ID: 976064164

View in Genome Browser
Species Human (GRCh38)
Location 4:81164663-81164685
Sequence AGTTTCCGATTCAGTAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 3, 2: 40, 3: 324, 4: 1115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976064154_976064164 20 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064164 4:81164663-81164685 AGTTTCCGATTCAGTAAGTGTGG 0: 1
1: 3
2: 40
3: 324
4: 1115
976064153_976064164 21 Left 976064153 4:81164619-81164641 CCCACCATTAGAGTGTTAGGTGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 976064164 4:81164663-81164685 AGTTTCCGATTCAGTAAGTGTGG 0: 1
1: 3
2: 40
3: 324
4: 1115
976064156_976064164 17 Left 976064156 4:81164623-81164645 CCATTAGAGTGTTAGGTGTGGAT 0: 1
1: 0
2: 2
3: 7
4: 107
Right 976064164 4:81164663-81164685 AGTTTCCGATTCAGTAAGTGTGG 0: 1
1: 3
2: 40
3: 324
4: 1115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976064164 Original CRISPR AGTTTCCGATTCAGTAAGTG TGG Intronic
900361492 1:2291269-2291291 ATTTTCGGATTCCGAAAGTGAGG + Intronic
900829154 1:4951878-4951900 AGTTTTCAATTCAGTATGTCTGG - Intergenic
900899883 1:5509201-5509223 AGTTTCTGACTCAGCAGGTGTGG - Intergenic
901149728 1:7093214-7093236 GGTTTCTGATTCAGCAGGTGCGG + Intronic
901587516 1:10310258-10310280 AGTTTCTGATTCACTAGGTCTGG + Intronic
902182037 1:14696706-14696728 AGTTTCTGATTCAGCAGGTCTGG + Intronic
902186138 1:14726791-14726813 AGTTTCTGATTCAGCAGGTCTGG - Intronic
902216119 1:14935525-14935547 AGTTTCTGATTCTGTAGGTCCGG - Intronic
902471861 1:16653450-16653472 AGCTTCTGATTCATTAAATGTGG + Intergenic
902486943 1:16753994-16754016 AGCTTCTGATTCATTAAATGTGG - Intronic
902563249 1:17291875-17291897 AGTTTCTGATTCAGAAGGTGTGG - Intergenic
902766090 1:18616367-18616389 AGTTTCTGATTCAGTAGGCATGG + Intergenic
902827999 1:18990263-18990285 AGTTTCCAATTCAGTTCCTGAGG - Intergenic
902831475 1:19016208-19016230 GGTTTCTGATTCAGTAGGTCTGG - Intergenic
902959460 1:19952369-19952391 AGTTTCTAATTCAGTAAGTGTGG - Intergenic
902984464 1:20147214-20147236 AGTATCAGATTCAGTAGGTCTGG - Intronic
903050431 1:20596407-20596429 AGTTTCTGATTCAATAGGTCTGG - Intronic
903132378 1:21288854-21288876 AGTTTCCACATCTGTAAGTGGGG + Intronic
903300057 1:22372397-22372419 AGTTTCTGATTCAGTGGGTCCGG - Intergenic
903631875 1:24780709-24780731 AGATTCCGATTCAGTAAATCTGG - Intronic
903695686 1:25204903-25204925 AGCTTCTGATTCAGTAGGTCTGG + Intergenic
903831843 1:26180165-26180187 AGTTTCTGATTCAGCAGGTGTGG + Intronic
903912686 1:26739372-26739394 AAATTCTGATTCAGTAGGTGTGG + Intronic
904109265 1:28112690-28112712 AGTTTCTAATCCAGTAGGTGTGG + Intergenic
904683617 1:32245656-32245678 AGTTTCAGATTCAGTATGTATGG - Intergenic
904798329 1:33074266-33074288 AGTTTCTGATTCAATAGGTTTGG - Intronic
904974058 1:34442515-34442537 AGTTTCTGATTCAGTGCGTGTGG + Intergenic
905461395 1:38125210-38125232 AATTTCTGATTCAGTAGGTCTGG + Intergenic
905954330 1:41979393-41979415 AGTTTCCTCCTCAGTAAATGGGG - Intronic
906943287 1:50274451-50274473 AGTTTCCTAATCAGTAAATATGG - Intergenic
907086206 1:51677177-51677199 AGTTTCTGATTCAGCAAGTGAGG - Intronic
907245390 1:53105390-53105412 AGTTTCCTCTTCAGGAAGTGGGG + Intronic
907253890 1:53163394-53163416 AGCTTCTGATTCAGTGGGTGCGG + Intergenic
907553972 1:55328738-55328760 AGATTCTGATTCAGTAGGTCTGG + Intergenic
907634908 1:56124660-56124682 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
907717946 1:56945133-56945155 AGATTCTGATTCAGTAGGTTTGG - Intronic
907922624 1:58927902-58927924 AGTTTCTGATTCAGTCAGTCTGG - Intergenic
907936364 1:59045850-59045872 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
907947870 1:59152166-59152188 AGTTTCTGATTTAGTAGGTCTGG + Intergenic
907952572 1:59197779-59197801 AGTTTCTGATTCAGTGAGTCTGG + Intergenic
908046335 1:60173555-60173577 AATTTCTGATTCAGCAAGTGTGG + Intergenic
908391789 1:63689836-63689858 AGATTCCGATTCAGTAAGTCTGG + Intergenic
908404471 1:63800690-63800712 AGTGTCTGATTCAGTAAGTCTGG - Intronic
908784453 1:67721414-67721436 AGTTTCTGATTCAGTAGATCTGG - Intronic
908959626 1:69680173-69680195 AGTTTCTGATTCAGTAGGTGTGG - Intronic
909323377 1:74318310-74318332 AGATTCTGATTCAGTAATTCTGG + Intronic
909414985 1:75396035-75396057 AGATTCTGATTCAATAAGTCTGG + Intronic
909621480 1:77672554-77672576 AGTTTCAGATTTAGTACGTCAGG - Intronic
909688559 1:78378569-78378591 AGGTTCTGATTTAGTAAGTCTGG + Intronic
910059293 1:83069101-83069123 AGTCTCTGATTCAGCAAGTCTGG - Intergenic
910235120 1:85027573-85027595 AGTTTCTGATTCAGTGGGTCTGG - Intronic
910241547 1:85092115-85092137 AGGTTCTGACTCAGTAAGTCGGG + Intronic
910372379 1:86530604-86530626 AGATTCTGATTCAGTAGGTCTGG + Intergenic
910413993 1:86978453-86978475 AGTTTTCTATTTAGTAAGTCTGG + Intronic
910474150 1:87589027-87589049 AGTTCCTGATTCAGTAGGTCTGG - Intergenic
910593741 1:88955774-88955796 AGTTTCTGATTCAGTAGGTCTGG - Intronic
910654594 1:89606840-89606862 AGTTTCCTCTTCAGTAAATGAGG + Intergenic
910792620 1:91066812-91066834 AGATTCTGATTCAGTAGGTCTGG + Intergenic
911350660 1:96750106-96750128 AGTTTCTTATTCAGTAGGTCTGG + Intronic
911417136 1:97589028-97589050 AGTTGCTGATTCAGTAAGTCTGG - Intronic
911477589 1:98392361-98392383 AGTTTCAAATTCAGTAGGTATGG + Intergenic
911637651 1:100253084-100253106 AGATTCTAATTCAGTAAATGTGG + Intergenic
911663889 1:100532972-100532994 AATTTCCGATTCAGGGGGTGGGG + Intergenic
911717260 1:101147400-101147422 AGTTTCCAATTCAATAAATCTGG + Intergenic
911758932 1:101593956-101593978 AGATTCTGATTCAGTAGGTAGGG + Intergenic
911903475 1:103534326-103534348 AGTTTCTGATTCAGTAAGACTGG - Intronic
913047473 1:115086873-115086895 AGTTTCTGATTCAGCAAGTCTGG + Intronic
913062208 1:115218916-115218938 AGATTCAGATTCAGTAGGTCTGG + Intergenic
913122536 1:115754962-115754984 AGTTTCTGATTCAGCAGGTCTGG + Intronic
913190866 1:116411885-116411907 AGTTTCTGACTCAGTAGGTCTGG - Intergenic
913366538 1:118045846-118045868 AGTTGCAGATTCAGTCGGTGTGG + Intronic
913407235 1:118508457-118508479 AGATTCTGATTTAGTTAGTGTGG - Intergenic
913439952 1:118886742-118886764 AGTCTCTGATTCTGTAAGTCTGG + Intronic
913454580 1:119018295-119018317 AGCTTCTCATTCAGTAGGTGTGG + Intergenic
913964430 1:143363672-143363694 AGTTTCTGATTTAGTAGGTCTGG - Intergenic
914058799 1:144189278-144189300 AGTTTCTGATTTAGTAGGTCTGG - Intergenic
914120350 1:144777093-144777115 AGTTTCTGATTTAGTAGGTCTGG + Intergenic
914344152 1:146783791-146783813 AGGTTCCGATTCCGTAGGTCTGG + Intergenic
914387161 1:147180877-147180899 AGTTTCTGATTCTGTAAGTCTGG + Intronic
914421055 1:147528716-147528738 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
914436985 1:147669523-147669545 AGATTCTGATTCAGCAGGTGTGG - Intronic
914666195 1:149834999-149835021 AGTTTCTCATTCAGTAGGTCTGG - Intergenic
914669570 1:149858795-149858817 AGTTTCTCATTCAGTAGGTCTGG + Intronic
914876795 1:151518311-151518333 AGCTTCTGATTCAGTAGGTCTGG - Intronic
915422942 1:155799609-155799631 AGATTCTGATTCAGTAGGTAAGG + Intronic
915602092 1:156928897-156928919 AGTTTCCTCATCTGTAAGTGGGG + Intronic
915807677 1:158871550-158871572 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
916265298 1:162884598-162884620 AGTTTCTAATTCAGTAGGTCTGG + Intergenic
916274902 1:162983220-162983242 AGTTTCTGACTCACTAGGTGGGG - Intergenic
916308036 1:163361663-163361685 AGAGTCTGATTCAGTAAGTTGGG + Intergenic
916561418 1:165936816-165936838 AGTTTCTGAATCAGTGAGTCTGG - Intergenic
916875368 1:168963128-168963150 AGATTCTGATTCAGTACGTTTGG + Intergenic
917045185 1:170851833-170851855 AGTTTCTCATTCAGCAGGTGGGG + Intergenic
917450321 1:175142565-175142587 AGTTTCCGGTTCTGTAGGTCTGG + Intronic
917486534 1:175459968-175459990 CTTTTCCGATTCAGCATGTGTGG + Intronic
917634847 1:176925429-176925451 AGATTCTAATTCAGTAAGTCTGG - Intronic
917748760 1:178036141-178036163 AGCTTCTGATTCAGTAGGTCTGG - Intergenic
917772570 1:178295667-178295689 AGTTTCTGATGCAGTAGGTCTGG + Intronic
917795746 1:178531735-178531757 AGATTCTGATTCAGTAGGTCTGG - Intronic
917924808 1:179780605-179780627 AGTTTCTGATTCAGCAGGTCTGG - Intronic
918260608 1:182792220-182792242 AGTTTCCCCTTCTGTAAATGAGG - Intronic
918420762 1:184362202-184362224 AATTTCTGATTCAGTAGGTTTGG - Intergenic
918468090 1:184842312-184842334 AGTTTCTGATTCAATAGGTCTGG + Intronic
919034731 1:192292421-192292443 AGTTTCTGATTCAGTAGGTTTGG - Intergenic
919090560 1:192974038-192974060 AGATTCCGTTTCAGTAGGTCAGG - Intergenic
919939152 1:202274615-202274637 AGGTTCTGATTTAGTAAGTCTGG + Intronic
920971846 1:210749553-210749575 AGGTTCCAATTCAGTAGGTCAGG - Intronic
921215528 1:212933715-212933737 AGATTCTGATTCAGTGAGTCTGG - Intergenic
921286267 1:213612153-213612175 AGATTCAGATTCAGTAGGTCTGG - Intergenic
921315847 1:213889622-213889644 AGTTTCTGTTTCAGAAAATGTGG + Intergenic
921578212 1:216863146-216863168 AGTTTCTGATTCAGTAGGCCTGG + Intronic
921834015 1:219759455-219759477 AGTTTCAGATTAAGTATGTCTGG - Intronic
921913406 1:220577572-220577594 AGTTTCATATTCAGTAGGTCTGG + Intronic
922063056 1:222109904-222109926 AGTTTCAGATTCAGTAGGTCTGG - Intergenic
922523010 1:226273699-226273721 AGTTTCTGATTCAGAAGGTCTGG - Intronic
922662208 1:227439868-227439890 AGTTTCTGATTCAGTAATAATGG - Intergenic
923861713 1:237898342-237898364 AGTTTCTGATTCAGGAAATGTGG - Intergenic
924063049 1:240196450-240196472 AGTTTCCAGTTCAGTAGGTCTGG - Intronic
924098738 1:240582021-240582043 AGTGTCTGATTCAGGAAGTCTGG + Intronic
924612462 1:245585150-245585172 AGTTTCTGATTCAGTGGGTCTGG - Intronic
924737718 1:246773482-246773504 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1063274538 10:4550790-4550812 AGTTTCTGAGTCAGTAGGTCTGG - Intergenic
1063350863 10:5353501-5353523 AGATTCCTCATCAGTAAGTGAGG - Intergenic
1063398001 10:5710198-5710220 AGTTTCCTGTTCAGTAAATGAGG - Intronic
1063480991 10:6376310-6376332 AGGTTCTGATTCAGTAGGTCTGG + Intergenic
1063686942 10:8246000-8246022 AGTTTCTGATTTAGTATGTCTGG + Intergenic
1063743762 10:8856251-8856273 AGTAACAGAGTCAGTAAGTGTGG - Intergenic
1064392808 10:14956169-14956191 AGTTTCTGATTCACTAGGTTTGG - Intergenic
1064468746 10:15613568-15613590 AGATTTGGATTCAGTAAGTCTGG - Intronic
1064818515 10:19295851-19295873 AGTTTCTGATTTAGTAGGTCTGG + Intronic
1064847818 10:19675530-19675552 AGTTTCTGATTCATTAAGTCTGG - Intronic
1065242215 10:23718069-23718091 AGCTTATGATTCAGTAGGTGTGG + Intronic
1065422946 10:25567417-25567439 AGTTTCAGAGTCAGTAGGTCTGG + Intronic
1065476581 10:26144834-26144856 AGTTTCTGACTCAGTAGGTTTGG - Intronic
1065636439 10:27741008-27741030 AGTTTCGGATTCAGCAGGTCTGG - Intronic
1065858559 10:29850873-29850895 AGTGTCTGATTCAGTAGGTCTGG - Intergenic
1067190644 10:44065113-44065135 GGTTTCTGATTCAGCAGGTGTGG + Intergenic
1067568341 10:47353849-47353871 AGCTTCTGAGTCAGTAAGAGGGG - Intronic
1067717401 10:48699972-48699994 AGTTTACAAGTCAGTAAGTCTGG - Intronic
1067740475 10:48891676-48891698 AGTTTCTAATTCAGTAGGTCTGG + Intronic
1067938681 10:50634013-50634035 AGTTTCTGATTCAGTAGGTCCGG - Intergenic
1067974301 10:51006900-51006922 AGGTTCTGATTCAGTAGGTCTGG + Intronic
1068090754 10:52429808-52429830 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1068476005 10:57526278-57526300 AGTTTCTGATTCAGTAGGTTTGG + Intergenic
1068601924 10:58965771-58965793 AGTTTCTGATTCAATAGGTATGG - Intergenic
1068928908 10:62568541-62568563 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1069084008 10:64118496-64118518 AGTTTCTGATTCAGTCTGTGTGG - Intergenic
1069374336 10:67778860-67778882 AGATTCTGATTCAGTAGATGTGG + Intergenic
1069526547 10:69177085-69177107 AGTTTCTGATTCAGTAGATCTGG - Intergenic
1069813803 10:71180809-71180831 AGTTTCTGAATCAGTAAGTATGG + Intergenic
1070225551 10:74500476-74500498 GGTTTCTGATTCAGTAAGTCTGG + Intronic
1070401051 10:76053917-76053939 AGTTTCTGATTCAGTATTTCTGG - Intronic
1070407173 10:76107279-76107301 AGTTTGGGATTTAGTAAGTCTGG + Intronic
1070514258 10:77189091-77189113 AGTTTCTGATTTAGTAGGTTTGG + Intronic
1070820177 10:79349761-79349783 AGTTTCCTCTTCTGTAAGGGGGG + Intronic
1071262842 10:83936567-83936589 AGATTCTGATTCAGTAAGTCTGG + Intergenic
1071331344 10:84564134-84564156 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1071436311 10:85651021-85651043 AGTTTCTGACTCAGTATGTCTGG - Intronic
1071696038 10:87872657-87872679 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1071707359 10:88013602-88013624 AGATTCTGATTCAGTAGGTTTGG + Intergenic
1071777740 10:88807993-88808015 AGTTCCTGATTCAGTAGGTTTGG + Intronic
1072109539 10:92305541-92305563 AGTTTCTGATTCTGTAGGTCTGG + Intronic
1072182680 10:93002483-93002505 AGTTCCCAATTCAGCAGGTGGGG - Intronic
1072305580 10:94103531-94103553 TGTTTCAGTTTCAGTAATTGAGG + Intronic
1072499388 10:95997725-95997747 AGTTTCTAATTCAGTAGGTCTGG + Intronic
1072576035 10:96701116-96701138 AGATTCCTATTCAGTAGGTCTGG + Intronic
1072631445 10:97149600-97149622 AGATTCTGAGTCAGTCAGTGTGG - Intronic
1072742937 10:97921141-97921163 AGTTTCTGATTCAGTCTGTCTGG + Intronic
1072989544 10:100178602-100178624 AGTTTCTGATTCAATAGGTCTGG - Intronic
1073417165 10:103394022-103394044 AGTTTCTGATTCAATAGGTAGGG - Intronic
1073541210 10:104317419-104317441 GGATTCCGATTCAGTAAGTGTGG - Intronic
1073548896 10:104378950-104378972 AGTTTCTGATTCAGTGGGTCTGG - Intronic
1073677108 10:105660881-105660903 AGTTCCTGATTCAGTAGGTCAGG + Intergenic
1073755276 10:106574626-106574648 AGTTTCTAATTCAGTAGGTATGG + Exonic
