ID: 976064166

View in Genome Browser
Species Human (GRCh38)
Location 4:81164665-81164687
Sequence TTTCCGATTCAGTAAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 1, 2: 35, 3: 264, 4: 768}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976064153_976064166 23 Left 976064153 4:81164619-81164641 CCCACCATTAGAGTGTTAGGTGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 976064166 4:81164665-81164687 TTTCCGATTCAGTAAGTGTGGGG 0: 1
1: 1
2: 35
3: 264
4: 768
976064156_976064166 19 Left 976064156 4:81164623-81164645 CCATTAGAGTGTTAGGTGTGGAT 0: 1
1: 0
2: 2
3: 7
4: 107
Right 976064166 4:81164665-81164687 TTTCCGATTCAGTAAGTGTGGGG 0: 1
1: 1
2: 35
3: 264
4: 768
976064154_976064166 22 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064166 4:81164665-81164687 TTTCCGATTCAGTAAGTGTGGGG 0: 1
1: 1
2: 35
3: 264
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976064166 Original CRISPR TTTCCGATTCAGTAAGTGTG GGG Intronic
900899881 1:5509199-5509221 TTTCTGACTCAGCAGGTGTGGGG - Intergenic
901587518 1:10310260-10310282 TTTCTGATTCACTAGGTCTGGGG + Intronic
902182039 1:14696708-14696730 TTTCTGATTCAGCAGGTCTGGGG + Intronic
902186136 1:14726789-14726811 TTTCTGATTCAGCAGGTCTGGGG - Intronic
902212550 1:14914144-14914166 TTTCTGATTCAGGAGGTCTGGGG + Intronic
902247144 1:15128534-15128556 TTTCTGATTCACTAGGTGTGGGG + Intergenic
902586810 1:17444510-17444532 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
902959458 1:19952367-19952389 TTTCTAATTCAGTAAGTGTGGGG - Intergenic
903488634 1:23710433-23710455 TCTCTGATTCAGTAAATCTGGGG + Intergenic
903573519 1:24323310-24323332 TTTCTGATTCAGTAGGTCTAGGG - Intronic
903631873 1:24780707-24780729 ATTCCGATTCAGTAAATCTGGGG - Intronic
903831845 1:26180167-26180189 TTTCTGATTCAGCAGGTGTGGGG + Intronic
904245615 1:29185730-29185752 TTTGGAATTCAGTAAGTGTGAGG + Intergenic
904683615 1:32245654-32245676 TTTCAGATTCAGTATGTATGGGG - Intergenic
904727245 1:32558774-32558796 TTTGGAATTCAGTAAGTTTGAGG + Intronic
904798327 1:33074264-33074286 TTTCTGATTCAATAGGTTTGGGG - Intronic
904976316 1:34459668-34459690 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
905091201 1:35432765-35432787 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
905144969 1:35881259-35881281 TTTTCGATTCAGTAGGTGTTGGG - Intronic
905461397 1:38125212-38125234 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
905556414 1:38888748-38888770 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
905588470 1:39141315-39141337 GTTCTGATTCAGTAGGTCTGGGG + Intronic
907086204 1:51677175-51677197 TTTCTGATTCAGCAAGTGAGGGG - Intronic
907344549 1:53764129-53764151 TTTCTGATTCAGTAAGTCTAGGG - Intergenic
907399123 1:54213658-54213680 TTTCTGATTCAGCAGGTCTGGGG - Intronic
907553974 1:55328740-55328762 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
907575313 1:55521059-55521081 TTTCTGATTCAGTGGGTTTGTGG + Intergenic
907634906 1:56124658-56124680 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
907936362 1:59045848-59045870 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
907952574 1:59197781-59197803 TTTCTGATTCAGTGAGTCTGGGG + Intergenic
908197160 1:61756421-61756443 TTACTGATTCAGTAGGTCTGAGG - Intronic
908391791 1:63689838-63689860 ATTCCGATTCAGTAAGTCTGGGG + Intergenic
909347891 1:74614083-74614105 TTTCTGATTCAGTACGTCTGTGG + Intronic
909430805 1:75585509-75585531 TTTCTGATTCAGTAGGTCTGAGG + Intronic
909500918 1:76334827-76334849 TTTCCGATTCAGTAGATGTGAGG + Intronic
909569040 1:77087377-77087399 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
909600859 1:77459566-77459588 TTTCTGATTCAATAGGTCTGAGG + Intronic
910728812 1:90368044-90368066 ACTCAGATTCAGTAAGTCTGTGG + Intergenic
910806585 1:91194428-91194450 TTTCTGATTCAGTAGGTCTAGGG - Intergenic
910965276 1:92802184-92802206 TTTCTGATTTAGTAGGTGTTAGG + Intergenic
911049252 1:93655699-93655721 TTTGCTATTCAGTAGTTGTGTGG - Intronic
911417134 1:97589026-97589048 TTGCTGATTCAGTAAGTCTGGGG - Intronic
911477591 1:98392363-98392385 TTTCAAATTCAGTAGGTATGGGG + Intergenic
912208929 1:107537579-107537601 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
912324046 1:108741047-108741069 TTTCTGATTCAATAGGTCTGTGG - Intronic
912345660 1:108961302-108961324 ATTCTGATTCAGTAAATCTGAGG + Intronic
912477971 1:109953743-109953765 CTTCTGACTCAGTAAGTCTGAGG - Intergenic
913062210 1:115218918-115218940 ATTCAGATTCAGTAGGTCTGGGG + Intergenic
913070831 1:115297159-115297181 TTTCTGATTCAGTAGGTTTGTGG - Intronic
913318642 1:117573838-117573860 TTTCTAATTCAGTAGGTCTGAGG + Intergenic
913366540 1:118045848-118045870 TTGCAGATTCAGTCGGTGTGGGG + Intronic
913439954 1:118886744-118886766 TCTCTGATTCTGTAAGTCTGGGG + Intronic
913454582 1:119018297-119018319 CTTCTCATTCAGTAGGTGTGGGG + Intergenic
914390423 1:147216791-147216813 GTTCTGATTCAGTAGGTCTGAGG - Intronic
916196911 1:162233116-162233138 TTTCTGCTTCAGTAGGTCTGAGG + Intronic
916213026 1:162373772-162373794 TTTCTGATTCAGTAGGTCTGAGG + Exonic
916701424 1:167299873-167299895 GTTCTGATACAGTAGGTGTGAGG + Intronic
917057332 1:170997470-170997492 ATTCTGATTCAGTAGGTCTGAGG - Intronic
917283649 1:173402812-173402834 TTTCTGATTCAGGGAGTCTGAGG + Intergenic
917596078 1:176530358-176530380 TGTCCCATTGAGTAACTGTGTGG - Intronic
