ID: 976064154

View in Genome Browser
Species Human (GRCh38)
Location 4:81164620-81164642
Sequence CACACCTAACACTCTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976064154_976064168 25 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064154_976064165 21 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064165 4:81164664-81164686 GTTTCCGATTCAGTAAGTGTGGG 0: 1
1: 2
2: 37
3: 322
4: 1024
976064154_976064166 22 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064166 4:81164665-81164687 TTTCCGATTCAGTAAGTGTGGGG 0: 1
1: 1
2: 35
3: 264
4: 768
976064154_976064164 20 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064164 4:81164663-81164685 AGTTTCCGATTCAGTAAGTGTGG 0: 1
1: 3
2: 40
3: 324
4: 1115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976064154 Original CRISPR CACACCTAACACTCTAATGG TGG (reversed) Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
906570398 1:46833110-46833132 CACACCTAACACTCAGATCTTGG - Intergenic
908041043 1:60113623-60113645 CACACCTAATACTATTCTGGGGG - Intergenic
908674779 1:66591554-66591576 CCCCCTTCACACTCTAATGGGGG - Intronic
910795243 1:91091307-91091329 CACACCTAACAGTCTTAGGGTGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
924239397 1:242026536-242026558 CACACAAAAAACTCTAATGCTGG - Intergenic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1065283454 10:24164441-24164463 GACAGCTTACACTCTATTGGAGG - Intronic
1068854685 10:61785362-61785384 CTCACCTAACCCTCTAACTGGGG + Intergenic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG + Intronic
1092360897 12:7835405-7835427 TACACCTAATACTTTAATGTAGG + Intronic
1093357453 12:18184904-18184926 CACACGTATCACACTAATGTAGG - Intronic
1100163437 12:91889113-91889135 CACACCTAACTCTCCAATTGTGG + Intergenic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1104873076 12:132014615-132014637 CACACCTCACTCTCTGCTGGGGG + Intronic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1107895078 13:44953784-44953806 TATACCTAGCACTCTAATTGTGG - Intronic
1110956918 13:81564428-81564450 CACACGTACCACTCTCATGGGGG - Intergenic
1112501724 13:99948037-99948059 CCGACCTAACACTTTAAGGGGGG - Intergenic
1115389729 14:32841407-32841429 CACACCTAACACTAAAATCTTGG - Intergenic
1123721389 15:23064637-23064659 GACCCCCAACACTCCAATGGGGG - Intergenic
1131664068 15:94551102-94551124 CAGAGCTCACTCTCTAATGGGGG + Intergenic
1131665041 15:94561332-94561354 CAAACCTAAAAAGCTAATGGAGG - Intergenic
1131688920 15:94805526-94805548 CACACATAATACTTTAATGTTGG + Intergenic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1144365976 17:14545356-14545378 CACAGCAAACACACAAATGGAGG - Intergenic
1156908669 18:42384980-42385002 CAAACCTAACACTCAAATATAGG + Intergenic
1157241766 18:46016563-46016585 CAGACCTCAGAGTCTAATGGAGG + Intronic
1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG + Intergenic
939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1168982117 20:2014109-2014131 CACACCTCCAACTCTAATTGTGG - Intergenic
1169309744 20:4525573-4525595 CACACCCAATAATCTAATTGTGG + Intergenic
1174295739 20:49543802-49543824 CACAGCTGACACTCCAGTGGGGG - Intronic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1182867299 22:33614783-33614805 CACAGCTGACAGTCTCATGGAGG - Intronic
957593856 3:82234744-82234766 CAGACCTTACAATCTAATGAAGG - Intergenic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
958489577 3:94754534-94754556 TCCACCTGAAACTCTAATGGAGG + Intergenic
961317757 3:126052206-126052228 CACACCTCACAGTCTCCTGGTGG + Intronic
962070628 3:132030085-132030107 TCCTCCTAACACTCTAATGGAGG + Intronic
966404870 3:179586082-179586104 CACACCTAACACTATAAATCTGG - Intronic
966435394 3:179878079-179878101 TATACTTAACAGTCTAATGGAGG + Intronic
966595909 3:181724776-181724798 CAGTCCAAACACTCTATTGGAGG + Intergenic
967147468 3:186618221-186618243 CACTCCTATCAGTCTAATGCTGG + Intronic
968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG + Intronic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
972087069 4:35231283-35231305 CTTACCTTACACTCTAATCGCGG - Intergenic
972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
974104373 4:57452628-57452650 AACACCTAAAACTGTAATGGTGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978731710 4:112035363-112035385 CAACCCTAACACACTATTGGTGG + Intergenic
981659407 4:147148236-147148258 CACACCTAACACTCACATCTTGG - Intergenic
981914472 4:150018594-150018616 AACAGTTAACACTGTAATGGAGG + Intergenic
984062441 4:175006958-175006980 CACTCCTAACACTCCACTGAAGG + Intergenic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
992936992 5:81718029-81718051 CACACCTAGCATCCTAAGGGCGG - Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
995622025 5:114036679-114036701 CACATCGAACACTATAATGAAGG - Intergenic
995818405 5:116198478-116198500 CAAACATATCACTCTAATAGGGG - Intronic
1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG + Intronic
1000224770 5:159249904-159249926 CAAACGTACCACTCCAATGGGGG - Intergenic
1005166447 6:22927286-22927308 CATACCTAACAGTTTAATGCTGG - Intergenic
1008006750 6:46418559-46418581 CACACCAGACACTCTACAGGTGG + Intronic
1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG + Intronic
1013531401 6:111022185-111022207 CAAACATAACATTCTAATTGAGG + Intronic
1014981063 6:127946933-127946955 CATACCCATCACTCTAATGAGGG - Intergenic
1016551780 6:145289205-145289227 CTCACCTAAGACTCTAAAGCAGG + Intergenic
1024905050 7:54368221-54368243 TACAGCTAACAATCTAATGGAGG + Intergenic
1030649984 7:112107141-112107163 AATACCTCACAATCTAATGGGGG + Intronic
1030819540 7:114079130-114079152 CAAACCTCACATTCTAATGAAGG - Intergenic
1032488342 7:132305302-132305324 CACACTGAACACTGTAGTGGAGG - Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1043232684 8:77822694-77822716 CACACCCAACTCACTATTGGTGG + Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1044758723 8:95494200-95494222 CTCACCTAAAAAACTAATGGAGG - Intergenic
1047030403 8:120872927-120872949 CACACCTAATAAGCCAATGGTGG - Intergenic
1048388157 8:133933021-133933043 CACACCTAACACTCAGATCTTGG - Intergenic
1048514918 8:135097463-135097485 CTCAACCAACACCCTAATGGGGG - Intergenic
1051540953 9:18216971-18216993 AACTCCCAACAATCTAATGGAGG - Intergenic
1052892756 9:33719531-33719553 CACACCTAACGCTCTACTGCTGG - Intergenic
1055322665 9:75097678-75097700 CAAACATAAAAGTCTAATGGGGG + Intronic
1060494297 9:124106602-124106624 AAAACCTCACACTCTAATGAAGG - Intergenic
1186434404 X:9530850-9530872 CACATCTAAAAATGTAATGGAGG - Intronic
1189115282 X:38335937-38335959 CAGACTTAACACTCTAAAAGGGG - Intronic
1200136328 X:153876595-153876617 CAGACCTAAAAAGCTAATGGGGG + Intronic