1074570956 10:114623680-114623702 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1074685129 10:115954908-115954930 AGTTTCTCATTCAGTAGGTCTGG + Intergenic
1074821565 10:117183223-117183245 TGTTTCCAATTCAGTAGGTCTGG - Intergenic
1074858360 10:117490293-117490315 AGATTCTGATTCCGTAAGTCGGG - Intergenic
1074920308 10:118001908-118001930 CGTTTCTGATTCAGTAGGTCTGG + Intergenic
1074963950 10:118472481-118472503 AGATTCTGATTCAGTAGGTATGG - Intergenic
1075633610 10:124016003-124016025 AGTTTCTGATTCAGGAGGTCTGG + Intronic
1077713474 11:4558453-4558475 AGTTTCCCCTTCAGCAAGGGAGG + Intergenic
1077819571 11:5723643-5723665 AGTTTCTAATTCAGTGAGTTTGG - Intronic
1078150781 11:8758067-8758089 AGATTCCCGTTCAGTAGGTGGGG - Intronic
1078268727 11:9774932-9774954 AGATTCTGATTCAGTAGGTTTGG - Intergenic
1078370737 11:10742629-10742651 AGTTTCTGATTCAGTAGGTATGG - Intergenic
1078464234 11:11538679-11538701 GGTTTCCCAGTCAGTAAATGGGG + Intronic
1078732199 11:13985063-13985085 AGTTTCTGATTCAGTAAGTCTGG - Intronic
1078883566 11:15477477-15477499 AGTCTTGGATTCAGTAAGTCTGG + Intergenic
1079091729 11:17485450-17485472 AGTTTCAGATTTAGTAGGTTAGG - Intergenic
1079154466 11:17931820-17931842 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1079322400 11:19462248-19462270 AGTTTCTGATTCAATAGGTCTGG + Intronic
1079442667 11:20531074-20531096 AGTTTCCAATTCAGCAGGTTTGG + Intergenic
1079551730 11:21707455-21707477 AGTTTCTGATTCAGAAGGTCTGG + Intergenic
1079677193 11:23243852-23243874 AGTTTCCTTATCTGTAAGTGAGG + Intergenic
1079989438 11:27231476-27231498 AGTCTCTGATTAAGTAAGTCTGG + Intergenic
1080002931 11:27371407-27371429 AGATTCTGATTCAGTAGGTCTGG + Intronic
1080022522 11:27578033-27578055 AGTCTACGATTCAATATGTGTGG - Intergenic
1080425880 11:32153900-32153922 AGTTTCTGAATCTGTAAGTCTGG + Intergenic
1080547551 11:33335899-33335921 TGTTTCCCACTCATTAAGTGGGG + Intronic
1080629981 11:34065462-34065484 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1080637340 11:34135504-34135526 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1080887795 11:36382499-36382521 AGAATCCGATTCAGTAGGTCTGG + Intronic
1081611121 11:44564242-44564264 AGTTTTCCATTCAGTAAGTTGGG + Intergenic
1081657490 11:44867173-44867195 AGTTTCTGATTCAGTGGGTCTGG - Intronic
1081684271 11:45030552-45030574 AGTTCCTGATTCAGTAAGTCTGG - Intergenic
1083230180 11:61312432-61312454 AGTTTCTGATTCTGTGAGTCAGG + Intronic
1083406171 11:62458824-62458846 AGTGTCTGATTCAGTAAATCTGG - Intronic
1083570675 11:63760797-63760819 AGTTTCTGATTCAGTAACCCTGG + Exonic
1084069674 11:66726362-66726384 AGTTTACGATTCAGTACTTCTGG + Intronic
1084130803 11:67132817-67132839 AGTTTCTGGTTCAGTAAGTTTGG - Intronic
1084131435 11:67138762-67138784 ACTTTCTGATTCAGTACGTTTGG - Intronic
1084345566 11:68545678-68545700 AGTTTCTGATTCAGCAGGTCTGG - Intronic
1084800480 11:71540209-71540231 AGTTTCTGTTTTAGTAAGTAAGG + Intronic
1085389605 11:76175744-76175766 AGTTTCCAATTCGGTAGGTCTGG + Intergenic
1085389799 11:76176557-76176579 AGTTTCCAATTCGGTAGGTCTGG + Intergenic
1085916996 11:80902470-80902492 AGTTTTTGATTCAGTAGGTCTGG + Intergenic
1086083202 11:82926678-82926700 AGATTCTGATTCAGGAAGTCTGG - Intronic
1086204715 11:84244156-84244178 AGTTTCTGATTCACTAGGTCTGG - Intronic
1086252848 11:84837926-84837948 AGTTTCTGATTCGGTGAGTCTGG - Intronic
1086263886 11:84974743-84974765 AGTTTCTGATTCACTAAATCTGG - Intronic
1086384286 11:86291202-86291224 AGTTTCTAATTCATTAAGTCTGG - Intergenic
1086574234 11:88320376-88320398 AGTTTATGAGTAAGTAAGTGAGG - Intronic
1086594553 11:88555303-88555325 AGTTTCTGATTCAGTTTGTCTGG - Intronic
1086931245 11:92695283-92695305 AGATTCTGATACAGTAAATGAGG + Intronic
1086943222 11:92819400-92819422 AGTTTCTGACTCAGTAGGTCAGG + Intronic
1086980071 11:93186883-93186905 AGTTTCCCACTCAGTAAGTCTGG + Intronic
1086984250 11:93231360-93231382 AGTTTCTGATTCAATAGGTCTGG - Intergenic
1087085392 11:94213197-94213219 AGTTTCTAATTCAGTAGATGTGG - Intergenic
1087679220 11:101200498-101200520 AGTTTTCTATTCAGTAGGTGAGG - Intergenic
1087821904 11:102721955-102721977 AGTTTCCTATTCATAAAATGAGG + Intronic
1087837768 11:102891931-102891953 AGTTTCTGATTCAAGAAGTCTGG - Intergenic
1088074959 11:105836676-105836698 AGTTTCTGATTCAATAAATCTGG + Intronic
1088098330 11:106125699-106125721 AGATTCAGATTCATTCAGTGGGG + Intergenic
1088246675 11:107825310-107825332 AGCTTCTGATTCAGTAGGTTTGG + Intronic
1088567662 11:111189871-111189893 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1088751227 11:112843757-112843779 AGTTTCTGATTCAGTACATCTGG + Intergenic
1088854978 11:113740751-113740773 GGTTTCTGATTCAGTAGGTCTGG - Intronic
1088887857 11:114021573-114021595 AGTTTCTGACTCAGTAGGTCAGG - Intergenic
1088918529 11:114245001-114245023 CGTTGCCGATTCAGTAAGGAGGG + Intronic
1088930918 11:114350022-114350044 AGTTTCTGATTCAGAAGGAGTGG - Intergenic
1089087617 11:115836600-115836622 AGTTTCTAATTCAGTAGGTATGG - Intergenic
1089510957 11:118996943-118996965 AGTTTCTGATTCAGTAGTTCTGG + Intergenic
1089533294 11:119145732-119145754 AGTTTCTGATTCAGTATCTGGGG - Intergenic
1089802939 11:121052049-121052071 AGCTTCTGATTCAGTAATTATGG + Intronic
1089807794 11:121106891-121106913 AGTTTCTGACTCAGTAGGTGTGG - Intronic
1090477003 11:127032131-127032153 AGCTTCTGATTCAGTAAATCTGG - Intergenic
1090561754 11:127940005-127940027 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1090824070 11:130371269-130371291 AGATTCTGATTCAGAAAGTCTGG + Intergenic
1091557927 12:1589540-1589562 AGTTACCCAACCAGTAAGTGAGG - Intronic
1091610038 12:1999133-1999155 AGTTTCTGATTCAGTAGGTTTGG - Intronic
1091834273 12:3574386-3574408 AGATTCTGATTCAGTAGGTCTGG + Intronic
1091954285 12:4625258-4625280 AGATTCTGATTCAGTAGGTCTGG + Intronic
1092092373 12:5813441-5813463 AGATTCTGATTCAGCAAATGTGG + Intronic
1092234379 12:6797081-6797103 AGTTTCTGATTCAGCAGGTCTGG + Intronic
1092308168 12:7322985-7323007 AGTTTCTGATTCATTAGGTGTGG - Intronic
1092388963 12:8058517-8058539 AGATTCCGATTCAGCAAGTCTGG + Exonic
1092480973 12:8858698-8858720 AGTTTCTCATTCAGTAGGTGTGG - Intronic
1092644732 12:10557991-10558013 AGTTTCTGATTCAGTGATTCTGG - Intergenic
1092661456 12:10742950-10742972 AATTTCCGATTCACTAGGTCTGG - Intergenic
1092770978 12:11896302-11896324 AGTTTCTGATTCAGTTTATGGGG - Intergenic
1093095858 12:14971515-14971537 AGATTCTGATTCGGTAAGTATGG + Intergenic
1093133253 12:15417575-15417597 AGATTCTGATTTAGTAAGTCTGG - Intronic
1093415854 12:18919783-18919805 AGTGTTCGATTGAATAAGTGGGG - Intergenic
1093713358 12:22353329-22353351 AGATTCTGATTCAGAAAGTTTGG + Intronic
1093780002 12:23123839-23123861 AGTTTCTGATTCTGTAGGTTTGG - Intergenic
1094093975 12:26682949-26682971 AGTTTCTGATTCAGTCGATGGGG - Intronic
1094166242 12:27446813-27446835 AGTTCCTGATTCAGTAAGTCTGG + Intergenic
1094182554 12:27607560-27607582 AGTTCCTGATTCAGTAGGTGTGG + Intronic
1094458612 12:30668258-30668280 ATTATTTGATTCAGTAAGTGAGG - Intronic
1094460670 12:30694590-30694612 AGTTTCTGATTCGTTAAGTCTGG + Intronic
1094501949 12:31029484-31029506 AGTTTCTGATTCAATAAGTCTGG - Intergenic
1094651163 12:32377103-32377125 AGATTCGGATTCATTAGGTGTGG - Intronic
1095417340 12:41990983-41991005 AGTTTCTGAGTCAGTAGGTCTGG - Intergenic
1095499493 12:42820913-42820935 AATTCCCGATTCAGTAGGTCTGG - Intergenic
1095659236 12:44709714-44709736 AGATTCTGATTCAGTAGGTCTGG - Intronic
1095797549 12:46236830-46236852 AGATTCTGATTCTGTAAGTCTGG - Intronic
1096280307 12:50246943-50246965 ATATTCTGATTCAGTATGTGTGG - Intronic
1096661522 12:53128139-53128161 AGTTTCTGATTCATTAAGTCTGG + Intergenic
1096756982 12:53807892-53807914 AGATTCCTCTTCAGTAAGTCAGG - Intergenic
1096971611 12:55670885-55670907 AGATTCAGATTCAGTAGGTCTGG + Intergenic
1097674512 12:62584198-62584220 AATTTCTGATTCAGTAAGACTGG + Intronic
1097945862 12:65366808-65366830 TGATTCTGATTCAGTAAGTGGGG - Intronic
1097972604 12:65650581-65650603 AGTTTTTGATTCAGTAAGTCTGG - Intergenic
1098136202 12:67405106-67405128 AGATTCTGATTCAGGAAGTCTGG + Intergenic
1098601530 12:72337001-72337023 AGATTCTGATTTAGTAAGTCTGG - Intronic
1098833859 12:75396720-75396742 GATTTCTGATTCAGTAAGTCTGG - Intronic
1099277623 12:80597774-80597796 GGTTTTTGATTCAGTAAGTCTGG + Intronic
1099345853 12:81498944-81498966 TGTTTCCCATTGAGAAAGTGAGG + Intronic
1099543381 12:83944277-83944299 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1099660497 12:85552641-85552663 AGTTTCTGATTCAGTAGATCTGG + Intergenic
1099935678 12:89122221-89122243 AGTTTCTGATTCAGTACATCTGG - Intergenic
1099937036 12:89138669-89138691 AGTTTCAGATTCAGTAAGCCTGG - Intergenic
1100097161 12:91054844-91054866 AATTTCTGATTCAGTAGATGTGG - Intronic
1100192505 12:92208070-92208092 AGATTCTGATTCAGCAAGTCTGG + Intergenic
1100377550 12:94031333-94031355 AGATTCAGATTCAGTTCGTGTGG - Intergenic
1100392407 12:94155341-94155363 AGCTTCTGATTTAGTAAGTCTGG - Intronic
1100559553 12:95734375-95734397 AATTTCTGATTCAGTAGGTCTGG + Intronic
1100620010 12:96261976-96261998 AGTTTCTGACTCAGTAGGTCTGG + Intronic
1100632695 12:96404144-96404166 AGTTTCTGATTCAGTTGGTCTGG - Intergenic
1100973904 12:100100790-100100812 AATTTCTGATTCAGTAGGTCTGG - Intronic
1101017371 12:100515952-100515974 AAATTCTGATTCAGTAAGTCTGG - Intronic
1101400041 12:104379298-104379320 AGTTTCTCATTCAGTAGGTCTGG + Intergenic
1101587488 12:106097816-106097838 AGTTTCCAATTCAGCAGGTCTGG + Intronic
1101665681 12:106811409-106811431 AGTTTCTGACTCAGTAGGTCTGG - Intronic
1101760222 12:107652231-107652253 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1101800025 12:108013599-108013621 AGTTTCCGATTTATTAGGTCTGG + Intergenic
1101860642 12:108479725-108479747 AGTTTCCATTTCAGTAGGTCTGG + Intergenic
1102217769 12:111173795-111173817 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1102785491 12:115600932-115600954 AGATTCCCATTCAGTAGGTCTGG - Intergenic
1102922716 12:116804316-116804338 AGTTTCTGAATCAGTAGGTCTGG - Intronic
1103018196 12:117512503-117512525 AGTTTCTCATTCAGTAGGTCTGG - Intronic
1103168392 12:118790938-118790960 AGTTTCCTATTCTGCAAATGGGG - Intergenic
1103290330 12:119840356-119840378 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1103618483 12:122170910-122170932 ACCTTCCGATTCAGTAGGTCTGG + Intronic
1103915876 12:124375436-124375458 GGTTTCTGATTCAGTACGTGTGG + Intronic
1103959641 12:124600954-124600976 AGTGTCCGATTCAGCAGGTTTGG + Intergenic
1104036441 12:125100706-125100728 AGTGTCCGATTCATTAGGTCTGG + Intronic
1104072292 12:125356337-125356359 AGTTTCCCAATCTGTACGTGGGG + Intronic
1104132656 12:125909407-125909429 AGATTCCGATTCAGTGGGTATGG + Intergenic
1104211111 12:126689627-126689649 AGTTTCCTTATCTGTAAGTGGGG - Intergenic
1104396055 12:128434266-128434288 AGTTTCTGATTCAGTGTATGTGG + Intronic
1104423545 12:128656620-128656642 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1105054207 12:133081916-133081938 AGTTTCTGATTCAGAAGGTCTGG - Intronic
1105952803 13:25246084-25246106 AGTTTCTGATTCAGTAGTTAGGG - Intergenic
1105982055 13:25527362-25527384 AGATTCTGATTCAGTACGTCTGG - Intronic
1106478366 13:30117212-30117234 AGTTTCAGATTCAGTAGTTCTGG - Intergenic
1106506782 13:30377258-30377280 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
1106527833 13:30558823-30558845 AGTTTCTGATTCAGTGGGTCTGG - Intronic
1106708014 13:32302065-32302087 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1106798910 13:33235754-33235776 AGTTTCCGATTTAGGAAGTCTGG - Intronic
1107354003 13:39546521-39546543 AGTTTCTGATTCACTAGGTCAGG - Intronic
1107769044 13:43770187-43770209 AGTTTCCAATTCATGAAGTTTGG + Intronic
1107782103 13:43914770-43914792 AGTTTTTGATCCAGTAAGTCTGG - Intergenic
1108020426 13:46122371-46122393 AGATTCTGATTCAGTACGTCTGG + Intergenic
1108117551 13:47146085-47146107 AGATTCCGATTCAGTAGGTCTGG + Intergenic
1108148761 13:47508545-47508567 AGGTTCTGATTCAGTAGGTTTGG - Intergenic
1108225107 13:48281306-48281328 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1108379438 13:49842138-49842160 AGATTCAGATTCAGTAGGTCTGG + Intergenic
1108674939 13:52728439-52728461 AGTTTCCCATTCAGTAGGTCTGG + Intronic
1109218105 13:59613364-59613386 AGTATCTGATTCAGTAGGTCTGG + Intergenic
1109230135 13:59746714-59746736 AAATTCTGATTCAGTAAGTCTGG + Intronic
1109279959 13:60344699-60344721 AGTTTCTGATTCAGTAGGTTTGG - Intergenic
1109728456 13:66377323-66377345 AGTTTCTGATTCAGGAGGTCTGG + Intronic
1109786790 13:67186466-67186488 AGATTCTGATCCAGTAGGTGTGG + Intronic
1110133221 13:72032850-72032872 AGTTTCAGATTCAGTAGATCTGG + Intergenic
1110370251 13:74731893-74731915 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1110416272 13:75256607-75256629 AGTTTCTGATGCAGTAGATGTGG - Intergenic
1110422819 13:75332604-75332626 AGTTTCTGATTAAGTAGGTCTGG + Intronic
1110499810 13:76213868-76213890 AGTTTCTGATTCAGTAGATTTGG + Intergenic
1110648552 13:77917753-77917775 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1110713637 13:78677063-78677085 AAATTCTGATTCTGTAAGTGGGG - Intergenic
1110897863 13:80778466-80778488 AGTTTCTGATTCATTAGGTCTGG + Intergenic
1111134823 13:84027508-84027530 AGTTTCCAAATCAGTAATTCTGG - Intergenic
1111851092 13:93575467-93575489 AGTTTCAGATTCAGTAGATCTGG + Intronic
1111959895 13:94798676-94798698 AGGTTCCACATCAGTAAGTGAGG - Intergenic
1112170030 13:96961830-96961852 AGTTTGTTATTCAGTAAGTCTGG - Intergenic
1112290467 13:98141655-98141677 AGCTGCCGATTCAGTAGGTTTGG - Intergenic
1112700071 13:101997575-101997597 AGGTTCTGATTCAGTAGGTCTGG + Intronic