917640925 1:176982471-176982493 TGTCTGATTCAGTAGGTCTGGGG + Intronic
917772572 1:178295669-178295691 TTTCTGATGCAGTAGGTCTGGGG + Intronic
917795744 1:178531733-178531755 ATTCTGATTCAGTAGGTCTGGGG - Intronic
917924806 1:179780603-179780625 TTTCTGATTCAGCAGGTCTGGGG - Intronic
918468092 1:184842314-184842336 TTTCTGATTCAATAGGTCTGGGG + Intronic
918474822 1:184912931-184912953 TTTCTGATTCAGTAGGCCTGGGG - Intronic
918858023 1:189783652-189783674 TTTTTGATTCAGTAGGTTTGGGG + Intergenic
919939154 1:202274617-202274639 GTTCTGATTTAGTAAGTCTGGGG + Intronic
920128933 1:203715946-203715968 TTTCCAATTCAGTAAATCTGGGG - Intronic
920372987 1:205491461-205491483 TTTCCTAGTCACTCAGTGTGAGG - Intergenic
920411892 1:205768487-205768509 ATTCTGATTCAGTAGGTTTGAGG + Exonic
921124131 1:212161972-212161994 ATTCTGATTCAGTGAGTCTGAGG - Intergenic
921215526 1:212933713-212933735 ATTCTGATTCAGTGAGTCTGGGG - Intergenic
921286265 1:213612151-213612173 ATTCAGATTCAGTAGGTCTGGGG - Intergenic
921315849 1:213889624-213889646 TTTCTGTTTCAGAAAATGTGGGG + Intergenic
921424131 1:214982872-214982894 TTTCTGATTCAGTAGGTCTGAGG - Intergenic
921834013 1:219759453-219759475 TTTCAGATTAAGTATGTCTGGGG - Intronic
922033086 1:221823300-221823322 TTTCTGATTCAGTAGGTCTTGGG + Intergenic
922063054 1:222109902-222109924 TTTCAGATTCAGTAGGTCTGGGG - Intergenic
922121356 1:222672508-222672530 TTTCGGATTCAGGATGTCTGGGG + Intronic
922408300 1:225341995-225342017 GTTCAGATTCAGTAAGTCTGTGG - Intronic
924098740 1:240582023-240582045 TGTCTGATTCAGGAAGTCTGGGG + Intronic
924308136 1:242712948-242712970 TTTTGGATTCAATAAGTTTGGGG - Intergenic
924612460 1:245585148-245585170 TTTCTGATTCAGTGGGTCTGGGG - Intronic
924737720 1:246773484-246773506 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1063480993 10:6376312-6376334 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1063686944 10:8246002-8246024 TTTCTGATTTAGTATGTCTGGGG + Intergenic
1063837793 10:10035408-10035430 TTTCTGATTTAGTAGGTTTGCGG + Intergenic
1064468744 10:15613566-15613588 ATTTGGATTCAGTAAGTCTGGGG - Intronic
1064818517 10:19295853-19295875 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1064847816 10:19675528-19675550 TTTCTGATTCATTAAGTCTGGGG - Intronic
1065308837 10:24394958-24394980 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1065476579 10:26144832-26144854 TTTCTGACTCAGTAGGTTTGGGG - Intronic
1065636437 10:27741006-27741028 TTTCGGATTCAGCAGGTCTGGGG - Intronic
1065738598 10:28776112-28776134 ATTCTGATTCAGTAAATCTGGGG + Intergenic
1066112530 10:32210115-32210137 TGTCCGCTTCAGTAGGTCTGAGG - Intergenic
1067076942 10:43193310-43193332 TTGCCAATTCAGGAGGTGTGTGG + Intergenic
1067176762 10:43955490-43955512 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1067717399 10:48699970-48699992 TTTACAAGTCAGTAAGTCTGGGG - Intronic
1067740477 10:48891678-48891700 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1067938679 10:50634011-50634033 TTTCTGATTCAGTAGGTCCGGGG - Intergenic
1067974303 10:51006902-51006924 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1068410885 10:56652924-56652946 GTTCTGATTCAGTTAGTCTGGGG - Intergenic
1069084006 10:64118494-64118516 TTTCTGATTCAGTCTGTGTGGGG - Intergenic
1069374338 10:67778862-67778884 ATTCTGATTCAGTAGATGTGGGG + Intergenic
1069539238 10:69281221-69281243 TTTTCCATTCAGTAGGTCTGTGG + Intronic
1069827748 10:71264730-71264752 GTTCTGATTCAGTCGGTGTGGGG - Intronic
1070045137 10:72826145-72826167 ATTCTGATTCAGTAAGTCAGAGG + Intronic
1070225553 10:74500478-74500500 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1070407175 10:76107281-76107303 TTTGGGATTTAGTAAGTCTGGGG + Intronic
1070501174 10:77073743-77073765 TTTCTGATTCAGTAGATCTGGGG + Intronic
1070514260 10:77189093-77189115 TTTCTGATTTAGTAGGTTTGGGG + Intronic
1070644081 10:78189386-78189408 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1070804373 10:79262282-79262304 TTTCTGATTCAGTGGGTCTGGGG - Intronic
1070935154 10:80288344-80288366 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1071320095 10:84446396-84446418 TCTCCGATTCACTGTGTGTGGGG + Intronic
1072026322 10:91462553-91462575 TTTCAGATTCAGTAGGTCTTGGG + Intronic
1072109541 10:92305543-92305565 TTTCTGATTCTGTAGGTCTGGGG + Intronic
1072437135 10:95424098-95424120 CTTCTGATGCAGTAAGTATGAGG + Intronic
1072479129 10:95793618-95793640 TTTCTGATTCAGTAAGTCTGAGG - Intronic
1072499390 10:95997727-95997749 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1072576037 10:96701118-96701140 ATTCCTATTCAGTAGGTCTGGGG + Intronic
1072976250 10:100061482-100061504 TTTCTGATTCAGTAGGTACGAGG + Intronic
1072989542 10:100178600-100178622 TTTCTGATTCAATAGGTCTGGGG - Intronic
1073755278 10:106574628-106574650 TTTCTAATTCAGTAGGTATGGGG + Exonic
1074310844 10:112322065-112322087 TTTCTGACTCAGTAGGTCTGGGG - Intergenic
1074685131 10:115954910-115954932 TTTCTCATTCAGTAGGTCTGGGG + Intergenic
1074888255 10:117711963-117711985 TTTGTGATTCAGTAAGTCTACGG + Intergenic
1074963948 10:118472479-118472501 ATTCTGATTCAGTAGGTATGGGG - Intergenic
1075184940 10:120247589-120247611 TTTCAGAATCTCTAAGTGTGGGG - Intergenic
1075437379 10:122455052-122455074 TTTCTGATTCAATAGGTCTGGGG - Intronic
1078268725 11:9774930-9774952 ATTCTGATTCAGTAGGTTTGGGG - Intergenic
1078370735 11:10742627-10742649 TTTCTGATTCAGTAGGTATGGGG - Intergenic
