CAGCCAGTCAGTGAGGAAGTGGG - Intergenic
1053601067 9:39610007-39610029 CTGTCCATCAATAAGAAAATGGG + Intergenic
1053601774 9:39618210-39618232 CTGTCAGTCACCAATAAAATGGG + Intergenic
1053859426 9:42371981-42372003 CTGTCAGTCACCAATAAAATGGG + Intergenic
1054251761 9:62724236-62724258 CTGTCAGTCACCAATAAAATGGG - Intergenic
1054252468 9:62732431-62732453 CTGTCCATCAATAAGAAAATGGG - Intergenic
1054453676 9:65418011-65418033 CTGACATTCATTAAGGAAAATGG + Intergenic
1054565873 9:66758735-66758757 CTGTCAGTCACCAATAAAATGGG - Intergenic
1054566582 9:66766930-66766952 CTGTCCATCAATAAGAAAATGGG - Intergenic
1055330844 9:75181898-75181920 CTGACAGCCAGTAAGGAAGCCGG + Intergenic
1056078814 9:83068497-83068519 CTGACAGCCAGCAAGGAAATGGG + Intergenic
1057503158 9:95611670-95611692 CTGTCACACAGTTAGGAAAGAGG - Intergenic
1058607779 9:106742179-106742201 CTGGCAGCCAGCAAGAAAATGGG - Intergenic
1061662233 9:132137838-132137860 CTGTGAGTCAGGGACGAAATGGG - Intergenic
1062131728 9:134898553-134898575 CTGACAGCCAGCAAGAAAATGGG - Intergenic
1186594418 X:10965274-10965296 CTGACAGCCAGCAAGGAAACGGG + Intergenic
1186920523 X:14274128-14274150 CTGTCAGTAAGGAATGGAATTGG + Intergenic
1187434398 X:19253682-19253704 CAGTCAGTGTGCAAGGAAATCGG - Intergenic
1189538978 X:41966499-41966521 CTGACAGCCAGCAAGGAAATGGG + Intergenic
1189806776 X:44743172-44743194 CTGACAGCCAGCAAGGAAATGGG + Intergenic
1190089596 X:47426248-47426270 CTGACAGCCAGCGAGGAAATGGG - Intergenic
1190118613 X:47642093-47642115 CTGACAGACAGTAAGGAAACAGG + Intronic
1190170740 X:48109824-48109846 CTGCCCGTGAGTAAGGACATGGG - Intergenic
1190191062 X:48277727-48277749 CTGTCCCTGAGTAAGGACATGGG + Intergenic
1190200300 X:48355396-48355418 CTGTCCCTGAGTAAGGATATGGG + Intronic
1190388189 X:49904506-49904528 CTGGTATTCAGTAATGAAATAGG + Intergenic
1190657501 X:52624827-52624849 CTGTCCCTGAGTAAGGACATGGG - Intergenic
1190667115 X:52705898-52705920 CTGTCCCTGAGTAAGGATATGGG + Intronic
1190672303 X:52752510-52752532 CTGTCCCTGAGTAAGGATATGGG - Intronic
1191951753 X:66600444-66600466 CTTACAGCCAGCAAGGAAATGGG + Intronic
1192863831 X:75108217-75108239 CTGTCTGTGAGTCAGGAACTAGG - Intronic
1194504897 X:94722410-94722432 CTGACAGTGAGCAAAGAAATGGG + Intergenic
1194573731 X:95585464-95585486 CTGACAGACAGCAAGGAAGTGGG - Intergenic
1194579930 X:95659457-95659479 CTGACAGCCAGCTAGGAAATGGG + Intergenic
1194911570 X:99651143-99651165 CTGACAGCCAGTAAATAAATGGG - Intergenic
1195222979 X:102763914-102763936 CTGACAGTCATCAAGGAAATGGG + Intergenic
1195247942 X:103013401-103013423 CTGACAGCCAACAAGGAAATGGG - Intergenic
1196019850 X:110979990-110980012 CAGACAATCAGCAAGGAAATGGG - Intronic
1196195517 X:112834983-112835005 ATTACAGTCAGTAAGGCAATGGG + Intronic
1196401800 X:115324475-115324497 CTGACAGCCAGCAAGGAAACGGG - Intergenic
1196624686 X:117864831-117864853 CTGACAGCCAGAAAGGAAATGGG - Intergenic
1196668131 X:118337854-118337876 CTGATAGTCAGCAAAGAAATGGG - Intergenic
1196804515 X:119572718-119572740 GTGGCAGCTAGTAAGGAAATAGG + Intergenic
1196940908 X:120774955-120774977 CTGACAGACAGCAAGGAAACAGG - Intergenic
1197006109 X:121500493-121500515 CTGAGAGTCAGTAAAGAAATAGG + Intergenic
1199785471 X:151101372-151101394 CTGACAGCCAGCAAGAAAATGGG + Intergenic
1199799499 X:151235620-151235642 CTGTTAGTCAGTAACAAACTGGG + Intergenic
1199840630 X:151643945-151643967 CTGTCAGTCAGAGATGAGATTGG + Intronic
1200411593 Y:2867275-2867297 TTGTCAGTCAGCAAGGAAAAAGG - Intronic
1201384440 Y:13423654-13423676 GTGTCAGTAAATAATGAAATTGG + Intronic
1202051103 Y:20781624-20781646 CTGCCAGTCAGCAAGGAAACAGG - Intergenic