1112893285 13:104265490-104265512 AGTCTCCCATACAGTAGGTGTGG - Intergenic
1113092736 13:106632195-106632217 AGTTTCCAATTCTGAAAGTCTGG - Intergenic
1113333738 13:109357742-109357764 AGTTTCTGATTCACTAGGTCTGG + Intergenic
1113780131 13:112972015-112972037 AGTTTCTGATTCAGGAAGTCTGG + Intronic
1114172477 14:20287231-20287253 AGTTTTGAATTCAGTAAGTCTGG + Exonic
1114744581 14:25134086-25134108 AGATTCAGATTCAGCAAGTCTGG - Intergenic
1115200939 14:30853521-30853543 AATTTCTGATTCAGTATGTGTGG - Intergenic
1115301147 14:31886970-31886992 AGGTTCTGATTCAGTAGGTCTGG + Intergenic
1115351538 14:32400811-32400833 AGATTCTGATCCAGTAAGTCTGG + Intronic
1115490972 14:33957755-33957777 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1115654335 14:35429061-35429083 CGTTTCTGATTCAGTAAGCATGG - Intergenic
1115705910 14:35998060-35998082 AGATTCTGATTCAGTATGTCTGG - Intergenic
1115727218 14:36230118-36230140 AGTTTCTGATTCAGTAAGTCTGG + Intergenic
1115916292 14:38319021-38319043 AGTTTCTGATTAAGTCAGTTTGG + Intergenic
1115992382 14:39163443-39163465 AGTTTCTGATTAAGTAAATTGGG - Intronic
1116491685 14:45511078-45511100 AGTTTCTGATTCAGGATGTCTGG + Intergenic
1116539561 14:46082744-46082766 AGTTTCTGATTCAGTAGATCTGG + Intergenic
1116657777 14:47674023-47674045 ATTTTCCGGCTCAGGAAGTGGGG - Intronic
1116818869 14:49608727-49608749 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1117012704 14:51487042-51487064 AGTTTCTGATGCAGTAGGTCTGG - Intergenic
1117142679 14:52805656-52805678 AGTTTCTGATTCAGTAAGTGCGG - Intergenic
1117440538 14:55755131-55755153 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1117513777 14:56479833-56479855 AGATTCTGATTCAATAAGTCTGG + Intergenic
1117736032 14:58769460-58769482 AGATCCTGATTCAGTGAGTGTGG - Intergenic
1117901119 14:60534470-60534492 AGTTTCCAATTCAGTAGGTCTGG - Intergenic
1118030702 14:61815128-61815150 AGTTCCTGATTCAGTAAGTCTGG + Intergenic
1118161735 14:63297600-63297622 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1118542651 14:66845763-66845785 AGATTCTGATTCAGTAGGTTTGG + Intronic
1118652161 14:67908198-67908220 AGTTTCTGATTCACTAGGTCTGG + Intronic
1119118819 14:72053514-72053536 AGATTCTGATTCAGTAAGCCTGG + Intronic
1119136560 14:72226636-72226658 AGATTCCGATTCAGGATATGTGG - Intronic
1119191217 14:72683359-72683381 AGTTTCTGATTCAGCAATTCAGG - Intronic
1119192972 14:72696838-72696860 AGTTTCTGATTCAGTCAGTCTGG - Intronic
1119279919 14:73397184-73397206 GGTTTCCGATTCAGTAGGTCTGG + Intronic
1119374648 14:74179967-74179989 AGTTTCTGATTCAGTAGATTTGG + Intronic
1119628664 14:76206686-76206708 AGTTTCGGATTCAGTAGGTCTGG - Exonic
1119661203 14:76453046-76453068 AGTCTCAGATTCAGTAGGTCTGG - Intronic
1119842159 14:77801190-77801212 AGTTTCTGATTCTGTAAGTCTGG + Intronic
1119861444 14:77939015-77939037 AGTTTCTGATTCAGTGAGTCTGG - Intergenic
1119893474 14:78200481-78200503 AGTGTCAGATTCAGGAAGTCTGG - Intergenic
1119954121 14:78776887-78776909 AGTTTCTGATTCAGTAGGTTGGG + Intronic
1120009871 14:79401417-79401439 AGTTTCTGAGTCAGTAAGTCTGG - Intronic
1120096037 14:80388726-80388748 AGTTTCTCGTTCAGTAAGTCTGG - Intergenic
1120222598 14:81751438-81751460 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1120431622 14:84425325-84425347 AGTGTCCGATAGAGGAAGTGAGG + Intergenic
1120592058 14:86388099-86388121 AGTTTCAACTTCAGAAAGTGGGG - Intergenic
1120648193 14:87098453-87098475 AGTTTCACATTCTGAAAGTGAGG - Intergenic
1120909556 14:89653719-89653741 AGTTTCTGACTCAGTAAGTGTGG + Intergenic
1121099298 14:91239106-91239128 AGTTTCAGACTCAGTGAGTCTGG + Intronic
1121179956 14:91921560-91921582 AGTTTCTGACTCAGTAGGTCTGG - Intronic
1121906712 14:97752754-97752776 AGTTTCTGATTCACTAGGTCTGG - Intronic
1122500417 14:102194409-102194431 AGTTTCTGATTCATTTAGTCTGG + Intronic
1123470257 15:20545781-20545803 ACTTTCTGATTCAGGAGGTGTGG - Intergenic
1123647798 15:22454919-22454941 ACTTTCTGATTCAGGAGGTGTGG + Intergenic
1123727704 15:23121104-23121126 ACTTTCTGATTCAGGAGGTGTGG + Intergenic
1123730556 15:23140758-23140780 ACTTTCTGATTCAGGAGGTGTGG - Intergenic
1123748694 15:23338184-23338206 ACTTTCTGATTCAGGAGGTGTGG - Intergenic
1124281068 15:28362067-28362089 ACTTTCTGATTCAGGAGGTGTGG - Intergenic
1124301634 15:28549554-28549576 ACTTTCTGATTCAGGAGGTGTGG + Intergenic
1124531650 15:30513478-30513500 ACTTTCTGATTCAGGAGGTGTGG + Intergenic
1124767008 15:32494216-32494238 ACTTTCTGATTCAGGAGGTGTGG - Intergenic
1125005434 15:34811457-34811479 AGTTTCTGATTCTGTAGGTCTGG + Intergenic
1125006532 15:34823516-34823538 AGTGTGGGATTCAGTAAGTCTGG - Intergenic
1125487245 15:40120554-40120576 AGTTTCTGAGTCAGTAGGTCTGG - Intergenic
1125714459 15:41811452-41811474 AGTTTCTGATTCTGTAGGTCTGG + Intronic
1125809891 15:42529350-42529372 AGTTTCTGATTGAGTAGGTCTGG + Intronic
1125961012 15:43829948-43829970 AGTTTCTGATTCAGAAGTTGGGG + Intronic
1125983843 15:44029770-44029792 AGATTCCGATTCAGTAGGTCTGG + Intronic
1126197315 15:45946664-45946686 AGTTTCTGATTCGGTAAGTCTGG - Intergenic
1126374977 15:47988572-47988594 AGTTTCCAATTCAATAGGTCTGG - Intergenic
1126393807 15:48190197-48190219 AGACTCTGATTCAGTAGGTGTGG - Intergenic
1126484535 15:49165759-49165781 AGATTCTGATTCAGTAGGTCTGG + Intronic
1126494215 15:49272463-49272485 AGATTCTGATTCAGTAGGTCTGG + Intronic
1126646607 15:50881314-50881336 AGTTTCTGCTTCAGTAGGTCTGG + Intergenic
1126847749 15:52776936-52776958 AGATTCAGGTTCAGTAGGTGTGG + Intronic
1126874995 15:53032028-53032050 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1126969611 15:54095613-54095635 AGATTCCCATTCAGTAGGTCTGG - Intronic
1126985360 15:54300660-54300682 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1127064130 15:55219541-55219563 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1127070035 15:55279983-55280005 AGTTTCAGATTCAGTAGGTCTGG + Intronic
1127386096 15:58468390-58468412 AGTTTCTGATTCATTAGGTCTGG - Intronic
1127620996 15:60734264-60734286 AGTTTCTGATTCAGTAGGACTGG - Intronic
1127621343 15:60737508-60737530 AGTTTCTGATTCAGTCAGTCTGG - Intronic
1127634872 15:60859444-60859466 AAATTCAGATTCAGTAAGTCTGG - Intronic
1127646969 15:60968371-60968393 AGTTTCTGATTCAGGAAATCTGG + Intronic
1127676632 15:61245613-61245635 AGTTTCTCATTCAGTATGTCTGG + Intergenic
1127738349 15:61869829-61869851 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1127782176 15:62326789-62326811 AGATTCCAATTCAGTAGGTCTGG - Intergenic
1127896169 15:63301098-63301120 TGTTTCTGATTCAGGAAGTGCGG + Intronic
1127908291 15:63393752-63393774 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1128015633 15:64342888-64342910 AGTTTCCAATTCAGTAGGTATGG + Intronic
1128219232 15:65956309-65956331 AGGTTCTGATTCAGTCAGTCTGG - Intronic
1128299729 15:66558618-66558640 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1128804958 15:70523826-70523848 GGTTTCTGATTCAGTAGGTCTGG - Intergenic
1129075653 15:72993719-72993741 AGTTTCTGATTCAGAAGGTCTGG - Intergenic
1129115327 15:73362459-73362481 AGATTCTGATTCAGTAGGTCTGG - Intronic
1129145485 15:73643047-73643069 AGTTTCTGACTCAGTAGGTTTGG + Intergenic
1129229100 15:74186832-74186854 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1129974905 15:79813883-79813905 AGTTTCCTCATCTGTAAGTGGGG - Intergenic
1130072414 15:80658878-80658900 AGGTTCTGATTCAGTAGGTCTGG - Intergenic
1130612943 15:85378099-85378121 GGATTCTGATTCAGTAAGTCTGG - Intergenic
1130928424 15:88402364-88402386 AGTTTCTGATTCAGCAGGTCCGG + Intergenic
1131156011 15:90076033-90076055 AGTTTCTGATTCAGTAGATCTGG + Intronic
1131425553 15:92342860-92342882 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1131428413 15:92366454-92366476 AGAATCCGATTCAGTAGGTCTGG + Intergenic
1131481657 15:92787491-92787513 AGCTTCTGATTCAGTAGGTGTGG - Intronic
1131576114 15:93592957-93592979 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1131603886 15:93879982-93880004 AATTTCTGATTCAGTAAGTCTGG - Intergenic
1132034622 15:98472146-98472168 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1132335611 15:101046462-101046484 AGGTTCTGATTCAGTAGGTGTGG + Intronic
1133530276 16:6648641-6648663 AATTTTGGATTCAGTAACTGAGG + Intronic
1133914441 16:10096374-10096396 AGTGTCAGATTCAGTAGGTCTGG - Intronic
1134142580 16:11734171-11734193 AGTTTCTGTTTCAGTGAGAGAGG - Intronic
1134346923 16:13399770-13399792 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1134648387 16:15889024-15889046 AGTTTCTGATTCTGTAAATCTGG + Intergenic
1134666912 16:16025378-16025400 AGTTTCTGATGCAGTAGGTCTGG + Intronic
1134686635 16:16163428-16163450 AGATTCCGATTCAGTCATTCTGG - Intronic
1134816751 16:17212154-17212176 AGTTTCTGATTCAGAAGGTTTGG - Intronic
1135165703 16:20137495-20137517 AGATTCTGCTTCAGTAAGTCTGG - Intergenic
1135984942 16:27177213-27177235 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
1135999580 16:27281592-27281614 AGATTCCGCTTCAGTATGTCAGG - Exonic
1137923954 16:52521788-52521810 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1138009573 16:53365150-53365172 ACTTTCTGATTCAGGAAGTGTGG - Intergenic
1138111519 16:54327967-54327989 AGTTTCCTAATCTGTAAATGGGG + Intergenic
1138313149 16:56045288-56045310 AGTTTCTGACTTAGTAAGTCTGG - Intergenic
1138736216 16:59252886-59252908 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1139279516 16:65758221-65758243 AGATTCTGATTCAGTAAGTCTGG - Intergenic
1139418715 16:66834906-66834928 AGTTTCTGATTCAGCAAGTATGG - Intronic
1139698517 16:68692563-68692585 AATTTCTGAATCAGTAAGTCTGG - Intronic
1139818850 16:69702614-69702636 AGTTTCTGACTCAGTATGTCTGG - Intronic
1139989844 16:70931542-70931564 AGGTTCCGATTCCGTAGGTCTGG - Intronic
1140638771 16:76947359-76947381 AGATTATGATTCAGTAAGTATGG - Intergenic
1140730745 16:77853655-77853677 AGTTTCTGATTCCATAAGTCTGG + Intronic
1140785231 16:78335075-78335097 AGCTTCTGATTCATTATGTGTGG - Intronic
1140820613 16:78659427-78659449 AGTTTCTGGTTCAGGAAGTCTGG - Intronic
1140995417 16:80254153-80254175 AGTTTCTGACTCAGTAGGTTTGG + Intergenic
1141048359 16:80737716-80737738 AGTTTCCGATTCAGTAGGTCTGG + Intronic
1141102891 16:81210958-81210980 GGATTCTGATTCAGTAAGTATGG + Intergenic
1141224297 16:82100662-82100684 TGTTTCTGATTCAGTAGCTGTGG - Intergenic
1141360242 16:83388851-83388873 AGATTCTGATTCAGTAGGTCTGG - Intronic
1143083642 17:4399639-4399661 AGTTTCCAATTCACCAGGTGTGG - Intergenic
1143444726 17:7000779-7000801 ACTTTCTGATTCAGTATGTCTGG + Intronic
1143877100 17:10000209-10000231 AGTTTCTGATTTAGTAGGTCTGG + Intronic
1143970641 17:10792708-10792730 AGATTCAGATTCAGTAGGTCTGG - Intergenic
1143998076 17:11025807-11025829 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1144040700 17:11408362-11408384 AGCTTCTGATTCAGTAAGTCTGG - Intronic
1144190664 17:12842571-12842593 AGTTTGTGATTCAGTAGGTCTGG + Intronic
1144213270 17:13032968-13032990 CGTTTCCGATTCAGTAGGAGTGG + Intergenic
1144366189 17:14547203-14547225 AGTTTCTGATTCAGTAGCTCTGG + Intergenic
1144369112 17:14573287-14573309 AGTGTCTGATTCAGTAAATCTGG - Intergenic
1144386606 17:14754018-14754040 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
1144394534 17:14831397-14831419 AGTTTCTGATTCTGTAGGTCTGG + Intergenic
1144406799 17:14959736-14959758 AGTTTCTGGTTCAGTAGGTTTGG + Intergenic
1144805819 17:17966522-17966544 AGTTTCTGTTTCAGTAGGTTTGG - Intronic
1145248943 17:21286992-21287014 AGTTTCCTTATCAGTAAATGGGG - Intronic
1146105425 17:30031286-30031308 AATTTCTGATTCAGTAAATATGG + Intronic
1146909566 17:36639845-36639867 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1147554802 17:41470689-41470711 AGTTTCTGATTCAGCCAGTCTGG - Intergenic
1148538336 17:48459314-48459336 AGATTCTGATTCAGCAAGTCTGG + Intergenic
1148539327 17:48467236-48467258 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1149332114 17:55594836-55594858 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1149384000 17:56124126-56124148 AGGTTCTGATTCAGTAGGTCTGG + Intronic
1149462103 17:56837245-56837267 AGTTTCTGATTTAGTAGGTCTGG - Intronic
1149910594 17:60563507-60563529 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1149913056 17:60583815-60583837 AGTTTCTGATTCAGTAAGTCTGG - Intronic
1150193890 17:63273843-63273865 AATTTCTGATTCAGTAGGTGTGG - Intronic
1150319004 17:64194690-64194712 AGATTCTGATTCAGTAGCTGTGG - Intronic
1150441594 17:65195937-65195959 AGTTTCTGATTCAGTAGGAGTGG - Intronic
1150577615 17:66444030-66444052 AGTTTCTCATTCTGTAATTGGGG + Intronic
1150729429 17:67679005-67679027 AGTTTCTGAGTCAGTAGGTTTGG - Intronic
1151413351 17:73945830-73945852 AGTTTCTGATTCAGTAGTTCTGG - Intergenic
1151737519 17:75953760-75953782 AGTTTCTGATTCAGTTGGTCAGG - Intronic
1151876987 17:76872447-76872469 AGTATCTGATTCAGTAATTTGGG + Intronic
1152273461 17:79339576-79339598 AGTTTCTGATTCAGTATGTGTGG + Intronic
1152979803 18:266442-266464 AGATTCTTGTTCAGTAAGTGTGG - Intronic
1152993711 18:386456-386478 AGATTCTGATTCAGTAGGTCTGG - Intronic
1153197825 18:2620134-2620156 AGATTCTGATTCAGTAGGTTTGG - Intergenic
1153445102 18:5162984-5163006 AGATTCCAATTCAGTAGGTTTGG + Intronic
1154955380 18:21249372-21249394 AGATTCTGATTCAGTAAGCTCGG - Intronic
1155008076 18:21747382-21747404 AGATTCTGGTTCAGTAAGTTTGG + Intronic
1155322934 18:24636793-24636815 AGTTTTTGATTCAGTATGAGGGG + Intergenic
1155409954 18:25533000-25533022 AGTTTCTGATTCAGTTGGTCTGG + Intergenic