1078814298 11:14803498-14803520 TTTCTGATTCACTAAGTCTTGGG - Intronic
1078844398 11:15108313-15108335 TTTCTGATTCAGTCGCTGTGGGG + Intergenic
1078844514 11:15109274-15109296 TTTCTGAGTCAGTAGGTGGGTGG - Intergenic
1078949590 11:16115305-16115327 TTTCTGATTCAGTAGGTATGGGG - Intronic
1079442669 11:20531076-20531098 TTTCCAATTCAGCAGGTTTGGGG + Intergenic
1079637361 11:22760370-22760392 TTTCTGATTTAGTAAGTCTTGGG - Intronic
1079989440 11:27231478-27231500 TCTCTGATTAAGTAAGTCTGGGG + Intergenic
1080629983 11:34065464-34065486 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1080757378 11:35215087-35215109 TTCCTGATTCAGTAGGTCTGGGG + Intronic
1080758909 11:35228830-35228852 TTTCTGATTCAGCAGGTTTGGGG + Intronic
1080873103 11:36253973-36253995 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1080960875 11:37158373-37158395 TTTCTGATTCAGCATGTCTGAGG - Intergenic
1081315735 11:41626881-41626903 ATTCACATTCAGTAAGTCTGAGG + Intergenic
1081684269 11:45030550-45030572 TTCCTGATTCAGTAAGTCTGGGG - Intergenic
1082736642 11:56863293-56863315 ATTCTGATTCAGTTAGTCTGGGG - Intergenic
1083184501 11:61009293-61009315 ATTCTGATTCAGTAGGTCTGAGG + Intronic
1083570677 11:63760799-63760821 TTTCTGATTCAGTAACCCTGGGG + Exonic
1083977804 11:66138042-66138064 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1084069676 11:66726364-66726386 TTTACGATTCAGTACTTCTGGGG + Intronic
1084130801 11:67132815-67132837 TTTCTGGTTCAGTAAGTTTGGGG - Intronic
1084131433 11:67138760-67138782 TTTCTGATTCAGTACGTTTGGGG - Intronic
1084450342 11:69233120-69233142 GTTCTGATTCAGTCAGTGTGAGG + Intergenic
1084454307 11:69258705-69258727 TTTCTGATTCAGCAAGTCTGAGG - Intergenic
1085198147 11:74684410-74684432 GTTCCGATTCAGCAGATGTGAGG - Intergenic
1085389607 11:76175746-76175768 TTTCCAATTCGGTAGGTCTGGGG + Intergenic
1085389801 11:76176559-76176581 TTTCCAATTCGGTAGGTCTGGGG + Intergenic
1085617954 11:78016004-78016026 ATTCTGATTCAGTAGGTCTGAGG + Exonic
1085916998 11:80902472-80902494 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
1086259980 11:84927892-84927914 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1086980073 11:93186885-93186907 TTTCCCACTCAGTAAGTCTGGGG + Intronic
1087679218 11:101200496-101200518 TTTTCTATTCAGTAGGTGAGGGG - Intergenic
1088001706 11:104889586-104889608 TTTCTTATTCAGTAGGTCTGGGG - Intergenic
1088496514 11:110436597-110436619 TTTGTGACTCAGTAAGTCTGGGG - Intronic
1088567664 11:111189873-111189895 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1088573254 11:111243593-111243615 ATTCTGATTCAGTCAGTCTGGGG + Intergenic
1088918531 11:114245003-114245025 TTGCCGATTCAGTAAGGAGGGGG + Intronic
1089024732 11:115257881-115257903 TTTCAGATTCAGCAGGTGCGAGG + Intronic
1089087615 11:115836598-115836620 TTTCTAATTCAGTAGGTATGGGG - Intergenic
1089145917 11:116329651-116329673 TTTCCGGTTCAGGAAGTGGGAGG + Intergenic
1089154032 11:116386776-116386798 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1089226340 11:116925583-116925605 TTTCCAAGTCATTAAGTTTGTGG + Intronic
1089412734 11:118260456-118260478 TTTCTAATTCAGTAGGTCTGGGG - Intronic
1089807792 11:121106889-121106911 TTTCTGACTCAGTAGGTGTGGGG - Intronic
1089996019 11:122908261-122908283 TTTCTGATTCAGCAGGTGTAGGG + Intronic
1090344182 11:126054677-126054699 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1090349811 11:126100852-126100874 TGGCCGATTCACTCAGTGTGGGG - Intergenic
1090479361 11:127054630-127054652 ATTCTGATTCAGTAGGTCTGAGG - Intergenic
1091336906 11:134777733-134777755 TTTTCAAGTCAGGAAGTGTGAGG - Intergenic
1091520815 12:1239894-1239916 GTTTTGATTCAGTAAGTTTGGGG + Intronic
1091805270 12:3351451-3351473 ATTCTAATTCAGTAAGTCTGGGG + Intergenic
1092234381 12:6797083-6797105 TTTCTGATTCAGCAGGTCTGGGG + Intronic
1092661454 12:10742948-10742970 TTTCCGATTCACTAGGTCTGGGG - Intergenic
1093133251 12:15417573-15417595 ATTCTGATTTAGTAAGTCTGGGG - Intronic
1093365379 12:18289641-18289663 TTTCTGATTCAGTAGATCTGTGG - Intronic
1093947071 12:25121127-25121149 TTTCGGATTCAGTAAGTTTGAGG + Intronic
1094182556 12:27607562-27607584 TTCCTGATTCAGTAGGTGTGGGG + Intronic
1094651161 12:32377101-32377123 ATTCGGATTCATTAGGTGTGGGG - Intronic
1094697930 12:32840127-32840149 TTTCTGATTCAGAAGGTCTGGGG + Intronic
1095659234 12:44709712-44709734 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1095797547 12:46236828-46236850 ATTCTGATTCTGTAAGTCTGGGG - Intronic
1096657610 12:53101454-53101476 TTCCTGATTCAGGAGGTGTGGGG + Intronic
1096661524 12:53128141-53128163 TTTCTGATTCATTAAGTCTGGGG + Intergenic
1097061854 12:56290939-56290961 GTTTGGATTCAGTAAGTCTGAGG - Intronic
1097283015 12:57857004-57857026 TTTCTGATTCAGTAGGTGTGAGG - Intergenic
1097361816 12:58666566-58666588 TTTTTGATTCAGTAAGTCTAAGG - Intronic
1097972602 12:65650579-65650601 TTTTTGATTCAGTAAGTCTGGGG - Intergenic
1098114551 12:67161251-67161273 TTTCTGATTCAGTAGGTTTGTGG + Intergenic
1098136204 12:67405108-67405130 ATTCTGATTCAGGAAGTCTGGGG + Intergenic
1098325277 12:69295866-69295888 TTTTGAAATCAGTAAGTGTGAGG - Intergenic
1099277625 12:80597776-80597798 TTTTTGATTCAGTAAGTCTGGGG + Intronic
1099543383 12:83944279-83944301 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1099937034 12:89138667-89138689 TTTCAGATTCAGTAAGCCTGGGG - Intergenic
1100377548 12:94031331-94031353 ATTCAGATTCAGTTCGTGTGGGG - Intergenic
1100436267 12:94574043-94574065 TTTCATATTCAGCCAGTGTGTGG - Intronic
1100559555 12:95734377-95734399 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1100803879 12:98261189-98261211 TTTCTGATTCAGTAAGCCTGAGG - Intergenic
1101017369 12:100515950-100515972 ATTCTGATTCAGTAAGTCTGGGG - Intronic
1101076238 12:101132464-101132486 TTTCTGATTCAGTAAGTATATGG + Intergenic
1101400043 12:104379300-104379322 TTTCTCATTCAGTAGGTCTGGGG + Intergenic
1101587490 12:106097818-106097840 TTTCCAATTCAGCAGGTCTGGGG + Intronic
1101760220 12:107652229-107652251 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1101860644 12:108479727-108479749 TTTCCATTTCAGTAGGTCTGGGG + Intergenic
1102753759 12:115320137-115320159 ATTCTGATTCAGTAAGTACGAGG - Intergenic
1102785489 12:115600930-115600952 ATTCCCATTCAGTAGGTCTGGGG - Intergenic
1102922714 12:116804314-116804336 TTTCTGAATCAGTAGGTCTGGGG - Intronic
1102939718 12:116928775-116928797 ATTCAGATTCAGGAAGTCTGCGG + Intronic
1103290328 12:119840354-119840376 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1103439891 12:120955242-120955264 TTTCTGATTCAGCAGGTTTGAGG + Intergenic
1103618486 12:122170912-122170934 CTTCCGATTCAGTAGGTCTGGGG + Intronic
1103959643 12:124600956-124600978 TGTCCGATTCAGCAGGTTTGGGG + Intergenic
1104036443 12:125100708-125100730 TGTCCGATTCATTAGGTCTGGGG + Intronic
1104423547 12:128656622-128656644 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1105054205 12:133081914-133081936 TTTCTGATTCAGAAGGTCTGGGG - Intronic
1105982053 13:25527360-25527382 ATTCTGATTCAGTACGTCTGGGG - Intronic
1106114837 13:26808428-26808450 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1106478364 13:30117210-30117232 TTTCAGATTCAGTAGTTCTGGGG - Intergenic
1106506780 13:30377256-30377278 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
1106527831 13:30558821-30558843 TTTCTGATTCAGTGGGTCTGGGG - Intronic
1106708012 13:32302063-32302085 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1106949152 13:34863412-34863434 TTTCTGATTCAGTAGATCTGTGG + Intergenic
1107594833 13:41952163-41952185 TTTCTAATTCAGTAGGTCTGAGG - Intronic
1108020428 13:46122373-46122395 ATTCTGATTCAGTACGTCTGGGG + Intergenic
1108117553 13:47146087-47146109 ATTCCGATTCAGTAGGTCTGGGG + Intergenic
1108148759 13:47508543-47508565 GTTCTGATTCAGTAGGTTTGGGG - Intergenic
1108225109 13:48281308-48281330 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1108674941 13:52728441-52728463 TTTCCCATTCAGTAGGTCTGGGG + Intronic
1109218107 13:59613366-59613388 TATCTGATTCAGTAGGTCTGGGG + Intergenic
1109513792 13:63414450-63414472 TTTCTGATTCAGTAGGCCTGAGG + Intergenic
1109657819 13:65417210-65417232 TTTTAAATTCAGTAAGTATGTGG + Intergenic
1109786792 13:67186468-67186490 ATTCTGATCCAGTAGGTGTGGGG + Intronic
1110370253 13:74731895-74731917 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1110422821 13:75332606-75332628 TTTCTGATTAAGTAGGTCTGGGG + Intronic
1110435105 13:75470438-75470460 TTTTTGATTCAGTAAGTCTAGGG - Intronic
1110499812 13:76213870-76213892 TTTCTGATTCAGTAGATTTGGGG + Intergenic
1110507075 13:76299370-76299392 TTTCTGATTTAGTCAGTGAGTGG - Intergenic
1110648554 13:77917755-77917777 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1110713635 13:78677061-78677083 ATTCTGATTCTGTAAGTGGGGGG - Intergenic
1111134821 13:84027506-84027528 TTTCCAAATCAGTAATTCTGGGG - Intergenic
1111888667 13:94054429-94054451 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1111958041 13:94779678-94779700 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1111981395 13:95019354-95019376 TTTCTGATTCAGTAGATCTGCGG + Intergenic
1112290465 13:98141653-98141675 CTGCCGATTCAGTAGGTTTGGGG - Intergenic
1112646217 13:101335307-101335329 TTTCAGTTTAAGTAAGTCTGTGG + Intronic
1113157833 13:107345381-107345403 TTTCAAAATCAGAAAGTGTGAGG - Intronic
1113333740 13:109357744-109357766 TTTCTGATTCACTAGGTCTGGGG + Intergenic
1113780133 13:112972017-112972039 TTTCTGATTCAGGAAGTCTGGGG + Intronic
1114288211 14:21265959-21265981 TTTCTAATTAAGTAAGTCTGGGG - Intronic
1114838698 14:26235625-26235647 TTTCCGATGATGTAAGTTTGGGG + Intergenic
1115200937 14:30853519-30853541 TTTCTGATTCAGTATGTGTGGGG - Intergenic
1115272348 14:31567824-31567846 TTTCTGATTCAGTAAGCCTAGGG - Intronic
1115301149 14:31886972-31886994 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1115352784 14:32413529-32413551 TTTGTGATTCAGTAACTGTGAGG - Intronic
1115424609 14:33243463-33243485 TTTCTGATTCAGTAAGTCTATGG + Intronic
1116609123 14:47044667-47044689 TTTCTGATTTACTATGTGTGAGG - Intronic
1117012702 14:51487040-51487062 TTTCTGATGCAGTAGGTCTGGGG - Intergenic
1117055872 14:51911455-51911477 TTTCCCAGTCAGTAAGTGGAGGG - Intronic
1117736030 14:58769458-58769480 ATCCTGATTCAGTGAGTGTGGGG - Intergenic
1117759934 14:59015846-59015868 TTTAGGATTCAGGAGGTGTGTGG + Intergenic
1118006297 14:61566878-61566900 ATTCTGATTCAGTCAGTCTGGGG + Intronic
1118030704 14:61815130-61815152 TTCCTGATTCAGTAAGTCTGGGG + Intergenic
1118175331 14:63434029-63434051 TTTTCATTTCAGTAATTGTGGGG + Intronic
1118581358 14:67302215-67302237 TTTCTGAAGCAGAAAGTGTGGGG + Intronic
1118626990 14:67668766-67668788 TTTCTGATTCAATAGGTCTGGGG + Intronic
1118851273 14:69585634-69585656 ATTACAATTCAGTAAGTTTGCGG - Intergenic