1155656697 18:28201225-28201247 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1155668801 18:28344423-28344445 AGATTTGGATTCAGTAAGTCTGG + Intergenic
1155826730 18:30454253-30454275 AGTTTTCGATCCAGTAAGTTTGG + Intergenic
1156170504 18:34478726-34478748 AGATTCCGATTCAGCAAGTTTGG - Intergenic
1156317816 18:35987239-35987261 ATTTTCTGATTCCGTAAGTCTGG + Intronic
1156318038 18:35989386-35989408 AGCTTCTGATTCAGTAGGTCTGG - Intronic
1156386782 18:36612233-36612255 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1156560266 18:38116944-38116966 AGTTTCTGATTCAGAAGGTCGGG - Intergenic
1156598313 18:38573690-38573712 AGTTTCTGATACAGAAAATGTGG - Intergenic
1156778363 18:40821302-40821324 AGTTTCTGATTCAGTAGATCTGG - Intergenic
1156857556 18:41799990-41800012 ATTTTCAGATTCAATAATTGAGG - Intergenic
1157315994 18:46590200-46590222 AGTTTCTAATTCAGTTAGTCTGG - Intronic
1157427539 18:47596665-47596687 AGTTTCTGATTCAGTAGGTTGGG - Intergenic
1157681340 18:49609693-49609715 TGATTCTGATTCAGTAAGTCTGG + Intergenic
1157790715 18:50528666-50528688 AATTTCTGATTCAGTAGGTCGGG + Intergenic
1157832754 18:50872113-50872135 AGTTTCTGATTCAGTGGCTGTGG + Intergenic
1157930215 18:51813448-51813470 AGTTTCAGATTCAGTAGGTCTGG - Intergenic
1157931453 18:51828262-51828284 AGTCTCTGATTCAGTAGGTCTGG - Intergenic
1158123572 18:54077699-54077721 AGTTTCTGATTCAGTGTGTCTGG + Intergenic
1158269623 18:55698450-55698472 AGTTTCTAATTCAGTAGGTCCGG + Intergenic
1158351312 18:56567291-56567313 AGTTTCTGATTCAATAGGTGTGG + Intergenic
1158730850 18:60020765-60020787 AGTTTCTGATTCAGTGGGTGTGG + Intergenic
1158737933 18:60104990-60105012 AGTTTCTGATTCTGTAGGTCTGG - Intergenic
1158932222 18:62333308-62333330 AGTTTCTGATTCGGTAGGTGGGG - Intronic
1158965490 18:62618870-62618892 AGTATCTGATTCAGTAGGTCAGG - Intergenic
1158982749 18:62780639-62780661 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1159011574 18:63063302-63063324 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1159026388 18:63185742-63185764 AGTTTCCTCCTTAGTAAGTGGGG - Intronic
1159085316 18:63783319-63783341 AGTTTCTGATTCAGTACTTCTGG - Intronic
1159488450 18:69097563-69097585 AGTTTCTGATTCAGTCAGTCTGG - Intergenic
1160735847 19:662191-662213 GGTTTCGGAGTCAGTAGGTGTGG - Intronic
1161842614 19:6692070-6692092 AATTTCTGATTCAGTGAGTCTGG + Intronic
1162235890 19:9309544-9309566 AGTTCCCGATTCAGTGAGTTTGG + Exonic
1166186494 19:41142711-41142733 GGTTTCTGATTCAGTAGGTCTGG - Intergenic
1166722543 19:45005213-45005235 AGTTTCTGATTCAGTAGGTTTGG + Intronic
1166973537 19:46588595-46588617 AGTTTCTGATTTAGTAAGTCTGG + Intronic
1167034084 19:46983100-46983122 AGTTTTGGATTCAGTCAGTTTGG - Intronic
1167252275 19:48405968-48405990 ACTTTCCTTTTGAGTAAGTGAGG + Intronic
1167704600 19:51072160-51072182 AGATTCCGATTCAGTTGGTCTGG + Intergenic
1202698202 1_KI270712v1_random:141163-141185 AGTTTCTGATTTAGTAGGTCTGG - Intergenic
1202704261 1_KI270713v1_random:10244-10266 AGCTTCTGATTCATTAAATGTGG + Intergenic
925388170 2:3477851-3477873 GCTTTCCAACTCAGTAAGTGGGG - Intronic
926129678 2:10294743-10294765 AGTTTCAGATTCAGCAAGTCTGG - Intergenic
926991900 2:18689192-18689214 AGTTTCCCCTTCAGTAAATGTGG - Intergenic
927061714 2:19429232-19429254 AGTTTATGATTCAGTAGGTTTGG - Intergenic
927181730 2:20451459-20451481 AGTTTCTGATCCAGTAGGTCTGG + Intergenic
927421371 2:22934878-22934900 AGTTTTTGATTCAGTAAGACTGG + Intergenic
927465795 2:23335605-23335627 AGATTCCGATTCAGTAGGCCTGG + Intergenic
927813758 2:26195824-26195846 AGTTTCTGATTCAGTAGGGCTGG - Intronic
927873908 2:26641685-26641707 AGTTTCCTCATCTGTAAGTGGGG + Intergenic
928059959 2:28101881-28101903 GGATTATGATTCAGTAAGTGTGG - Intronic
928155421 2:28871766-28871788 AGTTTCCTATTTAGTCAGTCTGG + Intergenic
928258881 2:29749193-29749215 GGTTTCTGATTCAGTAGGTCTGG + Intronic
928275804 2:29899112-29899134 AGTTTCTCATTCAGTAGGTCGGG - Intronic
928436646 2:31258845-31258867 AGTTTCTGATTCAGTAGGTCTGG - Intronic
929261725 2:39873383-39873405 AGTTTGTGATTCAGTAGGTCTGG + Intergenic
929434298 2:41915714-41915736 AGGTTCTGATTCATTAAGTCTGG - Intergenic
929644541 2:43613513-43613535 AGTTTCTGATTCAATAGGTCTGG + Intergenic
929647806 2:43647296-43647318 AGTTTCCTCTTCTGTAAATGTGG - Intronic
929747136 2:44670723-44670745 AGTTTCTGATTCGGTAGGTCTGG + Intronic
929979234 2:46663468-46663490 AGTTTCTGATTCAGTTGGTCTGG + Intergenic
930014426 2:46960550-46960572 AGATTCTGATTCAGTGAGTTTGG - Intronic
930221744 2:48753158-48753180 AGTTTCTGATTCAGTAGGTTGGG + Intronic
930321749 2:49863406-49863428 ACTTTCTCAATCAGTAAGTGAGG + Intergenic
930496637 2:52153461-52153483 AGTTTCTGATTCAGAAGGTGAGG + Intergenic
930618278 2:53616666-53616688 ACTTTCTGATTCAGTAGGTCTGG - Intronic
930802190 2:55454357-55454379 AATTTCTGATTCAGTAGGTCTGG + Intergenic
930846537 2:55911600-55911622 AGTTTCTGATTCAGTCAGTCTGG + Intronic
930916963 2:56704125-56704147 AGATTCCGATTCAGTAAATGTGG + Intergenic
930998732 2:57755596-57755618 AGTTTCTGATTCAGTAGTTCAGG + Intergenic
931440798 2:62289010-62289032 AGTTTCCAATTCAATAGGTCTGG + Intergenic
931588226 2:63852302-63852324 AGATTCTGATTCAGTAGGTTTGG - Intronic
931836188 2:66100354-66100376 AGATTCTGATTCAGTAGGTTTGG + Intergenic
932013387 2:68000290-68000312 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
932020987 2:68086419-68086441 AGTTTCTGATTCATCAGGTGTGG + Intronic
932255079 2:70277808-70277830 AGATTCTGATTCAGTAGGTCTGG + Exonic
932364434 2:71139645-71139667 ACTTTCTGATTCAGGAAGTATGG + Intronic
932521083 2:72413339-72413361 AGTTTCTGACTCAGAAAGTCTGG + Intronic
932734438 2:74244749-74244771 AGTTTCCGATTCAGCAGGTCTGG + Intronic
932807915 2:74798682-74798704 AGTTTTCGATTCAGCAGGTCTGG - Intergenic
932855104 2:75225373-75225395 TGTTTCTGATTCAGTAGGTCTGG - Intergenic
932867650 2:75362637-75362659 AGTGTCTGATTCAGTATGTTTGG - Intergenic
932896290 2:75643838-75643860 AGTTTTAAATTCAGTAAGTCTGG + Intergenic
932936881 2:76113748-76113770 AGTTTCTGACTCAGTAGATGTGG + Intergenic
933200234 2:79439634-79439656 AGATTCAGATTCAGTAAGTCTGG + Intronic
933219670 2:79674069-79674091 AATTTCTGATTCAGTAGGTCTGG + Intronic
933293221 2:80460877-80460899 AGTTTCTGATTCAGTATATCTGG + Intronic
933302270 2:80555439-80555461 AGTTTCCAATTCAGTAAGTCTGG - Intronic
933640303 2:84751816-84751838 AGTTTCTGATTCAGTAGGTCTGG + Intronic
933881444 2:86673912-86673934 AGATTCTGATTCAGTAGGTCTGG + Intronic
934034638 2:88078703-88078725 AGGTTCTGATTTAGTATGTGGGG - Intronic
934279455 2:91598946-91598968 AGTTTCTGATTTAGTAGGTCTGG - Intergenic
934934131 2:98452355-98452377 AGTTTCTGATTCAGTGGGTGGGG - Intronic
935006153 2:99079489-99079511 AATTTCTGATTCAGTAGGTCTGG - Intronic
935482931 2:103615955-103615977 AGTTTCTGATCCAGTACGTCCGG + Intergenic
935584092 2:104785036-104785058 AGATTCTGGTTCAGTAAGTATGG - Intergenic
935746139 2:106192017-106192039 AGTTTCTGATTCAGTTGGTCTGG - Intronic
936490184 2:112963406-112963428 AGATTCTGATTCAGTAGGTCTGG + Intergenic
936527354 2:113250506-113250528 AGTTTCTGAATCAGTAGGTCTGG + Intronic
936551571 2:113446943-113446965 AGATTCCGATTCAGTAGATCTGG - Intronic
936582101 2:113709762-113709784 AGTTTCTGATTCAGTAGGTCTGG - Intronic
936730010 2:115370795-115370817 AATTTCTGATTCAGTAGGTTTGG + Intronic
936768512 2:115883608-115883630 ACCTTCCCATTCATTAAGTGTGG - Intergenic
936805347 2:116324962-116324984 AGTTTTTGATTCAGTAGGTTTGG + Intergenic
936904271 2:117518597-117518619 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
937011130 2:118563702-118563724 AGTTTTTGATTCAGTAGGTCTGG + Intergenic
937070583 2:119060126-119060148 AGTCTCCGAGTCTGTCAGTGTGG + Intergenic
937139489 2:119586893-119586915 AGTTTCCTCTTCTGTAAGTGGGG + Intronic
938050712 2:128168164-128168186 AGTTTCTGATTCAGTAAGTCTGG + Intronic
938293499 2:130162647-130162669 ATTTTCAGATGCAGGAAGTGAGG - Intronic
938403923 2:131016713-131016735 AGTTTCTGATTCAGTGGGTCTGG + Intronic
938463054 2:131510314-131510336 ATTTTCAGATGCAGGAAGTGAGG + Intergenic
938566558 2:132524013-132524035 AGTTTCTGATTCAGCAGGTCTGG - Intronic
938672203 2:133597266-133597288 AGTCTCTGATTCAGTAGGTCTGG - Intergenic
938698331 2:133854551-133854573 AGTCTCTGATTCAGTAGGTCTGG - Intergenic
938743235 2:134252553-134252575 AGTTGCTGATTCAGTGGGTGTGG + Intronic
938771869 2:134507477-134507499 AGTTTCTGATTCAGTAGGTCTGG - Intronic
938920882 2:135993542-135993564 AGTTTCTGATTCAGTATGTCTGG - Intergenic
939134560 2:138278174-138278196 AGTTACTGATTCAGGAAGTCTGG - Intergenic
939389931 2:141554873-141554895 AGATTCTGATTCAGTAATTTGGG - Intronic
939486329 2:142816194-142816216 AGGTTCCAATTCAGTAGGTCTGG - Intergenic
939845526 2:147241588-147241610 AGTTTCTGATTCACAAAGTCTGG + Intergenic
940327699 2:152442873-152442895 AGTTTATGATTCAGTAGGTCTGG + Intronic
940328052 2:152445667-152445689 AGTTTCTGATTCAGTTGGTCTGG + Intronic
940409217 2:153340968-153340990 AGCTTACGATTCAGTAGGTCTGG - Intergenic
940834329 2:158503877-158503899 AGTTTCTGATTCAGTAGGTCTGG + Intronic
941358780 2:164525629-164525651 AGTTTCTGATTCAGTAGATCCGG + Intronic
941435554 2:165466560-165466582 AGGTTCTGATTCAGTAGGTATGG + Intergenic
941498027 2:166231506-166231528 AGTTTCTGACTCAGTAGGTCTGG + Intronic
941542565 2:166804827-166804849 AGGTTCTGATTTAGTAAGTCTGG - Intergenic
941860059 2:170269881-170269903 AGTTTCTGATTCAGTAGGTTCGG + Intronic
941894387 2:170614615-170614637 AGATTCTGATTCAGTAGGTCTGG + Intronic
941906838 2:170724828-170724850 GGTTTCTGATTTAGTAAGTCTGG - Intergenic
942106927 2:172642515-172642537 AGTTTGTGATTCAGTAGGTCTGG - Intergenic
942392813 2:175513700-175513722 AGTTTCTGACTCAGTACGTGTGG + Intergenic
942494798 2:176528684-176528706 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
942502334 2:176604817-176604839 AGATTCTGATTCAGAAGGTGAGG + Intergenic
942735092 2:179101101-179101123 AGATTCTGATTCAGTAAATCTGG - Intergenic
942793594 2:179790446-179790468 AGTGTCTGATTCAGTAAATTTGG + Intronic
942864995 2:180662737-180662759 AGGTTCTGATTCAGTAGGTCTGG + Intergenic
943617486 2:190109995-190110017 AGCTTCTGATTCAGTAGGTCTGG + Intronic
943754638 2:191545290-191545312 AGTTTCTGATTCACTACATGTGG - Intergenic
944331399 2:198470738-198470760 AGTTTCTTTATCAGTAAGTGAGG + Intronic
944605319 2:201347067-201347089 AGTTTCCTTATCAGAAAGTGGGG + Intronic
944948668 2:204721030-204721052 AGATTCTGATTCAGTAGGTCTGG - Intronic
944982123 2:205133428-205133450 AATTTCTGGTTCAGTAGGTGTGG - Intronic
945005726 2:205403646-205403668 AGGTTCTGATTCTGTAAGTCTGG - Intronic
945010842 2:205461728-205461750 AGTTTCTGATTCAATAGGTCTGG + Intronic
945661962 2:212697524-212697546 AGTTTCTGATTCAGTAGCTCTGG + Intergenic
945768665 2:214012939-214012961 AGTTTCTGATTCAATAGGTTTGG + Intronic
945774900 2:214094264-214094286 AGATTCCAATTCAGTAGGTCTGG - Intronic
945992788 2:216410495-216410517 AAATTCCAATTCAGTAAGTCTGG - Intergenic
946261749 2:218498297-218498319 GGTTTCTGATTCAGTAGGTTTGG + Intronic
946398916 2:219458459-219458481 AATTTCCGATTCAGTAGGTCGGG - Intronic
946548829 2:220777742-220777764 AGTTTCCGATTCAGTAAGTCTGG + Intergenic
946990292 2:225321658-225321680 AGATTCTGATTCAGCAAGTCTGG + Intergenic
947123054 2:226837010-226837032 TATTTCTGATTCAGTAAGTTTGG - Intronic
947229081 2:227867282-227867304 TGTTTCTGATTCAGTAGGTCGGG + Intergenic
947908100 2:233780363-233780385 AGTTTCTGATTCAGTAAGTCTGG + Intronic
948005772 2:234606441-234606463 AGATTCTGATTCAGTAGATGTGG - Intergenic
948052197 2:234987144-234987166 AGTTTCTGATTCTGTAGGTCTGG - Intronic
948311808 2:236992794-236992816 AGATTCTGATTCAGTAGGTTTGG + Intergenic
1169260541 20:4135112-4135134 AGTTTCGGATCCAGTAGGTTTGG - Intronic
1169343388 20:4812604-4812626 AGTTTCTGATTCAGTAATTCTGG + Intronic
1169542422 20:6614482-6614504 AGTTTCAGATTCAGTAGATCTGG - Intergenic
1169596179 20:7201995-7202017 AATTTCTGATTCAGTAGGTCTGG - Intergenic
1169601366 20:7264726-7264748 AGTTTCTGATTCAGTTGGTGTGG + Intergenic
1169727252 20:8749004-8749026 AGATTCAGATTCAGTAGGTCTGG + Intronic
1169727273 20:8749181-8749203 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1169782112 20:9320853-9320875 AGTTTCTGATTCTGTAGGTCTGG - Intronic
1169858319 20:10126802-10126824 AGATTCTGATTCAGTAAGTCTGG - Intergenic
1169888631 20:10429875-10429897 AGTTTCTGACTCAGTAGGTCAGG - Intronic
1169924753 20:10770990-10771012 ATTTTCCTATTCTGTATGTGAGG + Intergenic
1169939719 20:10924102-10924124 AGATTCTGATTCAGTAGGTGTGG + Intergenic
1170043654 20:12064091-12064113 AGATTCTGATTCAGTGGGTGTGG + Intergenic
1170067022 20:12323105-12323127 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1170157501 20:13282005-13282027 AGTTTCTGACTCAGTAGGTCTGG - Intronic
1170281934 20:14659022-14659044 AGTTTCTGATTCGGTAGGTCTGG + Intronic
1170284576 20:14692168-14692190 GGTTTCTGAATCAGTAGGTGTGG - Intronic
1170308658 20:14968659-14968681 AGTTTCTGATTCAGTAAGTCTGG + Intronic
1170315490 20:15036434-15036456 AGTTTCTGAGTCAGTAGGTCTGG - Intronic
1170393740 20:15903560-15903582 AGTCTCTGATTCAGTAGGTTTGG + Intronic
1170412296 20:16104700-16104722 AGTTTCTGATTCTGCAAGTCTGG - Intergenic
1170535050 20:17332618-17332640 AGTTTGTGATTCCGTAAGTCTGG - Intronic
1170609698 20:17902484-17902506 AGATTCTGATTCAGTTGGTGTGG - Intergenic
1170633179 20:18082584-18082606 AGTTTCTGACTCAGTGAGTCTGG - Intergenic
1170681317 20:18528176-18528198 GGTTTCCGATTCAGGAGGTCTGG - Intronic
1170779952 20:19416298-19416320 AGATTCCGATTCAGGAAACGTGG + Intronic
1171092854 20:22302522-22302544 AGTTTCAGATTCAGGATGTCTGG + Intergenic