1119131826 14:72179821-72179843 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1119192970 14:72696836-72696858 TTTCTGATTCAGTCAGTCTGGGG - Intronic
1119661201 14:76453044-76453066 TCTCAGATTCAGTAGGTCTGGGG - Intronic
1119893472 14:78200479-78200501 TGTCAGATTCAGGAAGTCTGGGG - Intergenic
1120453561 14:84702441-84702463 TTTCTGATTCAGTAGGTGTCAGG + Intergenic
1120472283 14:84940662-84940684 TTTCTGATTCATTAGGTCTGAGG + Intergenic
1120895910 14:89532066-89532088 TTTCTGATTCAGGAGGTCTGGGG - Intronic
1120909558 14:89653721-89653743 TTTCTGACTCAGTAAGTGTGGGG + Intergenic
1121179954 14:91921558-91921580 TTTCTGACTCAGTAGGTCTGGGG - Intronic
1121489370 14:94346807-94346829 ATTCTGGTTCAGTAGGTGTGCGG + Intergenic
1121626974 14:95392702-95392724 TTTCTGATTAAGTAAAGGTGGGG + Intergenic
1121746962 14:96304171-96304193 TTTCTGATTCAGGAAGTCTGAGG - Intronic
1122500419 14:102194411-102194433 TTTCTGATTCATTTAGTCTGGGG + Intronic
1123470255 15:20545779-20545801 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1123647800 15:22454921-22454943 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1123727706 15:23121106-23121128 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1123730554 15:23140756-23140778 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1123748692 15:23338182-23338204 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1124281066 15:28362065-28362087 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1124301636 15:28549556-28549578 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1124531652 15:30513480-30513502 TTTCTGATTCAGGAGGTGTGGGG + Intergenic
1124767006 15:32494214-32494236 TTTCTGATTCAGGAGGTGTGGGG - Intergenic
1125096494 15:35859031-35859053 TTTGTGATACAGTATGTGTGGGG + Intergenic
1125259219 15:37802850-37802872 TTTCTGATTCAGTATGTAGGAGG - Intergenic
1125983845 15:44029772-44029794 ATTCCGATTCAGTAGGTCTGGGG + Intronic
1126168348 15:45672953-45672975 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1126197313 15:45946662-45946684 TTTCTGATTCGGTAAGTCTGGGG - Intergenic
1126333138 15:47555644-47555666 TTTCTGATTCAGAAAGTCTAAGG + Intronic
1126374975 15:47988570-47988592 TTTCCAATTCAATAGGTCTGGGG - Intergenic
1126375503 15:47992912-47992934 TTTCTGATTCAATAGGTCTGGGG + Intergenic
1126393805 15:48190195-48190217 ACTCTGATTCAGTAGGTGTGGGG - Intergenic
1126415258 15:48411695-48411717 TTTCTGATTCAGTAGTTCTGGGG - Intronic
1126646609 15:50881316-50881338 TTTCTGCTTCAGTAGGTCTGGGG + Intergenic
1126808651 15:52378848-52378870 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1126847751 15:52776938-52776960 ATTCAGGTTCAGTAGGTGTGGGG + Intronic
1127386094 15:58468388-58468410 TTTCTGATTCATTAGGTCTGGGG - Intronic
1127455225 15:59150824-59150846 TTTCTGATTCTGTAGGTCTGGGG - Intronic
1127619106 15:60716089-60716111 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1127620994 15:60734262-60734284 TTTCTGATTCAGTAGGACTGGGG - Intronic
1127634870 15:60859442-60859464 ATTCAGATTCAGTAAGTCTGGGG - Intronic
1127646971 15:60968373-60968395 TTTCTGATTCAGGAAATCTGGGG + Intronic
1127713106 15:61620872-61620894 ATTCCAATTCAGGAAGTCTGAGG - Intergenic
1127738347 15:61869827-61869849 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1127782174 15:62326787-62326809 ATTCCAATTCAGTAGGTCTGGGG - Intergenic
1127844491 15:62857323-62857345 TCTCTGATTCAGTGAGTTTGGGG + Intergenic
1127896171 15:63301100-63301122 TTTCTGATTCAGGAAGTGCGGGG + Intronic
1128287227 15:66447347-66447369 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1128804956 15:70523824-70523846 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1129448375 15:75634730-75634752 TTTCTGATTCAGGAGGTCTGGGG - Intergenic
1129486997 15:75883668-75883690 TTTCTGATTCAGTAGGTCTGTGG + Intronic
1130072412 15:80658876-80658898 GTTCTGATTCAGTAGGTCTGGGG - Intergenic
1130082276 15:80744210-80744232 ATTCTGATTCAGTGGGTGTGCGG - Intronic
1130264046 15:82382629-82382651 TTTCCTGTTCAATAACTGTGGGG - Intergenic
1130434814 15:83887111-83887133 TTTCTGACTCAGTAGGTCTGTGG - Intronic
1130505218 15:84533911-84533933 TTTCAGATTCAGTAGGTCTGTGG - Intergenic
1130527347 15:84718713-84718735 TTTTCAACTCAATAAGTGTGGGG - Intergenic
1130612941 15:85378097-85378119 ATTCTGATTCAGTAAGTCTGGGG - Intergenic
1131156013 15:90076035-90076057 TTTCTGATTCAGTAGATCTGGGG + Intronic
1131428415 15:92366456-92366478 AATCCGATTCAGTAGGTCTGGGG + Intergenic
1131446482 15:92502209-92502231 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1131481655 15:92787489-92787511 CTTCTGATTCAGTAGGTGTGGGG - Intronic
1131576112 15:93592955-93592977 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1132034624 15:98472148-98472170 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1132070910 15:98775780-98775802 TTTCCGATTCAGCAGGTCTCGGG + Intronic
1132925446 16:2426974-2426996 TTTCTGATTCAGTAAGTTTTGGG - Intergenic
1133089261 16:3390655-3390677 TTTCCGATTCAGAAGATCTGAGG - Intronic
1134648389 16:15889026-15889048 TTTCTGATTCTGTAAATCTGGGG + Intergenic
1134686633 16:16163426-16163448 ATTCCGATTCAGTCATTCTGGGG - Intronic
1134788100 16:16963120-16963142 TTTCTGACTCAGTAAGTTTAGGG + Intergenic
1134816749 16:17212152-17212174 TTTCTGATTCAGAAGGTTTGGGG - Intronic
1135404550 16:22189125-22189147 TTTCCTAGTCAGTAAGTGCAGGG - Intronic
1135490071 16:22901420-22901442 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1137267303 16:46879832-46879854 TTTCAGAATCAGCAAGTCTGGGG + Intergenic
1137734599 16:50714364-50714386 ATTCCCATTCAGTAGGTTTGGGG + Intronic
1137923952 16:52521786-52521808 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1138009571 16:53365148-53365170 TTTCTGATTCAGGAAGTGTGGGG - Intergenic
1138327412 16:56187061-56187083 TTTCTGAATCAGTAAGTTTGAGG - Intergenic
1138801151 16:60031614-60031636 ATTCCCATTCAGTAAGTCTTGGG + Intergenic
1138958014 16:61994699-61994721 TTTCTGATTCAGTACCTCTGTGG - Intronic
1139211917 16:65086354-65086376 TTCCTGATTCAGAAAGTGTGAGG + Intronic
1139279514 16:65758219-65758241 ATTCTGATTCAGTAAGTCTGGGG - Intergenic
1140854030 16:78961722-78961744 TTTCTGGTTCAGTAAGTCTGAGG + Intronic
1140977049 16:80069917-80069939 ATTCCAATTCAGTAGATGTGGGG + Intergenic
1140995419 16:80254155-80254177 TTTCTGACTCAGTAGGTTTGGGG + Intergenic
1141048361 16:80737718-80737740 TTTCCGATTCAGTAGGTCTGGGG + Intronic
1141102893 16:81210960-81210982 ATTCTGATTCAGTAAGTATGGGG + Intergenic
1141236968 16:82227888-82227910 TTTCTGATTCAGCAAGTCTAGGG - Intergenic
1141240894 16:82264270-82264292 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1143311024 17:5989336-5989358 TTTCTGATTCAGTAGGTCTGTGG - Intronic
1143351225 17:6289683-6289705 CTTCTGATTCAGTAGGTCTGAGG - Intergenic
1143444728 17:7000781-7000803 TTTCTGATTCAGTATGTCTGGGG + Intronic
1143877102 17:10000211-10000233 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1143946442 17:10596793-10596815 TTTCTGATTCAGTGAGTCTTGGG - Intergenic
1143970051 17:10788965-10788987 TTTCTGATTAAGTAGGTCTGCGG + Intergenic
1143970639 17:10792706-10792728 ATTCAGATTCAGTAGGTCTGGGG - Intergenic
1144024655 17:11267338-11267360 CTTCAGATTCAGTAGGTTTGAGG - Intronic
1144366191 17:14547205-14547227 TTTCTGATTCAGTAGCTCTGGGG + Intergenic
1144394536 17:14831399-14831421 TTTCTGATTCTGTAGGTCTGGGG + Intergenic
1144462316 17:15468045-15468067 TCTCTGATTCAGTATATGTGGGG + Intronic
1144637625 17:16920361-16920383 TTTCTGATTCAGCAGGTCTGTGG + Intergenic
1144692711 17:17279187-17279209 TTTCCTATCCAGTGAGTGTGAGG + Intronic
1144805817 17:17966520-17966542 TTTCTGTTTCAGTAGGTTTGGGG - Intronic
1146105427 17:30031288-30031310 TTTCTGATTCAGTAAATATGGGG + Intronic
1146719504 17:35113830-35113852 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1146909564 17:36639843-36639865 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1147711868 17:42472882-42472904 TGTCTGATTCAGTAAGTCTAGGG - Intronic
1148396805 17:47314702-47314724 TTTCTGATTCAGCAGCTGTGGGG - Intronic
1148538338 17:48459316-48459338 ATTCTGATTCAGCAAGTCTGGGG + Intergenic
1148539325 17:48467234-48467256 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1149026776 17:52036051-52036073 TTTCTGATTCGGTAGGGGTGGGG + Intronic
1149332116 17:55594838-55594860 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1149462101 17:56837243-56837265 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1149910592 17:60563505-60563527 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1150729427 17:67679003-67679025 TTTCTGAGTCAGTAGGTTTGGGG - Intronic
1151413349 17:73945828-73945850 TTTCTGATTCAGTAGTTCTGGGG - Intergenic
1152990624 18:360628-360650 GTTCCGATTCAGTGGGTCTGAGG + Intronic
1152993709 18:386454-386476 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1153197823 18:2620132-2620154 ATTCTGATTCAGTAGGTTTGGGG - Intergenic
1153280274 18:3408353-3408375 ATTCCAATTCAGTAGGTCTGGGG - Intergenic
1153542690 18:6173043-6173065 TTTCTGATTCAGTAGGGTTGAGG - Intronic
1153552267 18:6273957-6273979 TTTCTGATTCATTAAATCTGAGG - Intronic
1153555314 18:6306754-6306776 TTTCCATTTCAGTAAGTATAAGG - Intronic
1153926113 18:9836643-9836665 ATTCCGATTCTGTAGGTCTGGGG + Intronic
1154041753 18:10862685-10862707 TTTCTGATTTAGTAAGTTTGAGG - Intronic
1155552810 18:26983672-26983694 TTTCTGATTTAGTAAGTCTTTGG + Intronic
1155656699 18:28201227-28201249 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1155668803 18:28344425-28344447 ATTTGGATTCAGTAAGTCTGGGG + Intergenic
1156317818 18:35987241-35987263 TTTCTGATTCCGTAAGTCTGGGG + Intronic
1156318036 18:35989384-35989406 CTTCTGATTCAGTAGGTCTGGGG - Intronic
1156386780 18:36612231-36612253 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1156575241 18:38307267-38307289 TTCCTGATTGGGTAAGTGTGAGG + Intergenic
1157239498 18:45996384-45996406 TTTCTGATTCGGTAGGTCTGAGG + Intronic
1157681342 18:49609695-49609717 ATTCTGATTCAGTAAGTCTGGGG + Intergenic
1157811168 18:50697067-50697089 TTTCTGATTCAGCAAGTCTCAGG - Intronic
1157832756 18:50872115-50872137 TTTCTGATTCAGTGGCTGTGGGG + Intergenic
1157899342 18:51499124-51499146 GTTCTGATTCAGTAAATCTGAGG + Intergenic
1157899376 18:51499487-51499509 ATTCTGATTCAGTAAATCTGGGG - Intergenic
1157990411 18:52489143-52489165 ATTCTGATTCAGTAAGTTTGAGG + Intronic
1158123574 18:54077701-54077723 TTTCTGATTCAGTGTGTCTGGGG + Intergenic
1158644245 18:59230255-59230277 TTTCTGATTTAGTAGGTGTTAGG + Intronic
1158730852 18:60020767-60020789 TTTCTGATTCAGTGGGTGTGGGG + Intergenic
1158932220 18:62333306-62333328 TTTCTGATTCGGTAGGTGGGGGG - Intronic