1171390367 20:24797905-24797927 AGTTCCTGATTCAGTGAGTCTGG - Intergenic
1171959493 20:31483849-31483871 AGTTTCTGATTCTGTAGGTTTGG - Intronic
1172229988 20:33330147-33330169 AGTTTCCTCATCTGTAAGTGGGG - Intergenic
1172367354 20:34360227-34360249 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1172699607 20:36845171-36845193 AGTTTCTGATTCAGCAAGTCTGG - Intronic
1172742519 20:37179770-37179792 AGTTTCCCATTCAGTGAAAGGGG + Intronic
1173058392 20:39637989-39638011 AGTTTCTGATTCACTAGGTTTGG + Intergenic
1173240587 20:41293245-41293267 AGATTCTGATTCAGAAAGTCTGG - Intronic
1173245695 20:41335954-41335976 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1173311639 20:41901490-41901512 AGACTCCAATTCAGTAAGTCTGG - Intergenic
1173338739 20:42135432-42135454 AGTTTCTGATTCAGTGAGTCTGG - Intronic
1173339116 20:42138099-42138121 AATTTCTGATTCAGTAAGTCTGG + Intronic
1173347344 20:42213157-42213179 AGTTTCTGATTCAGTAGGTCAGG - Intronic
1173400538 20:42722189-42722211 AGATTCTGATTCAGTCGGTGGGG + Intronic
1173436849 20:43041025-43041047 AGTTTCTGATTTAGTAGGTCTGG - Intronic
1173551039 20:43933428-43933450 AGATTCTGATTCAGTAGGTCTGG + Intronic
1173589306 20:44211479-44211501 AGTTTTCCATCTAGTAAGTGAGG + Intergenic
1173885839 20:46458081-46458103 CGTTTCTGATTCAGTAGGTCTGG - Intergenic
1174055754 20:47797089-47797111 AGTTTCCGATTCAGTGGGACTGG - Intergenic
1174373115 20:50107245-50107267 AGTTTCAGATTCAGGAATTCTGG - Intronic
1174685633 20:52452391-52452413 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1174732834 20:52934945-52934967 AGTTTCTGACTCAGTAGGTCTGG + Intergenic
1174741789 20:53021324-53021346 GGTTTCTGATTCAGTAGGTCTGG - Intronic
1174891858 20:54403736-54403758 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1175002876 20:55648783-55648805 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1175101846 20:56584881-56584903 AGTTTCTGATTCAGTGGGTCTGG - Intergenic
1175175826 20:57111494-57111516 AGTTTCCCCTTCAGTAAGATGGG - Intergenic
1175721822 20:61292302-61292324 AGTTTCCTTTTCTGTAAGTAAGG + Intronic
1177647072 21:23913150-23913172 AGTTTCTAATTCAGTAGGTCTGG - Intergenic
1177767145 21:25472141-25472163 AAATTCTGATTCAGTAGGTGTGG - Intergenic
1178058417 21:28825262-28825284 AGTTCCTGATTCAGTAGGTCTGG + Intergenic
1178094971 21:29204905-29204927 AGTTTCCAATTCAGTAAAACTGG - Intronic
1178156782 21:29863255-29863277 AAATTCTGATTCAGTAAGTCAGG + Intronic
1178800015 21:35785382-35785404 TGTTTCTGATTCAGTAGGTATGG - Intronic
1179093636 21:38291720-38291742 AATTTCCGATTCAGCAGGTTTGG - Intronic
1179535550 21:42049264-42049286 AGATTCGGATTCAGTAAGTCTGG + Intergenic
1180597878 22:16990837-16990859 AGTTTCTGATTCAGTAAGTCTGG + Intronic
1181112864 22:20612079-20612101 ATTTTCAGATGCAGGAAGTGAGG - Intergenic
1181735424 22:24877702-24877724 AGGTTCTGATTCAGGAAGTTTGG - Intronic
1181908895 22:26222128-26222150 AGTTTCTGATTTAGTAAGTCTGG - Intronic
1182372514 22:29821483-29821505 AGTTTCCTTATCTGTAAGTGGGG + Intronic
1182948035 22:34343516-34343538 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1183038424 22:35157988-35158010 AGCCTCTGATTCAGTAAGTCTGG - Intergenic
1183093154 22:35537169-35537191 AGTTTCCCCTTCTGTAAGTGGGG + Intergenic
1183139288 22:35921374-35921396 AGTTTCTGATTCAGTAAGTCTGG + Intronic
1183779865 22:39992426-39992448 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1184408210 22:44312126-44312148 AGTTTCCCAATCTGTAAATGGGG + Intronic
1184594460 22:45505368-45505390 AGTTTCCCAGTCAGGAGGTGGGG + Intronic
1185046493 22:48531121-48531143 TGTTTCAGATCCAGGAAGTGTGG + Intronic
949096629 3:94175-94197 AGTTGCCGATTCAGTAAGGTTGG - Intergenic
949300746 3:2581122-2581144 AGATTCCAATTCTGTAAGTCTGG - Intronic
949416547 3:3821081-3821103 AGATTTTGATTCAGTAAGTCTGG - Intronic
949520075 3:4843517-4843539 AGTTTCTGACTCAGTAGGTCTGG - Intronic
949613689 3:5730360-5730382 AGTTTCTGATTCAGTAGGTTTGG + Intergenic
949725416 3:7038985-7039007 AGTTTCAAATTCAGTAGGTCTGG - Intronic
949782282 3:7703262-7703284 AGTTTCTGATTCAGCAGGTCTGG - Intronic
949951500 3:9232750-9232772 AGATTCTGATTCAGTAGGTCTGG + Intronic
950075676 3:10185175-10185197 AGTTTCCGAATCAGCAGATGAGG - Intronic
950393502 3:12715654-12715676 AATTTCTGATTCAGTAGATGTGG - Intergenic
950648802 3:14394337-14394359 AGTTTCTGATTCAGGAGGTCTGG + Intergenic
950983715 3:17337170-17337192 AGTTTCTGATTTAGTGAGTCTGG + Intronic
951044527 3:18023200-18023222 AGTTTCTGATTCAGTAGGTGTGG - Intronic
951064356 3:18246960-18246982 GGGTTCTGATTCAGTAAGTTTGG - Intronic
951105059 3:18732693-18732715 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
951105899 3:18742338-18742360 AGTTTCTGATTTAGTAAGCTTGG - Intergenic
951119474 3:18908266-18908288 AGCTTCTGATTCATTAAATGTGG - Intergenic
951191018 3:19771702-19771724 AGTTTACGATTCAATAGGTCTGG - Intergenic
951243064 3:20309125-20309147 AGTTTTTCATTCAGTAAGTCTGG - Intergenic
951273334 3:20654702-20654724 AATTTCTGATTCAGCAAGTCTGG - Intergenic
951360390 3:21717996-21718018 AGTTTCAAATTCAATAAGTCTGG + Intronic
951372410 3:21866577-21866599 AGTTTCTGATTCAGTAGGTATGG + Intronic
951574723 3:24101883-24101905 AGTTTCTGATTCAGTAGGCCTGG + Intergenic
951588680 3:24240741-24240763 AGTTTCTGATTCAGTTAGTTTGG + Intronic
951597059 3:24329884-24329906 AGTCTCTGATTCAGTAGGTCTGG - Intronic
951605129 3:24424499-24424521 ACTTTCTGATTCAGTAGGTCTGG - Intronic
951825892 3:26867824-26867846 AGTTTCTAATTCAGTAGGTCTGG + Intergenic
952001157 3:28787231-28787253 AGTTCCTGATTCAGTAGGTCCGG - Intergenic
952112507 3:30140247-30140269 AGTTTCCGATTCAACAGGTCTGG + Intergenic
952418811 3:33113656-33113678 AGTTTCTGATTCAGAAAGTCTGG - Intergenic
952447970 3:33401845-33401867 AGTTTCCTAGTCAGTCAGTCCGG - Intronic
952470621 3:33647382-33647404 AGTTTCTGATTCAGTAGGTTTGG - Intronic
952669414 3:35948166-35948188 AGTTTCTCATTCAGTACGTCTGG - Intergenic
952688952 3:36181169-36181191 AGTTTCTGATTCAATATGTCTGG + Intergenic
952927365 3:38329902-38329924 AGTTTCTGATTCACTATGTCCGG - Intergenic
952963801 3:38608873-38608895 AGTTTCCGAGTCAGTAGGTCTGG - Intronic
953056872 3:39394881-39394903 ATTTCCTGATTCAGTAAGTCTGG - Intronic
953129713 3:40126231-40126253 AGTTTCTGATTCAGGAGGTCTGG - Intronic
953179525 3:40582974-40582996 AGTTTCCAATGCAGCAAGTTTGG + Intergenic
953204876 3:40817256-40817278 AGTTTCTGATTCAGTATGTCTGG - Intergenic
953344466 3:42163612-42163634 AGTTTCTGATTCAGTAGGTCTGG - Intronic
953375160 3:42422192-42422214 AGATTCCGATTCAGTCAATCTGG - Intergenic
953461322 3:43083423-43083445 AGGTTCTGATTCAGTAGGTCTGG + Intronic
953596013 3:44314790-44314812 ATTTTCTGATTCATTAAGTCTGG + Intronic
953758514 3:45667907-45667929 AGTTTCCAAATCAGTAGGTCTGG + Intronic
953795333 3:45981015-45981037 AGATTCTGATTCAGTAGGTTGGG + Intronic
954166490 3:48763155-48763177 AGTTTCTGATTCAGCAGGTCTGG + Intronic
955591523 3:60540975-60540997 AGTTTCTGGTTCAGTAGGTCTGG - Intronic
955661838 3:61307724-61307746 AGTTTCTCATTCATTAAGTCTGG - Intergenic
955786897 3:62550575-62550597 AGCTTCTGATTCAGTACGTCCGG + Intronic
955884674 3:63584941-63584963 AGATTCTAATTCAGTAAGTCTGG - Intronic
956094293 3:65699937-65699959 AGTTTTTGATTCAGTAGGTCTGG - Intronic
956405272 3:68922267-68922289 AGTTTGTGATTCAATAAGTCTGG - Intronic
956525038 3:70149492-70149514 AGTTTCTGCTTCAGTAGGTCTGG - Intergenic
956601566 3:71028399-71028421 TGTTTCTGATTCAGTAAATTGGG - Intronic
956647190 3:71467800-71467822 AGTTTCTGATTCAGGAGGTCTGG + Intronic
956665583 3:71639195-71639217 AGATTCTGATTCAGTAGGTCAGG + Intergenic
956841387 3:73143415-73143437 AGATTCCGACTCAGTAGGTCTGG + Intergenic
956913432 3:73845444-73845466 AGATTCTGATTCAGTAGGTCTGG + Intergenic
956994512 3:74808864-74808886 AGTTTCTGATTCTGCAAGTCTGG + Intergenic
957698931 3:83684150-83684172 AGTTTCTGATTCACTGAGTCTGG + Intergenic
957853245 3:85838971-85838993 AGATTCTGATTCAGTAGGTCAGG - Intronic
957864814 3:86007796-86007818 AATGTCCTGTTCAGTAAGTGTGG + Intronic
958056981 3:88426424-88426446 AGATTCTGATTCAGTAAGGCTGG - Intergenic
958130002 3:89406306-89406328 AGTTTCAGATTCAGTCATTCCGG - Intronic
958917431 3:100065188-100065210 AGATTCAGATTCAGTAAGTCTGG - Intronic
959533702 3:107462122-107462144 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
959627699 3:108471361-108471383 AGATTCTGATTCAGTAGGTCTGG - Intronic
959878463 3:111415168-111415190 AGATTCTGATTCAGTAGGTCTGG + Intronic
959910802 3:111761685-111761707 AATTTCTGATTCAGTACATGTGG + Intronic
960007613 3:112796312-112796334 ATTTTCAGATTCAGAAACTGGGG + Intronic
960311248 3:116118962-116118984 AGATTCCAATTCAGTAAGTCTGG + Intronic
960369406 3:116815406-116815428 AGTTTCCTCTTCAGTAAGCCAGG - Intronic
960667047 3:120119607-120119629 AGTTTCTGATTCAGTATGTCTGG + Intergenic
960869659 3:122235960-122235982 AGTTTCTGATTCAGTAGGTTGGG + Intronic
961061835 3:123835185-123835207 AGTTTCTGATTCAGCAGGTCTGG - Intronic
961114541 3:124317610-124317632 AGATTCTGATTCAGAAAGTTGGG + Intronic
961871819 3:129993893-129993915 AGTTTCTGATTCAGTAGTTCTGG - Intergenic
961936129 3:130585838-130585860 AAATTCTGATTCAGTAAGTGTGG + Intronic
961994031 3:131221873-131221895 TGTTTCTGATTCAGTAGGTCTGG - Intronic
962016518 3:131446198-131446220 AGATTCTGATTCAGTAATTTTGG - Intergenic
962020762 3:131498955-131498977 AGATTCTGATTCAGTAGGTCTGG - Intronic
962032414 3:131615064-131615086 AGTTTGTGATTCAGTAAGTTTGG + Intronic
962115335 3:132499931-132499953 AGTTTCTGATTCAGTGAGTCTGG + Intronic
962265036 3:133938736-133938758 ACTTTCCGACTCAGTAAGTCTGG - Intronic
962490942 3:135893684-135893706 AGTTTCTGATACAGTAGGTCTGG - Intergenic
962524335 3:136223786-136223808 AGTTTCTGATTCAGTGGGTCTGG - Intergenic
962652475 3:137510287-137510309 AGTTTCTTATTCAATAGGTGGGG + Intergenic
962875710 3:139534668-139534690 AGTTTCTGATTCAGTAGGCCAGG + Intronic
963054573 3:141175141-141175163 AGATTCTGATTCAGTAGGTCTGG - Intergenic
963501882 3:146137698-146137720 AGTTTCTGATTCAGTTTGTATGG + Intronic
963537875 3:146550764-146550786 TCTTTCTGATTCAGTAAGTCTGG + Intergenic
963590215 3:147247782-147247804 AGTTACTGATTCTGTAAGTCTGG - Intergenic
963874131 3:150454558-150454580 AGTTTCTGATTCAGTAGGCATGG - Intronic
963883559 3:150554880-150554902 AGATTCTGATTCAGTAAGTTGGG - Intronic
963924780 3:150939592-150939614 AGTTTCTGATTCAGTGGGTCTGG + Intronic
964013592 3:151919675-151919697 AGTTTCTGATTCAGTAGCTCTGG + Intergenic
964036171 3:152199810-152199832 AGTTTCTGATTCACTAGGTATGG + Intergenic
964188032 3:153970155-153970177 AGTTTCTGATTCAGTAGGTTGGG + Intergenic
964532157 3:157680516-157680538 AGTTTCAGATTCACTATGTCTGG - Intergenic
964757104 3:160098295-160098317 AGATTCAGATTCAGTAGGTCTGG - Intergenic
964807695 3:160629684-160629706 ACTTTCTGATTCAGTAGGTCTGG + Intergenic
965087411 3:164116392-164116414 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
965228282 3:166019961-166019983 AGTTTCTAATTCATTAAGTCTGG - Intergenic
965294846 3:166931640-166931662 AGTTTTTGATTCAGTAGGTTTGG - Intergenic
965436233 3:168655863-168655885 AGATTCTGATTCAGCAGGTGTGG + Intergenic
965491269 3:169339316-169339338 AGTTTCTGATTCAATAAGTCTGG - Intronic
965506556 3:169521657-169521679 AGTTTCTCATTCAGTAGGTTTGG - Intronic
965507456 3:169532199-169532221 AGTTTCTGATTCAGTGTGTCTGG + Intronic
965521258 3:169669658-169669680 AGATTCTGATTCAGTAAGCCTGG + Intergenic
965641013 3:170829080-170829102 AGTGTCTGATTCAGTAGGTCTGG - Intronic
965659485 3:171026488-171026510 TGTTTCTTATTCAGTAATTGGGG - Intronic
965733532 3:171797457-171797479 AGTTTCTGATTCAGTAGGTCTGG - Intronic
965814079 3:172618948-172618970 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
965925409 3:173972858-173972880 AGTTTCTGATTCAGGAAGTCTGG - Intronic
966211123 3:177454535-177454557 AGTTTCCTCATCTGTAAGTGGGG - Intergenic
966252363 3:177880619-177880641 AGATTCCTATTCAGTAGGTCTGG + Intergenic
966285388 3:178289133-178289155 AGATTCTGATTCAGTAAGTCTGG - Intergenic
966448376 3:180029756-180029778 AGTTCCTGATTCAGTAGGTCTGG + Intronic
966692905 3:182759959-182759981 AGATTCTGATTCAGTAGGTCTGG + Intergenic
966780856 3:183582995-183583017 AGATTCTGATTCAGTAGGTCTGG - Intergenic
966825868 3:183964489-183964511 AGTTTCTGATTCAGTAGGTCTGG + Intronic
966999182 3:185315409-185315431 AGTTTCTGATTCAGTAGGTCTGG + Intronic
967017312 3:185493971-185493993 AGATTCTGATTCAGTAGGTCTGG + Intronic
967079538 3:186036628-186036650 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
967093441 3:186154850-186154872 ATTTTCTGGTTCAGTAAGTCTGG - Intronic
967221376 3:187250691-187250713 AGTTTCTGATTCAGTGAGGCTGG + Intronic
967348263 3:188482939-188482961 AGATTCTGATTCAGTAGGTCTGG - Intronic
967462070 3:189759228-189759250 AGTTTCTGATTCAGTAGATCTGG - Intronic
967497432 3:190157071-190157093 ATTTTCTGATTTAGTAAATGAGG - Intergenic
967505897 3:190252232-190252254 AGTTTCTGATTCAGTAGGTTTGG - Intergenic
967670591 3:192230105-192230127 ATATTCTGATTCAGTAAGTGTGG - Intronic
967683396 3:192392039-192392061 AGATTCTGATTCAGCAAGTCGGG - Intronic
967738545 3:192980249-192980271 AGTTTCTGATTCAGGAGGTTTGG + Intergenic
967836004 3:193963339-193963361 AGTTTCTGATTCAGTGGGTCTGG - Intergenic
967881924 3:194307552-194307574 AGTTTCTGATTCAGTAATCCTGG + Intergenic
968193748 3:196690152-196690174 AATTTCTGATTCAGTAAGTCTGG - Intronic
968217084 3:196901962-196901984 AGTTTCTGATTCAGTAGGTGTGG - Intronic
968276847 3:197446680-197446702 AGTTTCTGATTCAGTAGATCTGG - Intergenic
969031294 4:4216951-4216973 AGTTTCTGATTCAGCAGGTGTGG + Intronic
969741720 4:9033205-9033227 AGTTTCCCTTTCCCTAAGTGGGG - Intergenic
969801086 4:9566102-9566124 AGTTTCCCTTTCCCTAAGTGGGG - Intergenic
969952813 4:10854947-10854969 AATTTCTGATTCAGTAAATTTGG - Intergenic
969954731 4:10877240-10877262 AGATTCTGATTCAGTAGGTCTGG - Intergenic
970321324 4:14878426-14878448 AGGTTCTGATTCAGTAGGTCTGG + Intergenic
970663681 4:18313331-18313353 GGATTCTGATTCAGTAAGTCTGG - Intergenic
970689608 4:18607363-18607385 GGATTCTGATTCAGTAAGTCTGG + Intergenic
970884831 4:20976239-20976261 AGTTTCCAATTCAGTAAATCTGG - Intronic
971226778 4:24761424-24761446 AGATTCTGATTCAGTGAGTCTGG + Intergenic
971235134 4:24834731-24834753 AGTTTCTGATTCAGTAGGTCTGG - Intronic
971649206 4:29250175-29250197 AGTTTTTGATTCAGTAAGACTGG + Intergenic
972308051 4:37851239-37851261 ACTTTCCGATTCAGTAGGTCTGG + Intronic
972440828 4:39089764-39089786 AGTTTCATATTCAGTAGGTGTGG - Intronic
972511536 4:39771709-39771731 AGTTTCTGATTCAGTAGCTCTGG + Intronic
972637701 4:40898904-40898926 AGTTTCTGATTCAGTAGGTCTGG + Intronic
972887179 4:43507169-43507191 AGTTTCTGATTTAGTAGGTCTGG + Intergenic
973583900 4:52371960-52371982 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
973691474 4:53437603-53437625 AATTTCTGATTCAGTAAGTCTGG - Intronic
973723567 4:53749843-53749865 AGTCTCTGATTCAGTAAGTGTGG - Intronic
974140139 4:57875900-57875922 ATTTTCTGATTCAGTATTTGTGG - Intergenic
974373097 4:61042757-61042779 AATTTCTGATTCAGTAGGTCTGG - Intergenic
974386598 4:61208060-61208082 AGTTTCCATTTCACTAAATGGGG - Intronic
974729866 4:65848479-65848501 AGTTTGGGATACAGTAAATGTGG - Intergenic
974794315 4:66729190-66729212 AGATTCTGATTCAGTAAGTTTGG - Intergenic
975061372 4:70005988-70006010 AGATTCTGATTCAGCAAGTTTGG + Intergenic
975064974 4:70049429-70049451 AGATTCTGACTCAGTAAGTTTGG + Intergenic
975671875 4:76788057-76788079 AGTTACCGATTCTGGCAGTGTGG + Intergenic
976038363 4:80852297-80852319 AGTTTCAGATTCAGTAGGTCTGG - Intronic
976064164 4:81164663-81164685 AGTTTCCGATTCAGTAAGTGTGG + Intronic
976625754 4:87179918-87179940 AGTTTCTGATTCAGTAGGTTTGG + Intronic
976707541 4:88035103-88035125 AGTTTCCTCTTCAGTAAGATGGG - Intronic
976774497 4:88692696-88692718 AGTTTCCTCCTCAGTAAATGGGG - Intronic
977304269 4:95303262-95303284 AGATTCCTATTCAGTGAGTTTGG - Intronic
977388400 4:96375095-96375117 TTTTTACGATTCAATAAGTGAGG + Intergenic
977543375 4:98346055-98346077 AGTCCCTGATTCAGTAAGTCTGG - Intronic
977765877 4:100797054-100797076 AGTTTCTGATTCCGTAAATCTGG - Intronic
977797926 4:101191173-101191195 AGTTTCTGATTTAGTAGGTCTGG - Intronic
978143286 4:105341926-105341948 AGTTCCTGATTCAGCAAGTCTGG - Intergenic
978530668 4:109709238-109709260 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
978745182 4:112185407-112185429 AGTTTCTGATTCAGTAAGTCAGG - Intronic
978791746 4:112670004-112670026 AGTTTCTGATTCAATAGGTCTGG + Intergenic
979761859 4:124415913-124415935 AGTTTCTCATTCAGTAGGTCTGG - Intergenic
980064753 4:128173689-128173711 ACTTTCTTATTCAGTAAGTTAGG + Intronic
980125908 4:128774069-128774091 AGTTTCTGATTCACTAGGTCTGG + Intergenic
980147135 4:129001306-129001328 AGTTTCTGATTCAAGAAGTCTGG - Intronic
980900214 4:138897812-138897834 AGTTTCTGATTCAGTAGGTTTGG - Intergenic
980973892 4:139592343-139592365 AGTTTCTGATTCAGTGGGTCTGG - Intronic
981001688 4:139834538-139834560 AGATTCCAATTCAGTAGGTCTGG + Intronic
981009433 4:139910243-139910265 AGTTTCTGATTCAGAAAGCCTGG - Intronic
981143565 4:141299729-141299751 AGATTCTGATTCAGTAGGTCTGG + Intergenic
981244818 4:142523204-142523226 AGTTTCTGATTTAGTAGGTCTGG - Intronic
981691571 4:147514963-147514985 AGTTCCTGATTCAGTAGGTCTGG - Intronic
982300151 4:153869995-153870017 AGTTTCTGATTTAGTAGGTTTGG + Intergenic
982673380 4:158348593-158348615 AGTTTCTGATTCAGTAGGTCTGG - Intronic
982796886 4:159657090-159657112 AGTTTCCAGTTTAGTAAGTGGGG + Intergenic
983094985 4:163550891-163550913 AGTTTCTGATTCCGTGAGTTTGG - Intronic
983370806 4:166855764-166855786 AGTTTCTGATTCATTAGGTGTGG + Intronic
983447407 4:167871165-167871187 AGTTTCTGATCCAGAAACTGAGG + Intergenic
983544186 4:168945159-168945181 AGGTTCTGATTCAGTAGGTTTGG - Intronic
983924870 4:173389601-173389623 AGTTTCTGATTCAGTAGGTCTGG + Intronic
984125057 4:175798009-175798031 AGTTTCTGATTCGGTGAGTATGG - Intronic
984258822 4:177419733-177419755 AGTTTCTGATTCAGTAGGTGTGG + Intergenic
984489746 4:180417976-180417998 AGTTTCTGATTCAGTGGGTCAGG - Intergenic
984742956 4:183185131-183185153 AGTTTCCGACTCAGTAGATTTGG - Intronic
984924077 4:184791479-184791501 AGTTTCGGATTCAGCAGGTCTGG - Intronic
985094182 4:186396327-186396349 AGTTTCTGATTGAGTAGGTCTGG + Intergenic
987302621 5:16609990-16610012 AGATTCCTGTTCAGTGAGTGTGG + Intronic
987353191 5:17039521-17039543 AGTTTCAGATTCAGTGAATCTGG - Intergenic
987814897 5:22887387-22887409 AGATTCTGATTCAGTAGGTATGG + Intergenic
988689977 5:33562118-33562140 AGATTCTGATTCAGTAGGTCTGG + Intronic
988909901 5:35828745-35828767 AGATTCTGATTCAGTAGGTCTGG + Intergenic
989001273 5:36763038-36763060 AGTTTCTGAGTCAGTAGGTAGGG + Intergenic
989108690 5:37886923-37886945 AGTTTCTGATCCAGTAGGTCTGG - Intergenic
989133237 5:38127631-38127653 AGTTTCTGATTGAGTAGGTCTGG + Intergenic
989237993 5:39171435-39171457 AGTTTCTAATTCAGTAGGTCAGG - Intronic
989358446 5:40571745-40571767 AGTTTCTGATTCAGTAGTTCTGG - Intergenic
989469408 5:41797783-41797805 AGTTTCTAATTCAGTAAGTGTGG + Intronic
989788049 5:45355396-45355418 AGTTTCTGATTCAGTAGGTCTGG - Intronic
990533561 5:56697651-56697673 AGTTTCTGATTCAGTAGGACTGG + Intergenic
990980545 5:61599033-61599055 GGTTTCTGATTCAGTAAGTCTGG + Intergenic
990996331 5:61735747-61735769 AGATTCTGATTCAGTAGGTCAGG - Intronic
991112270 5:62914336-62914358 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
991250934 5:64560309-64560331 AGTTTCCAATTCAGTGGGTCAGG - Intronic
991530683 5:67610514-67610536 AATTTCTGATCCAGTAGGTGTGG - Intergenic
991915136 5:71597992-71598014 AGTTTCCTCATCAGTAAATGAGG + Intronic
992202222 5:74395678-74395700 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
992204778 5:74420936-74420958 AGGTTCTGATTCAGTAGGTTTGG - Intergenic
992532934 5:77670078-77670100 AATTTCTGATTCAGTAAGTCTGG - Intergenic
992599084 5:78378892-78378914 TGTTTCTGATTCAGTAGGTCTGG - Intronic
992614732 5:78537061-78537083 AGATTCCGATTCAGTGGGTCTGG - Intronic
992911386 5:81399020-81399042 AATTTCGGATTCAGTATGTATGG - Intergenic
993056325 5:82984427-82984449 AGTTTCTAATTCAGTAGGTGTGG + Intergenic
993248210 5:85479973-85479995 AGTTTCTGATTCAGTAGGTCAGG - Intergenic
993681733 5:90886455-90886477 AGATTCTGATTCAGTATGTTTGG - Intronic
993699953 5:91107094-91107116 AGTTTCTGATACAGTAGGTCTGG + Intronic
993707646 5:91189563-91189585 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
993865747 5:93192908-93192930 AGATTCAGATTCAGTAGGTGTGG - Intergenic
993871498 5:93259999-93260021 AGTTTCTGATTCACTAAATCTGG - Intergenic
994017476 5:94984429-94984451 ATTTTCCGCTTCAGCCAGTGTGG - Intronic
994018405 5:94995284-94995306 AGTTTATGATTCAGTAGGTCTGG + Intronic
994046363 5:95314842-95314864 AGTTCCTGATTCAGTAGGTATGG + Intergenic
994366299 5:98921446-98921468 AGATTCTGATTCAGTACGTCTGG + Intronic
995060004 5:107803359-107803381 AGTTTCTGACTCAGTAGGTACGG + Intergenic
995102039 5:108323673-108323695 AGTTTTGGAATCAGGAAGTGTGG - Intronic
995161027 5:108982125-108982147 AGTTTCTGATTCTGTAGGTGTGG - Intronic
995379406 5:111515321-111515343 AGATTCTGATTCAGTAGGTTGGG - Intergenic
995411101 5:111858152-111858174 AGTTTCAGACTCAGTAGGTCTGG - Intronic
995507427 5:112874683-112874705 AGATTCTGATTCAGGAAGTCTGG - Intronic
995576974 5:113547302-113547324 AGATTCAGATTCAATAAGTCTGG - Intronic
995710441 5:115030036-115030058 AGTTTCAGATTCTGTAAATTTGG - Intergenic
996111362 5:119570218-119570240 AGTTTCTGATTCAGTAGATCTGG - Intronic
996138121 5:119870199-119870221 AGTTTCTGATTCAATAAGTCTGG - Intergenic
996337408 5:122399885-122399907 AGTTCCTGATTCAGTAGGTCTGG + Intronic
996716930 5:126595552-126595574 ACATTCTGATTCAGTAAGTCTGG + Intergenic
996728708 5:126696305-126696327 AGTTCCTGATCCAGTAGGTGTGG + Intergenic
996856123 5:128009464-128009486 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
997069326 5:130601394-130601416 AGTTTCTGATTCAGGAGGTCTGG + Intergenic
997078123 5:130705196-130705218 AGTTTCTTATTCAGTATGTCTGG + Intergenic
997367136 5:133333254-133333276 AGTTTCCTAATCAATAAATGAGG - Intronic
998175490 5:139899319-139899341 AGTTACTGATTCAGTAGGTCAGG + Intronic
998390021 5:141781232-141781254 GGTTTCTGATTCAGTAGGTTTGG + Intergenic
998685874 5:144524216-144524238 AGATTCTGATTCACTAAGTCTGG - Intergenic
998806625 5:145923140-145923162 GGTTTCTGATTCAATAAGTCTGG + Intergenic
998825879 5:146100887-146100909 AGATCCTGATTCAGTAAGTTTGG + Intronic
999187752 5:149725364-149725386 AGATTCCAATTCAGTAGGTCTGG - Intergenic
999292722 5:150437299-150437321 AGTTTCTGATTCAGTAGATCTGG - Intergenic
999496766 5:152106806-152106828 GGTTTCTGATTCAGTAGGTCTGG - Intergenic
999540833 5:152570992-152571014 CATTTCTGATTCAGTAAGTCAGG + Intergenic
999576709 5:152986789-152986811 AGATTCTGATTCAGTAATTCTGG - Intergenic
999625842 5:153519306-153519328 AGTTTCTGATTCAGGAGGTCCGG - Intronic
999629378 5:153554436-153554458 AGATTCCGAGTCAGTAAATCTGG + Intronic
999664069 5:153894439-153894461 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1000112611 5:158123274-158123296 AGTTTCAGATTCAGTAGGTCTGG - Intergenic
1000442633 5:161281686-161281708 AGTTTCTAATTTAGTAAGTTTGG - Intergenic
1000694230 5:164360078-164360100 AGTTTCTGATTCATTTAGTCTGG + Intergenic
1000761946 5:165236985-165237007 AGTTTCTGACTCAGTAGGTCTGG - Intergenic
1000765521 5:165284653-165284675 AATTTCTGATTCAGTAAATGTGG - Intergenic
1000922928 5:167159938-167159960 AGGTTACCATTCAGAAAGTGGGG + Intergenic
1001012323 5:168109584-168109606 AATTTCTGATTCAGTAGGTCTGG + Intronic
1001019973 5:168174534-168174556 AGTTTCAGATTCAGTAGGTCTGG + Intronic
1001053812 5:168433252-168433274 AGATTCTGATTCAGCAAGTCTGG + Intronic
1001110337 5:168890842-168890864 GGTTTCTGATTCAGTAGGTTTGG - Intronic
1001263656 5:170255931-170255953 AGATTCTGATTCAGTAAGTCCGG - Intronic
1001682936 5:173571986-173572008 AGTTTCTGATTCAGCAGGTGTGG - Intergenic
1001756950 5:174177727-174177749 AATTTCTGATTCAGCAAGTTTGG - Intronic
1001827569 5:174758126-174758148 GGTTTCTGATTCAGTAGGTCTGG + Intergenic
1001860645 5:175051833-175051855 AATCTCCGATTCAGTAGGTCTGG + Intergenic
1002515445 5:179754721-179754743 AGTTTCTGACTCAGTGAGTATGG + Intronic
1002555673 5:180037621-180037643 AAATTCTGATTCAGTAAGTCTGG - Intronic
1002667066 5:180832799-180832821 AGTTTCTGATGCAGGAAGTCTGG - Intergenic
1002820842 6:723252-723274 AGTTTCTGATTCATAAAGTCTGG + Intergenic
1002920421 6:1565985-1566007 AGTTTTGAATTCAGGAAGTGTGG + Intergenic
1003017762 6:2481751-2481773 AGTCTCTGATTCAGTAAGTCTGG + Intergenic
1003259474 6:4504024-4504046 AGATTCCGACTCAGCAGGTGTGG - Intergenic
1003328159 6:5108542-5108564 AGATTCTGACTCAGTAAGTGAGG - Exonic
1003492057 6:6631607-6631629 AGCTTCTGATTCAGTACGTCTGG - Intronic
1003525581 6:6894037-6894059 CGTTTCTGATTCAGCAGGTGTGG + Intergenic
1003584147 6:7371197-7371219 AGTTTCTGATTCAGTAATTCTGG - Intronic
1003688490 6:8328079-8328101 AGTTTCTGATTCAGTAGGGCAGG + Intergenic
1003741891 6:8949991-8950013 AGTTTCTGAGTCAGTAGGTATGG - Intergenic
1003894480 6:10594137-10594159 AGTTTCTGATTCAGCAGGTCTGG + Intronic
1004096165 6:12556612-12556634 AGTTTCTGATGCAGTAAGTCTGG + Intergenic
1004109311 6:12699747-12699769 AGATTCAGATTCAGTAGGTCTGG + Intergenic
1004120173 6:12813901-12813923 AGATTCTGATTCAGTAGGTCTGG - Intronic
1004200547 6:13543761-13543783 AGTTTCTGACTCAGTAGGTCCGG - Intergenic
1004645366 6:17555144-17555166 AGATTCTGATTCAGTAGGTCTGG - Intronic
1004729318 6:18342429-18342451 AGTCTCTGATTCAGTAGGTCTGG - Intergenic
1004968474 6:20881207-20881229 AGTCTGCGATTCAGTAGGTCTGG + Intronic
1005015761 6:21374082-21374104 AGGTTCTGATTTAGTGAGTGTGG + Intergenic
1005251980 6:23957138-23957160 AGTGTCTGATTCAATAGGTGTGG + Intergenic
1005321946 6:24664164-24664186 AGATTCTGATTCAGTAGGTCTGG + Intronic
1005488040 6:26319890-26319912 AGTTTCTGATTCAGTAGGTGTGG - Intergenic
1005595195 6:27372474-27372496 AGTTTTTGATTCAGTAGGTCTGG - Intergenic
1006352096 6:33528502-33528524 AGATTCAGATTCAGTAGGTCTGG - Intergenic
1006506803 6:34494398-34494420 AGATTCTGATTCAGTAGGTCTGG + Intronic
1006684515 6:35821324-35821346 AGATTCTGATTCAGTTGGTGGGG + Intronic
1006747518 6:36354571-36354593 AGTTTCAAAATCAGGAAGTGTGG + Intergenic
1007031799 6:38635062-38635084 AGTTTCTGATTAAGTAGGTGTGG - Intronic
1007089056 6:39170566-39170588 AGTCTCTGATTCAGTAGGTCTGG - Intergenic
1007108619 6:39300071-39300093 AGTTTCTGATCCAGTAGGTCTGG - Intronic
1007189415 6:40000638-40000660 AGTTTCAGATTCAATGGGTGTGG + Intergenic
1007962463 6:45972652-45972674 AGGTTCTGATTCAGTAAGTATGG - Intronic
1008003029 6:46380537-46380559 AGTTTCTGAATCAGTAAATCTGG - Intronic
1008036455 6:46749967-46749989 AGTTTCAGATTCTGTAAGTCTGG + Exonic
1008127099 6:47681094-47681116 AGATTCTGATTCATTAAGTCTGG + Intronic
1008391717 6:50959641-50959663 AGATTCTGATTAAGTAAGTCTGG + Intergenic
1008496416 6:52138520-52138542 AGTTTCTGATTCAGGAAGCCGGG - Intergenic
1008653018 6:53582785-53582807 AGTTTCTGATTCAGTAAATCTGG + Intronic
1008794420 6:55284402-55284424 AGTTTCTGGTTAAGTAGGTGAGG - Intergenic
1008896177 6:56558433-56558455 AGTTTTTGATTCAGTAGGTCTGG + Intronic