1159011572 18:63063300-63063322 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1159058295 18:63488833-63488855 ATTCTGATTCAGTATGTCTGGGG + Intronic
1159085314 18:63783317-63783339 TTTCTGATTCAGTACTTCTGGGG - Intronic
1159143385 18:64424225-64424247 TTTCTGATTCAATAGGTCTGGGG + Intergenic
1159488448 18:69097561-69097583 TTTCTGATTCAGTCAGTCTGGGG - Intergenic
1161842616 19:6692072-6692094 TTTCTGATTCAGTGAGTCTGGGG + Intronic
1165168079 19:33871166-33871188 TTTCTGATTCAGTAGGTCTGCGG + Intergenic
1165310525 19:35026873-35026895 TTTCTGGTTCAGTAGGTCTGGGG + Intergenic
1165695647 19:37898960-37898982 TTTCCAATTGAGTAGGTCTGGGG - Intronic
1166164290 19:40976317-40976339 TTTCTGATTTAGTAGGTCTGGGG + Intergenic
1166186492 19:41142709-41142731 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1166973539 19:46588597-46588619 TTTCTGATTTAGTAAGTCTGGGG + Intronic
1167725886 19:51212266-51212288 TTTCCCATTCAGTTGGGGTGAGG - Intergenic
925017852 2:545265-545287 TTTCCAGTTCGGTAAGTGGGCGG - Intergenic
925173712 2:1767920-1767942 AATCGGAGTCAGTAAGTGTGGGG + Intergenic
926029568 2:9574256-9574278 GTTTTGATTCAGTAAGTCTGAGG - Intergenic
926080544 2:9982623-9982645 TTTCGGATTCAGTGAGTCTGGGG + Intronic
926440452 2:12883408-12883430 TTTCTGATTCAGGAAGTTTGTGG + Intergenic
926942473 2:18152750-18152772 TTCCCCACTCAGTCAGTGTGTGG - Intronic
927274226 2:21248290-21248312 TTTCTGATTCAGTATGTCTGAGG + Intergenic
928258883 2:29749195-29749217 TTTCTGATTCAGTAGGTCTGGGG + Intronic
929038265 2:37718021-37718043 CTTCTGATTCAGTAGGTCTGGGG - Intronic
929174612 2:38963748-38963770 ATTCTGATTCAGTAGGTCTGGGG - Intronic
929198629 2:39212112-39212134 TTTCTGATTCAGTCAGTCTTGGG - Intronic
929419575 2:41777176-41777198 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
929431492 2:41891114-41891136 TTTCAGGTTCAGTAATTGTCTGG - Intergenic
929434296 2:41915712-41915734 GTTCTGATTCATTAAGTCTGGGG - Intergenic
929752453 2:44729876-44729898 TTTCCGATTCAGCAGGTCTGAGG - Intronic
929963493 2:46514340-46514362 ATTCTGATTCAGTAGGTGTAGGG - Intronic
929979236 2:46663470-46663492 TTTCTGATTCAGTTGGTCTGGGG + Intergenic
929985639 2:46728989-46729011 TTTCTGATTCAGTAGATCTGAGG - Intronic
930014424 2:46960548-46960570 ATTCTGATTCAGTGAGTTTGGGG - Intronic
930169133 2:48233172-48233194 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
930366801 2:50449518-50449540 ATTCAGAGTCAGTAGGTGTGTGG + Intronic
930577920 2:53174543-53174565 TTTCTGATGCAGTAAGAGTGAGG - Intergenic
930672116 2:54162560-54162582 TTTCTGATTCAGTACGTCTAGGG - Intronic
930802192 2:55454359-55454381 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
930846539 2:55911602-55911624 TTTCTGATTCAGTCAGTCTGGGG + Intronic
931120026 2:59206251-59206273 TTTCTGATTCTGCAAGTCTGAGG + Intergenic
931243338 2:60471852-60471874 TTTCTGATTCAGTAAGTCTGAGG - Intronic
931588224 2:63852300-63852322 ATTCTGATTCAGTAGGTTTGGGG - Intronic
931802977 2:65776908-65776930 TTTCCGATTCAGTAGATCTAGGG + Intergenic
931836190 2:66100356-66100378 ATTCTGATTCAGTAGGTTTGGGG + Intergenic
932020989 2:68086421-68086443 TTTCTGATTCATCAGGTGTGGGG + Intronic
932364436 2:71139647-71139669 TTTCTGATTCAGGAAGTATGGGG + Intronic
932734440 2:74244751-74244773 TTTCCGATTCAGCAGGTCTGGGG + Intronic
932896292 2:75643840-75643862 TTTTAAATTCAGTAAGTCTGGGG + Intergenic
933124876 2:78592809-78592831 TTTCCGACTCAGCCAGTTTGTGG + Intergenic
933200236 2:79439636-79439658 ATTCAGATTCAGTAAGTCTGGGG + Intronic
933219672 2:79674071-79674093 TTTCTGATTCAGTAGGTCTGGGG + Intronic
933293223 2:80460879-80460901 TTTCTGATTCAGTATATCTGGGG + Intronic
933302268 2:80555437-80555459 TTTCCAATTCAGTAAGTCTGGGG - Intronic
933565841 2:83949606-83949628 TTTCTAATTCAATAAGTCTGAGG - Intergenic
934046126 2:88173853-88173875 ATTCTGATTCAGTAGGTCTGGGG + Intronic
934710637 2:96511918-96511940 TGTCCTCTTCAGTAAGTGGGGGG - Intergenic
935045545 2:99478783-99478805 TTTCTGATTCAGTGAGTCTAGGG + Intronic
936533892 2:113296104-113296126 TTTCTGATTCAGTAGGTATTGGG - Intergenic
936628853 2:114178344-114178366 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
936730012 2:115370797-115370819 TTTCTGATTCAGTAGGTTTGGGG + Intronic
937011132 2:118563704-118563726 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
937890891 2:126937825-126937847 TTTCTGATTCAGAAGGTCTGTGG - Intergenic
938403925 2:131016715-131016737 TTTCTGATTCAGTGGGTCTGGGG + Intronic
938566556 2:132524011-132524033 TTTCTGATTCAGCAGGTCTGGGG - Intronic
938672201 2:133597264-133597286 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
938737911 2:134203294-134203316 CTTGAGATTCAGCAAGTGTGAGG + Intronic
938771867 2:134507475-134507497 TTTCTGATTCAGTAGGTCTGGGG - Intronic
938831510 2:135054197-135054219 TTTCTGATTCTGTAGGTCTGAGG + Intronic
938921833 2:136002288-136002310 TTTCTGATTCAGTAGGTCTGTGG - Intergenic
938928735 2:136067431-136067453 TTTTAGAGGCAGTAAGTGTGGGG + Intergenic
939253108 2:139708699-139708721 TTTCTGATTCAGTTAGTCTAAGG + Intergenic
939563454 2:143758855-143758877 TTTCTGATTCAGCAAGTCTGGGG - Intronic
939741924 2:145918584-145918606 GATCTGATTCAGTAGGTGTGAGG + Intergenic
939845528 2:147241590-147241612 TTTCTGATTCACAAAGTCTGGGG + Intergenic
940354761 2:152728330-152728352 TTTCCTATTAAATAAGTGTTAGG - Intronic
941432198 2:165426566-165426588 TTTCTGATTTAGTAGGTCTGAGG - Intergenic