1008928209 6:56909688-56909710 AGTTTCTGATTCATTAAGTCTGG + Intronic
1008979354 6:57465297-57465319 AGCTTCTGATTCAGAAACTGGGG - Intronic
1009167487 6:60358289-60358311 AGCTTCTGATTCAGAAACTGGGG - Intergenic
1009790463 6:68394951-68394973 AGATTCTGATTCAGTAGGTATGG + Intergenic
1009815783 6:68732915-68732937 AGTTTCTGATCCAGTAAGATTGG + Intronic
1009827175 6:68881537-68881559 AGTTTTGCATTTAGTAAGTGTGG + Intronic
1009899169 6:69791242-69791264 AGTTTCAGATTCAAGAAGTCTGG + Intronic
1009903712 6:69842005-69842027 AATTTCTGATCCAGTAAGTCTGG + Intergenic
1010080575 6:71856528-71856550 AATTTCCCACTCTGTAAGTGTGG - Intergenic
1010099360 6:72085696-72085718 AGCTTCTGATTCAGTAGGTTTGG - Intronic
1010152350 6:72748432-72748454 AGATTCTGATTCATTAAGTCTGG - Intronic
1010308946 6:74359991-74360013 AGTTTCTGATTCAGTAGGTGTGG + Intergenic
1010357711 6:74953898-74953920 AGTTTCTGAATCAGTAGGTCTGG - Intergenic
1010443966 6:75930752-75930774 TGTTTCTGATTCAGTAGGTCTGG - Intronic
1010550297 6:77213606-77213628 AGTTTCCGATTTAGTAGGTTTGG - Intergenic
1010754878 6:79655830-79655852 AGTTTCAGATTCAGGAAGACTGG - Intronic
1010769557 6:79812660-79812682 AGTTTCTGATTCAGCAAGTCTGG - Intergenic
1011007937 6:82668964-82668986 AGATTCTGATTCAGTAAGTCTGG - Intergenic
1011507282 6:88059693-88059715 AGTTTCTGATTCAGTAGATTTGG + Intronic
1011606160 6:89107793-89107815 AGGTTCTGATTCAGGAAGTATGG + Intronic
1011732546 6:90280641-90280663 AGATTCAGACTCAGTAGGTGTGG + Intronic
1011738425 6:90335194-90335216 AGTTTCAAATTCAGTAAGTCTGG + Intergenic
1011739987 6:90349938-90349960 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1012103446 6:95121995-95122017 AGTTTCTGATTCAGTAGTTCTGG - Intergenic
1012280427 6:97321626-97321648 ATTTTCTGATTCAGTAAGTCTGG - Intergenic
1012394126 6:98776202-98776224 AGTTTTTGATTGAGTAAGTTTGG - Intergenic
1012797430 6:103780361-103780383 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1012979986 6:105819115-105819137 AGTTTCTGATTCAGTAGTTTGGG - Intergenic
1012988290 6:105898399-105898421 AGTTTCTGAATCAGTAGGTCTGG + Intergenic
1013275181 6:108578220-108578242 AGTTTCTGATTTAGTCTGTGTGG - Intronic
1013428936 6:110038834-110038856 AGTTTCTGATTCAGTAAGTCTGG - Intergenic
1013577585 6:111500114-111500136 AGTTTCCTATTCAGTAAGTCTGG - Intergenic
1013744078 6:113323803-113323825 AGTTTCTGATTCAGTAGGACCGG - Intergenic
1013987613 6:116214592-116214614 AGTTTCTGATTCAGTAGGTTTGG - Intronic
1014264792 6:119264188-119264210 AGCTTCTGATTCAGTAAATCTGG - Intronic
1014271003 6:119336029-119336051 AGTTTCTGATTCAGTAGGCCTGG - Intronic
1014274395 6:119370268-119370290 AGCTTCTGATTCAGTAAGTCTGG + Intergenic
1014300134 6:119671375-119671397 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1014389495 6:120843195-120843217 AGTTTCTGATTCAGTAGGTCCGG - Intergenic
1014538572 6:122647352-122647374 AGTGTCCGATTGATTAACTGGGG + Intronic
1014551130 6:122790219-122790241 CGTTTCAGATTCAGTAGGTCTGG - Intronic
1014684925 6:124485223-124485245 AGTTTCTGATTCAGTAAGACAGG - Intronic
1014974146 6:127857706-127857728 AGGTTCTGATTCAGTAGGTCTGG - Intronic
1014991239 6:128079933-128079955 AGTTTCTGATTCAGTATTTCTGG + Intronic
1015093969 6:129392375-129392397 AGTTTCTGATTCAGGAGGTCTGG - Intronic
1015126402 6:129759933-129759955 AGTTTCTAATTTAGTATGTGTGG - Intergenic
1015202566 6:130599843-130599865 AGTTTCTGGTTCTGTAAGTTTGG - Intergenic
1015296483 6:131599206-131599228 AGCTTCTGATTCAGTAAATCTGG - Intronic
1015581694 6:134731830-134731852 AGTTTCCAATTCAGTAACTCTGG + Intergenic
1015630689 6:135229146-135229168 AGTTTCTGATTCTGTAGGTCTGG + Intergenic
1016543837 6:145197764-145197786 AGTGTCCTAATCAGTAAGTGAGG + Intergenic
1016547865 6:145244534-145244556 AGTTTCTGATTCAGTAGATCTGG + Intergenic
1016595711 6:145797527-145797549 AGTTCCTGATTCACTAAGTCTGG + Exonic
1016628162 6:146196696-146196718 AGATTCTGATTCAGTAGGTTTGG - Intronic
1016715548 6:147223692-147223714 AGCTTCTGATTCAGTGAGTATGG + Intronic
1017047523 6:150361166-150361188 AGTTTCTGATTCAGTAAGCCTGG + Intergenic
1017725046 6:157271058-157271080 AGTTTCTGATTCAGCAGGTCTGG + Intergenic
1017795065 6:157836542-157836564 AGTTTCTGATTCAGGAGGTCTGG + Intronic
1017838520 6:158202345-158202367 AGATTCCGATTAAGTGGGTGTGG + Intergenic
1017951645 6:159140309-159140331 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1018252480 6:161885178-161885200 AGGTTCAGATTCAGTAGGTCCGG - Intronic
1018403983 6:163457524-163457546 AGTTTCTGATTCAATAAGTATGG - Intronic
1018615333 6:165681504-165681526 AGTTTCTGATTCAGTAGATCTGG + Intronic
1018678520 6:166243550-166243572 AGTTTCTGGTTCAGTAGGTCTGG + Intergenic
1018832647 6:167456434-167456456 AATTTCCAATTCAGTAGGTCTGG - Intergenic
1019061160 6:169259255-169259277 AGATTCCGACTCAGTAGGTGTGG + Intergenic
1019901986 7:4028164-4028186 AGTTTCTGATTCAGTGGGTCTGG - Intronic
1020334704 7:7053867-7053889 AGTTTCTGATTCAGGAGGTCTGG - Intergenic
1020821031 7:12967985-12968007 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1021180288 7:17497961-17497983 AGTTTCTGATCCAGCAAGTTTGG - Intergenic
1021615693 7:22500529-22500551 AGTTTCCGGTTCAGTATGTCTGG + Intronic
1021937855 7:25648795-25648817 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1022205146 7:28156657-28156679 AGTTTCTGATTTCGTAGGTGTGG + Intronic
1022324344 7:29317499-29317521 AGATTCTGATTCAGTAGGTCTGG - Intronic
1022403296 7:30062352-30062374 AGTTTCTGATTCAGTAACTCGGG + Intronic
1022531695 7:31070797-31070819 AGTTTCTGATTCAGTAGATCTGG + Intronic
1022723537 7:32961390-32961412 AGTTTCCGATTCAGTAGCTCTGG + Intronic
1022748940 7:33203330-33203352 AGTTTCTGATTCAGTAGGAGTGG + Intronic
1023141509 7:37106900-37106922 AGATTCTGACTCAGTAGGTGTGG + Intronic
1023145432 7:37146261-37146283 AGCTTCAGATTCAGTAGGTCTGG + Intronic
1023520336 7:41044131-41044153 AGATTCTGATTCTGTAGGTGTGG - Intergenic
1023676465 7:42635302-42635324 AGTTTCTGATTCAGTGGGTCTGG - Intergenic
1023730711 7:43189302-43189324 AGATTCTGATTCAGTAGGTGAGG + Intronic
1023760667 7:43462543-43462565 AGTCTCCGATTCAGTAGGTTTGG - Intronic
1025050092 7:55726527-55726549 AGTTTCCGATTCAGTAGCTCTGG - Intergenic
1025117436 7:56270216-56270238 AATTTCCTTTTCAGTAAATGAGG + Intergenic
1026110411 7:67454929-67454951 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1026201376 7:68217423-68217445 AATTTCCTTTTCAGTAAATGAGG + Intergenic
1026266748 7:68801944-68801966 AGATTCTGATTCAGTAGCTGAGG + Intergenic
1026370815 7:69697122-69697144 AGTTTCTGATTCAGTATGCCTGG + Intronic
1026435157 7:70390285-70390307 ATTTTCTGATTCAGTAGATGTGG + Intronic
1026459386 7:70600037-70600059 AGTTTCTGATTCAGTAGCTGTGG - Intronic
1026473315 7:70712575-70712597 AGTTTCCAATTCTGTAGGTTTGG - Intronic
1026576341 7:71574716-71574738 AGTTTCTGATTCAGTAGGTCTGG - Intronic
1026602830 7:71790814-71790836 AGTTTCTGATTCAGTAGGCCCGG + Intronic
1026613049 7:71877992-71878014 AATTTCTGTTTCAGTAAGTCTGG + Intronic
1026877105 7:73886140-73886162 AGTTTCTGATCCAGTAGGTCTGG + Intergenic
1027525586 7:79265227-79265249 AGTCTCTGGTTCAGTAAGTCTGG - Intronic
1027859835 7:83563546-83563568 AGTTTCTGATTAAGTAGGTCTGG - Intronic
1028102934 7:86843941-86843963 AGATTCTGATTCAGTAAGAAAGG + Intronic
1028228722 7:88280325-88280347 AGTTTCTGATTCAGTAGGCCTGG + Intronic
1028376807 7:90154106-90154128 AGTTTCCGGTTCAGTATGTCTGG - Intergenic
1028384662 7:90241592-90241614 AGTCTCTGCTTCAGTAAGTCTGG - Intergenic
1028673401 7:93430761-93430783 AGTTTCCTATTCAGTAGGTCTGG - Intronic
1028680942 7:93530930-93530952 AGTTTCTGGTTCAGTAGGTCTGG - Intronic
1028732587 7:94168993-94169015 AGTTTCTGATTCAATAGGTCTGG + Intergenic
1029802695 7:102966284-102966306 AGTTTCTGACTCAGTAGGTCTGG + Intronic
1029849551 7:103447614-103447636 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1030079437 7:105764436-105764458 AGTTTCTGATTCAGTAGATCTGG - Intronic
1030297498 7:107943642-107943664 AGATTCTGATTCAGTAGGTCTGG + Intronic
1030433778 7:109488439-109488461 AATTTCTGATTCAGTGGGTGTGG + Intergenic
1030581608 7:111363304-111363326 AGATTCTGATTCAGTATGTTTGG - Intronic
1030664019 7:112254319-112254341 AGTTGCTGATTCAGTAGGTTTGG - Intronic
1030714749 7:112794322-112794344 AGTTCCTGATTCAGTAGGTCTGG - Intergenic
1031485943 7:122324492-122324514 AATTTCTGATTCAGTAGGTCTGG + Intronic
1031589693 7:123574434-123574456 AGTTTGTGATACAGTAAGTCAGG + Intronic
1031618576 7:123908968-123908990 AGATTCTGATTCAGGAAGTCTGG - Intergenic
1031884776 7:127234690-127234712 AGTTTCTGATTCAGTGGGTCCGG - Intronic
1032568804 7:132977270-132977292 AGTTTCTGATTCAGCAAGTGTGG - Intronic
1032589820 7:133181710-133181732 CGTTTCTGATTCAGTCAGTCTGG + Intergenic
1032732983 7:134662377-134662399 AGTTTCGGAATCAGTAGGTCTGG + Intronic
1033009611 7:137606555-137606577 AGATTCTGCTTCAGTAAGTCGGG - Intronic
1033257726 7:139816645-139816667 AGTTTCTGATTCAGTAATTCTGG - Intronic
1033287499 7:140055084-140055106 AGGTTCTGATTCAGTCAGTCTGG - Intronic
1033315363 7:140292607-140292629 CGTTTCCGATACAGCATGTGCGG + Intergenic
1033413956 7:141146107-141146129 AGTTTCCTCATCTGTAAGTGAGG - Intronic
1033900442 7:146132353-146132375 AGATTCTGATTCAGTAAATCTGG + Intronic
1033961885 7:146923892-146923914 AGTTTCTGACTCAGTAAGTCTGG - Intronic
1034051516 7:147989144-147989166 AGATTCTGATTCAGGAAGTCTGG + Intronic
1034229030 7:149505534-149505556 AGTTTCCTTTTTCGTAAGTGAGG - Intergenic
1034783113 7:153900079-153900101 AGCTTCTGATTCAGTAGGTCTGG - Intronic
1034890046 7:154831650-154831672 ATTTTCCCATTCAGTATGAGTGG + Intronic
1035060120 7:156062873-156062895 AAATTCGGATTCAGTAGGTGTGG + Intergenic
1035126378 7:156610856-156610878 AGTTTCTGATTCAGTGAGTCTGG + Intergenic
1035485823 7:159225155-159225177 AGTTTCTGATTCAGTAGGTCAGG - Intergenic
1036494641 8:9259163-9259185 TGTTTCAGATTCAGTCAGTCTGG - Intergenic
1036579073 8:10055532-10055554 AGTCTCCGATTCAGTAATGGGGG - Intronic
1037188496 8:16093510-16093532 AGTTTCTGTTTTAGTCAGTGCGG + Intergenic
1037192812 8:16147956-16147978 AGTTTCTGATGCAGTAGGTCTGG - Intronic
1037778934 8:21854657-21854679 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1038181245 8:25230307-25230329 AGTTTCTGATTCAGTAGGTTGGG - Intronic
1038474740 8:27857465-27857487 AGTTTCTGATTCAGAAAGTCTGG + Intergenic
1038572750 8:28676868-28676890 AGATTCGGATTCAGTAGGTCTGG + Intronic
1038887767 8:31684150-31684172 AGTTTCTGATTCAATAGGTCTGG - Intronic
1038935095 8:32241121-32241143 AGTTTCTGATTCACTAGGTCTGG + Intronic
1039072918 8:33662424-33662446 AGTTTCTGATTAAGTAGGTCTGG + Intergenic
1039222071 8:35343044-35343066 AGTTTCTGATTCAGTAGTTCTGG + Intronic
1039273885 8:35913783-35913805 AGTTTCTGAGTCAGTAGGTCTGG + Intergenic
1039297751 8:36175401-36175423 AGTTTCTGATTCAGTATGTCTGG - Intergenic
1039303990 8:36241340-36241362 AATTTCAGATTCAGTAGGTCTGG + Intergenic
1039392810 8:37195485-37195507 AGTGTCCGATTCAGCAGGTCTGG - Intergenic
1039400458 8:37264976-37264998 AGCTTCTGATTCAGTAGGTCTGG - Intergenic
1040013721 8:42683305-42683327 AGTTTCTGATTCAGGAGGTCTGG - Intergenic
1040711079 8:50189392-50189414 AGTTTCTGATTCGGTAGATGTGG + Intronic
1040888055 8:52286860-52286882 AGTTTCTGATTCAGGAAGTCTGG - Intronic
1041006778 8:53503341-53503363 AGTTTCTGACTCAGTAGGTCTGG - Intergenic
1041827200 8:62109352-62109374 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1042314187 8:67408135-67408157 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1042439983 8:68814246-68814268 AGTTTCTGATTCAGTAGATCTGG - Intronic
1042524328 8:69748813-69748835 AGTCTCCGATTCAGTAGGTCTGG - Intronic
1042829784 8:73014286-73014308 AGTTTCAGATTCAGTAGGATGGG + Intronic
1042983125 8:74552656-74552678 AGATTCTGATTCAGTAAGTCTGG + Intergenic
1043185852 8:77148599-77148621 AGTTTCCAATTCAGAATGTCTGG + Intergenic
1043382392 8:79717132-79717154 TGTTTCCAATTCAGTTAATGGGG + Intergenic
1043389759 8:79781183-79781205 AGTTTCTGATTCTGTAAGTCTGG + Intergenic
1043436255 8:80238692-80238714 AGTTCCGGCTTCTGTAAGTGAGG + Intergenic
1043823569 8:84898208-84898230 AGTTTCTGATCCAGTAAGCCTGG - Intronic
1043865267 8:85367616-85367638 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1044069185 8:87735093-87735115 ATTTTCTGATTCAATAAGTGGGG - Intergenic
1044271267 8:90246994-90247016 AGTTTCAGATTCAGCATGTCTGG + Intergenic
1044541818 8:93416946-93416968 AGTTTCTGTTTCAGTAGGTCTGG + Intergenic
1044683500 8:94805095-94805117 AATTTCTGATTCAGTAGGTCTGG + Intergenic
1044865147 8:96563584-96563606 AGTTTCTGATTCATTAGGTCTGG + Intronic
1044945233 8:97383157-97383179 AATTTCCAATTCTGGAAGTGGGG - Intergenic
1045003400 8:97897152-97897174 AGTGTCTGATTCAGTAGGTCTGG + Intronic
1045110941 8:98939379-98939401 AGTTTCTGACTTAGTAGGTGAGG + Intronic
1045522428 8:102914863-102914885 AGTTTCCAGTTCAGCAACTGAGG - Intronic
1045605098 8:103764028-103764050 AGTTTCCTATTCAGTAAGTCTGG + Intronic
1045901646 8:107288537-107288559 AGATTCTGATTCAGTATGTCTGG + Intronic
1045955352 8:107899409-107899431 ATTTTCCCATTTACTAAGTGGGG - Exonic
1046298052 8:112247772-112247794 AGTTTCTGATTCAGTGTGTCTGG - Intronic
1046498202 8:115041648-115041670 AGTTTCAGATTTAGTAGGTCTGG - Intergenic
1046742252 8:117842016-117842038 AGTTTCTGATTCAGCAGGTTTGG - Intronic
1046898314 8:119497037-119497059 AGTATCCCATTTTGTAAGTGAGG + Intergenic
1046914202 8:119662472-119662494 AGTTTCTGATCCAGTAGGTCTGG - Intronic
1047000326 8:120566718-120566740 AGTTTCTGATTCAGTTGGTCTGG + Intronic
1047158311 8:122347405-122347427 AGATTCTGATTCAGTTAGTCTGG + Intergenic
1047268826 8:123335058-123335080 GGTTTCTGATTCTGTAGGTGTGG - Intronic
1047512591 8:125527001-125527023 AGTTTCTAATTCAGTAGGTCAGG - Intergenic
1047658382 8:127004018-127004040 AGTTTCTGACTCAGTAGGTCTGG + Intergenic
1047770851 8:128028617-128028639 AGTTTTCTCTTCTGTAAGTGGGG + Intergenic
1047790436 8:128198204-128198226 AGTTTCTGATTTAGTAGGTCTGG - Intergenic
1047801779 8:128317721-128317743 AGTTTCTGATTTAGTAGGTCAGG + Intergenic
1048059813 8:130907218-130907240 AGTTTCTGGTTCAGTATGTCTGG - Intronic
1048064568 8:130954489-130954511 AGAGTCCAATTCAGTAGGTGTGG - Intronic
1048232655 8:132659104-132659126 AGGTTCTGATTCAGTAGGTCTGG + Intronic
1048396101 8:134015353-134015375 AGATTCAGATTCAGTAGGTCTGG - Intergenic
1048428754 8:134347808-134347830 AGATTCTGATTCAGTAAGCCTGG - Intergenic
1048481702 8:134801959-134801981 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1048488446 8:134869903-134869925 GGTTTCTGATTCAGTAGGTCTGG - Intergenic
1049901426 9:170199-170221 AGATTCCGATTCAGTAGATCTGG + Intronic
1049910130 9:257859-257881 AGTTTAGGATTCAGTAGGTCTGG + Intronic
1049914768 9:306695-306717 AATTTCTGATTCAGTAGGTCTGG + Intronic
1049930900 9:455532-455554 AGATTCTGATTCAGTAGGTCTGG + Intronic
1049995512 9:1030333-1030355 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
1050001336 9:1079818-1079840 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1050109164 9:2196960-2196982 AGTTTCTGATTCAGCAGGTCTGG - Intergenic
1050112570 9:2231986-2232008 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1050154789 9:2655046-2655068 AGTTTCTGATTCAGTAGGTCTGG - Exonic
1050227255 9:3474003-3474025 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1050249167 9:3725691-3725713 AGTTTCCTATTCAGTAAGTCTGG - Intergenic
1050376335 9:4977397-4977419 AGTTTCTGATACAGAAAGTCTGG + Intergenic
1050460855 9:5876186-5876208 AGTTTCTGATTTAGTAAGTCTGG + Intergenic
1050529439 9:6575463-6575485 AGTTTCTGATTCAGTAAGTCTGG - Intronic
1050624071 9:7485158-7485180 AGTTTCTGATTCAGGAGGTCTGG - Intergenic
1050627557 9:7521384-7521406 AGTTTCTTATTTGGTAAGTGGGG - Intergenic
1050702440 9:8355780-8355802 AGGTTCTTATTCAGTAAGTCTGG + Intronic
1050834702 9:10061929-10061951 AGTTTCCGATTCAGTATTTGTGG - Intronic
1051044976 9:12861992-12862014 AGTTTCTAATTCAGTAGGTCTGG + Intergenic
1051764850 9:20512456-20512478 AGTTTCTGATTCATTAAATTTGG - Intronic
1051777442 9:20651339-20651361 AGATTATGATTCAGTAAGTCTGG + Intergenic
1051883808 9:21868878-21868900 AGTTTCCGATTCAGGATATCTGG + Intronic
1051885203 9:21885387-21885409 AGATTCTGATTCAGTAGGTCTGG + Intronic
1052021479 9:23530716-23530738 AGTTTCTGCTTCTGTAAGAGGGG - Intergenic
1052083879 9:24239961-24239983 AGATTCTGATTCAGCAAGTCTGG + Intergenic
1052260516 9:26510701-26510723 AGTTTTCGATTTAGTAGGTCTGG + Intergenic
1052343912 9:27389215-27389237 AGTTTCTGATCCAGTAAGTTTGG - Intronic
1052391851 9:27888556-27888578 AGTTTCTGATTCAGGAGGTCTGG - Intergenic
1052977476 9:34421856-34421878 AGATTCTGATTCAGTAGGTCTGG + Intronic
1053279348 9:36807444-36807466 AGTTTCTGACTCAGTAAGTCGGG + Intergenic
1053405532 9:37872136-37872158 AGTTTCTGATTCTGTAGGTCTGG + Intronic
1053448471 9:38172078-38172100 AGATTCTGATTCAGTAAGTGTGG + Intergenic
1053456671 9:38238322-38238344 AGTTTCTGATTCAGTAAGTGTGG - Intergenic
1053744462 9:41180506-41180528 AGATTCCGATTCAGTAGATCTGG + Intronic
1054482808 9:65684703-65684725 AGATTCCGATTCAGTAGATCTGG - Intronic
1054683882 9:68250744-68250766 AGATTCCGATTCAGTAGATCTGG - Intronic
1054725800 9:68648830-68648852 AGTTTCTGATTCAGAAGGTCTGG + Intergenic
1054814579 9:69462865-69462887 AGTTTCTGACTCAGTAGGTTTGG + Intronic
1054820338 9:69515668-69515690 AGTTTCTGATTCAGAAAGTATGG - Intronic
1054883789 9:70173841-70173863 GGTTTCCCATTCACTAAGTAAGG + Intronic
1055098006 9:72434320-72434342 AGATTCTGATCCAGTAAGTGGGG + Intergenic
1055219641 9:73913154-73913176 AATTTCTGATTCAGTAAATCTGG - Intergenic
1055275432 9:74610842-74610864 AGTCTCTGATTCAGTAGGTCTGG + Intronic
1055286308 9:74731876-74731898 AGTTTCTGCTTCAGTAGGTTTGG - Intronic
1055316089 9:75035976-75035998 AGATTCAGATTCAGTAGGTGAGG - Intergenic
1055318121 9:75054489-75054511 AGTTTCTGATTCAGTAGGTTTGG - Intergenic
1055365203 9:75536501-75536523 TGTTTCTGATTCAGTAAGTGTGG - Intergenic
1055451959 9:76439161-76439183 AGTTTCTGATTTAGTAGGTGAGG - Intronic
1055483102 9:76729301-76729323 CGTTTCTGATTCAGTAGGTCTGG + Intronic
1055491101 9:76806172-76806194 AGTTTCTGACTCAGTAGGTCTGG - Intronic
1055991858 9:82114815-82114837 AGTTTCTGATTCAGAAGGTCTGG + Intergenic
1056395875 9:86180663-86180685 AGTTTCTGATCCAGTAGGTCTGG - Intergenic
1056432911 9:86546518-86546540 AGTTTCTGATTCAATGAGTAAGG - Intergenic
1056520149 9:87393661-87393683 AGTTTCTGATTCAGTAAGTCAGG - Intergenic
1056905872 9:90647246-90647268 AGTTTCTGAATCAGTAGGTCCGG + Intergenic
1057097726 9:92327116-92327138 AGATTCTGATTCAGTAGGTCAGG - Intronic
1057520088 9:95752924-95752946 AGTTTTGGATTCAGGGAGTGGGG + Intergenic
1057665942 9:97045638-97045660 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1057960817 9:99455006-99455028 AGTTTCTGATTCGGTAGGTCTGG + Intergenic
1058001655 9:99872076-99872098 AGTTTCTGATTCAGTAACTCTGG - Intergenic
1058146907 9:101422546-101422568 AGTTTCTAATTCAGTAGGTCAGG - Intronic
1058166654 9:101626630-101626652 AGATTCTGATGCAGTAAGTTTGG + Intronic
1058324021 9:103672589-103672611 AGTTTCTGATTCAGGAAGTCTGG + Intergenic
1058497414 9:105574650-105574672 AGTTTCTGATTCAGTAAATCCGG - Intronic
1058523443 9:105834596-105834618 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1058674272 9:107387360-107387382 AGAGTCTGATTCAGTAGGTGTGG + Intergenic
1058816538 9:108688223-108688245 AGGTTCTGATTCAGTGTGTGAGG + Intergenic
1059048744 9:110899654-110899676 AGATTCTGATTCAGTAGGTCTGG + Intronic
1059379469 9:113912020-113912042 AGATTCTGATTCAGCAGGTGTGG + Intronic
1059698909 9:116756342-116756364 AATTTCCTAATCAGTAAATGTGG + Intronic
1059777852 9:117493785-117493807 AGATCCTGATTCAGTAAGTTTGG - Intergenic
1059780692 9:117523227-117523249 AGTTTCTGATTCAGTAGGTTGGG + Intergenic
1059840634 9:118211657-118211679 AGGTTCCGATTTAGTAGGTCTGG - Intergenic
1059847913 9:118302222-118302244 AGGTTCTAATTCAGTAAGTCTGG + Intergenic
1059915050 9:119090073-119090095 AGTTTCTCATTCAGTATGTCTGG + Intergenic
1059948302 9:119435703-119435725 AGTTTCTGATTCAGTAGCAGGGG + Intergenic
1059971482 9:119673206-119673228 ATTTTCTGATTCAGTAAGTCTGG + Intergenic
1060237589 9:121876824-121876846 AGTTTCTGAGTCAGTAGGTCTGG - Intronic
1060363257 9:122981578-122981600 AGTTTCCAATTAACTAAGTCTGG - Intronic
1060411455 9:123403084-123403106 AGATGCCGAGTCAGTAGGTGAGG - Intronic
1060762556 9:126268102-126268124 AGTTTCTGCTTCAGTAGGTCTGG - Intergenic
1060818715 9:126649514-126649536 AGTTTCTGATTTAGTGAGTCTGG + Intronic
1060883033 9:127131930-127131952 AGTTTCTGATTCAGTAAATCTGG + Intronic
1060917418 9:127399259-127399281 AGATTCCGATGCAGTAGGTCTGG - Intronic
1060977395 9:127772800-127772822 AGTTTCCCAATCTGTAAGTGGGG + Intronic
1062343318 9:136103464-136103486 AGATTCCGATTCAGCAGGTCTGG - Intergenic
1203656082 Un_KI270752v1:26064-26086 AGATTGGGATCCAGTAAGTGTGG + Intergenic
1186375279 X:8992007-8992029 AGGTTCCGATTCAGTAGGTCTGG + Intergenic
1186570770 X:10712771-10712793 AGTTTCTGATTCTGTATGTCTGG - Intronic
1186587905 X:10896441-10896463 AGATTCTGATTCAGTAGGTTTGG - Intergenic
1186625037 X:11284244-11284266 AGTTTCAGATTCAGTAGGTGTGG + Intronic
1186693561 X:12005247-12005269 AGGTTCCGATTCAGTAGGTCTGG + Intergenic
1186779557 X:12899236-12899258 AGCTTCTGATTCAGTAGGTCTGG + Intergenic
1186839337 X:13469468-13469490 AGTTTCTGATTCAGTAAGTCTGG + Intergenic
1186891048 X:13959589-13959611 AGTTTCCGATTCAGCAGGTCTGG + Intergenic
1186926668 X:14340740-14340762 GGTGTCTGATTCAGTAAGTCTGG - Intergenic
1186985858 X:15012745-15012767 AGTTTCCAATTCAGTAGGTCTGG - Intergenic
1187117862 X:16371717-16371739 AGTTTCTGATTCAGTAGCTCTGG + Intergenic
1187120759 X:16403990-16404012 AGATTCTGATTCAGTGAGTCTGG + Intergenic
1187233200 X:17441993-17442015 AGTTTCTGATTTAGTAGGTCTGG + Intronic
1187305346 X:18090365-18090387 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1187345783 X:18462416-18462438 AGTTTCTGAATCAGTAGGTCTGG - Intronic
1187432148 X:19234851-19234873 AGTGTCTGATTCAGTAGGTCTGG + Intergenic
1187433442 X:19245360-19245382 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1187465854 X:19527077-19527099 AATTTCTGATTCAGGAAGTCTGG + Intergenic
1187566490 X:20454654-20454676 AGATTCTGATTCAGTAGGTCTGG + Intergenic
1187577547 X:20574398-20574420 AGTTCCTGATTCAGTAAGCCTGG - Intergenic
1187819936 X:23276658-23276680 AATTTCTGATTCATTAAGTTTGG - Intergenic
1187827382 X:23345599-23345621 AGTTTCTGAGTCAGTAGGTCTGG + Intronic
1187882229 X:23857950-23857972 AGCTTCTGATTCAGTCAGTCTGG + Intronic
1187962941 X:24583885-24583907 AGATTCAGATTCAGTAGGTCTGG - Intronic
1187969985 X:24649380-24649402 AATTTCTGATTCAGTAGGTCTGG - Intronic
1188009792 X:25043512-25043534 AGTTTCTAATTCAGTAGGTCTGG + Intergenic
1188286956 X:28338934-28338956 AGCTTCTGATTCAGTAGGTCTGG + Intergenic
1188355009 X:29179891-29179913 AGTATCCGATTCAGAAAGTTGGG + Intronic
1188362680 X:29275227-29275249 AGTTTCAGATTCAGAAGGTCTGG - Intronic
1188398307 X:29713561-29713583 AGTTTTTGATTCAGTAGGTCTGG - Intronic
1188410332 X:29864093-29864115 AGCTTCTAATTCAGTAAATGTGG + Intronic
1188710406 X:33390127-33390149 AGTCTCTGATGCAGTAGGTGGGG - Intergenic
1189122520 X:38409587-38409609 GGTTTCTGATTCAGTAGGTCAGG + Intronic
1189148377 X:38678917-38678939 AGATTCTGATTCAGTAGGTCTGG + Intronic
1189236861 X:39493884-39493906 AGTTTCTGATTCAGTAGGTGTGG - Intergenic
1189342164 X:40212243-40212265 AGGTTCTGATTCAGTAGGTCTGG - Intergenic
1189575752 X:42351310-42351332 AGTTTCTGATTCCATAAGTGTGG + Intergenic
1189856095 X:45226652-45226674 AGTTTCTGATTCAGTAGATCGGG - Intergenic
1190702887 X:53001210-53001232 AGTTTCTGATTCAGTGGGTCTGG + Intergenic
1190827637 X:54032231-54032253 AGTTTCTGATTCAGTCAGTCTGG + Intronic
1190887071 X:54539659-54539681 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1191025831 X:55912160-55912182 AGTTTCTGAATCAGTATGTCTGG - Intergenic
1192012675 X:67291817-67291839 AGATTCAGATTCAGTAGGTGTGG - Intergenic
1192274956 X:69619068-69619090 AGATTCTGATTCAGTAAATAAGG + Intronic
1192305535 X:69955764-69955786 AGTTTCCTCATCAGTAAGTAGGG - Intronic
1192415709 X:70978663-70978685 AGATTCTGATTCAGTAGGTTTGG - Intergenic
1194011842 X:88571175-88571197 AGTTTCTGATTCAGCAAGTCTGG + Intergenic
1194312687 X:92332806-92332828 AGTTTTGGATTCAGTAGGTCTGG - Intronic
1194396044 X:93387629-93387651 AGCTTCTGATTCAGTAGGTTTGG + Intergenic
1194582387 X:95691980-95692002 AGATTCCAATTCAGTAGGTCTGG + Intergenic
1195085967 X:101414927-101414949 AGTTTCCAATTCAGTAGTTTTGG + Intergenic
1195086124 X:101416185-101416207 AGTTTCTGATTCAGTCCTTGGGG - Intergenic
1195400633 X:104457809-104457831 AGTTTCCAATTCACTAGGTTAGG + Intergenic
1195669194 X:107454894-107454916 AGCTTCTGATTCAGTAGGTCTGG + Intergenic
1195954383 X:110314025-110314047 AGTTTCTGATTCAGTTGGTGTGG - Intronic
1196035313 X:111137419-111137441 AGATTCAGATTCAGTTAGTCTGG - Intronic
1196049606 X:111291012-111291034 AGTTTCTGATCCAGTATATGTGG + Intergenic
1196117713 X:112015340-112015362 AGTTTCTGATTCAGTAGGGCTGG + Intronic
1196309990 X:114152502-114152524 AGTTTCATATTCAATAAGTTTGG + Intergenic
1196512400 X:116527794-116527816 AGTTTTCGATTCAGGATGTCTGG + Intergenic
1196565571 X:117200375-117200397 AGATTCTGATTTAGTAAGTCTGG + Intergenic
1196614153 X:117748517-117748539 AGTTTCTGATTCTGTAGGTCTGG - Intergenic
1196764266 X:119228705-119228727 AGATTCTGATTCAGTATGTCTGG + Intergenic
1196963953 X:121035157-121035179 AGTTTCTGATTCAGTAAATCTGG - Intergenic
1197252797 X:124232734-124232756 AGTTTCTGATTCAGCAAGTCTGG + Intronic
1197280942 X:124535175-124535197 AGTTTCTGATTTAGTAGGTCTGG + Intronic
1197310407 X:124898188-124898210 AGTTTCTGATTCAGCAGGTGTGG + Intronic
1197536960 X:127702163-127702185 AGGTTCTGATTCAGTAGGTTTGG - Intergenic
1197802555 X:130367047-130367069 AGATTCTGATTTAGTAAGTATGG + Intronic
1197890566 X:131265935-131265957 AGATTCTGATTCAGTAGGTCTGG - Intergenic
1197961001 X:132006137-132006159 TGTTTCTGATTCAGTAGGTCTGG - Intergenic
1197999913 X:132422858-132422880 AGTTTCTGATTCAGTAGGTGTGG + Intronic
1198047946 X:132921297-132921319 AGATTCTGATTCAGTAGGTCAGG - Intronic
1198085457 X:133278102-133278124 AGATTCTGATTCAGTAAGTCTGG - Intergenic
1198090707 X:133326406-133326428 GGTTTCTGATTCAGTAACTCTGG - Intronic
1198482238 X:137051971-137051993 AATTTCCCCTTCTGTAAGTGGGG + Intergenic
1198559142 X:137829812-137829834 AGTTTTTGATTCAGTAGGTTTGG - Intergenic
1198562055 X:137861085-137861107 AGTTTCTGATTCAGTAGAAGTGG + Intergenic
1198687752 X:139245630-139245652 AGTTTCTGATTCAGTAGATTTGG + Intergenic
1198793911 X:140375588-140375610 AGTTTCTGATTCAGTAGGTCTGG - Intergenic
1199115634 X:143988808-143988830 AGTTTCTGATTCAGTAGGTCTGG + Intergenic
1199725470 X:150575648-150575670 AGTTTCTGATTCAGTAGGTCTGG + Intronic
1199766350 X:150944428-150944450 AGTTTCTGATTCAATAGGTCTGG + Intergenic
1199936147 X:152575491-152575513 AGTTTCTGACTCAGTAAGTCTGG - Intergenic
1200749974 Y:6935957-6935979 AGTTTGTGATTCAGTGAATGAGG + Intronic
1200766921 Y:7087985-7088007 AGTTTCTGTTTGAGTAAGTAAGG + Intronic
1201470657 Y:14331140-14331162 AGATTCTGATTCAGTAGGTCTGG + Intergenic