941435556 2:165466562-165466584 GTTCTGATTCAGTAGGTATGGGG + Intergenic
941498029 2:166231508-166231530 TTTCTGACTCAGTAGGTCTGGGG + Intronic
941498293 2:166235542-166235564 TTTCTGATTCAGTATGTCTTGGG + Intronic
941656832 2:168153470-168153492 TTTCCGATTCAGAAGGTCTAGGG + Intronic
941740879 2:169033785-169033807 TTTCTGATTCAGTAGGTCTCAGG - Intergenic
942106925 2:172642513-172642535 TTTGTGATTCAGTAGGTCTGGGG - Intergenic
942392815 2:175513702-175513724 TTTCTGACTCAGTACGTGTGGGG + Intergenic
942735090 2:179101099-179101121 ATTCTGATTCAGTAAATCTGGGG - Intergenic
943436684 2:187872770-187872792 TTTCTAATTCAGTAGGTTTGGGG + Intergenic
943617488 2:190109997-190110019 CTTCTGATTCAGTAGGTCTGGGG + Intronic
943755593 2:191553771-191553793 TTTCTGATTCAATAGGTCTGGGG - Intergenic
944329703 2:198451092-198451114 TTTGTGAGTCAGTAAGTGAGTGG - Intronic
944402841 2:199347934-199347956 TTTCTGATTGAGTAAGTCTGAGG - Intronic
944658992 2:201904737-201904759 TTCCAGATTCAGTAGGTCTGAGG - Intergenic
945010844 2:205461730-205461752 TTTCTGATTCAATAGGTCTGGGG + Intronic
945412479 2:209527784-209527806 TTTCTGATTCACTAGGTCTGGGG - Intronic
945550698 2:211218466-211218488 TTTCTGATTCAGCAGGTGTGAGG - Intergenic
945591038 2:211731970-211731992 ATTCTGACTCAGTAAGTCTGGGG + Intronic
945661964 2:212697526-212697548 TTTCTGATTCAGTAGCTCTGGGG + Intergenic
945774898 2:214094262-214094284 ATTCCAATTCAGTAGGTCTGGGG - Intronic
945913056 2:215671290-215671312 TTTCTGATTCAGTAGCTATGGGG + Intergenic
946548831 2:220777744-220777766 TTTCCGATTCAGTAAGTCTGGGG + Intergenic
947328818 2:229006728-229006750 TTTCCGAGTCAGTAGGTTTAAGG + Intronic
947484766 2:230537924-230537946 CTTCTGATTCAGCAAGTGAGAGG + Intronic
947834951 2:233168768-233168790 TTTCAGATTCAGTAGGTCTGGGG + Intronic
947908102 2:233780365-233780387 TTTCTGATTCAGTAAGTCTGGGG + Intronic
948052195 2:234987142-234987164 TTTCTGATTCTGTAGGTCTGGGG - Intronic
948244354 2:236465932-236465954 TTTCAGCTTCAGTATGTTTGAGG + Intronic
1168995211 20:2128122-2128144 TTTCCAACTCAGTAGGTTTGAGG - Intronic
1169260539 20:4135110-4135132 TTTCGGATCCAGTAGGTTTGGGG - Intronic
1169343390 20:4812606-4812628 TTTCTGATTCAGTAATTCTGGGG + Intronic
1169542420 20:6614480-6614502 TTTCAGATTCAGTAGATCTGGGG - Intergenic
1169694048 20:8367382-8367404 TTTCTGATTCCGTGAGTCTGAGG - Intronic
1169727275 20:8749183-8749205 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1169782110 20:9320851-9320873 TTTCTGATTCTGTAGGTCTGGGG - Intronic
1169858317 20:10126800-10126822 ATTCTGATTCAGTAAGTCTGGGG - Intergenic
1170035774 20:11988124-11988146 GTTCTGATTCAGCAAATGTGAGG + Intergenic
1170269221 20:14505660-14505682 TTTCTGTTTTAGTAAGTCTGAGG + Intronic
1170284574 20:14692166-14692188 TTTCTGAATCAGTAGGTGTGGGG - Intronic
1170393742 20:15903562-15903584 TCTCTGATTCAGTAGGTTTGGGG + Intronic
1170468662 20:16646433-16646455 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1170633177 20:18082582-18082604 TTTCTGACTCAGTGAGTCTGGGG - Intergenic
1171336123 20:24387376-24387398 CTTCATATTCAGTAAGTCTGGGG - Intergenic
1171390365 20:24797903-24797925 TTCCTGATTCAGTGAGTCTGGGG - Intergenic
1172367352 20:34360225-34360247 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1172491658 20:35343835-35343857 ATTCTGATTCAGTAAGTTTCAGG - Intronic
1173245697 20:41335956-41335978 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1173339118 20:42138101-42138123 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1173436847 20:43041023-43041045 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1173444440 20:43105192-43105214 TTACTGATTCAGTAGGTTTGAGG - Intronic
1173551041 20:43933430-43933452 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1173576844 20:44117601-44117623 TTTCTGATTCAGTAGGTCTCAGG - Intronic
1173725615 20:45295345-45295367 TTTCTAATTCAGCAAGTCTGGGG - Intronic
1173817133 20:45996963-45996985 ATTCTGATTCAGTATGTCTGTGG + Intergenic
1173885837 20:46458079-46458101 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1173897822 20:46563999-46564021 TTGCTGATTCAGCAAGTCTGGGG + Intronic
1174083279 20:47985864-47985886 ATTCTGATTCAGTAAGTGTTGGG - Intergenic
1174262339 20:49305691-49305713 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
1174658740 20:52192381-52192403 TTTCTGCTTCAGTAGGTCTGGGG + Intronic
1174685631 20:52452389-52452411 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1174732836 20:52934947-52934969 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1174741787 20:53021322-53021344 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1174891856 20:54403734-54403756 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1174947740 20:55007034-55007056 TTTCTGATTCTGTAGATGTGGGG + Intergenic
1175002874 20:55648781-55648803 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1175101844 20:56584879-56584901 TTTCTGATTCAGTGGGTCTGGGG - Intergenic
1177283675 21:19020387-19020409 TTTCTGACTCAGTATGTCTGGGG - Intergenic
1177443547 21:21161402-21161424 TTTCAGATTAAGCAATTGTGTGG + Intronic
1177647070 21:23913148-23913170 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
1178083975 21:29094394-29094416 TTTCTGATTCAGAAAGTCTAGGG + Intronic
1178156784 21:29863257-29863279 ATTCTGATTCAGTAAGTCAGGGG + Intronic
1179093634 21:38291718-38291740 TTTCCGATTCAGCAGGTTTGGGG - Intronic
1179283212 21:39952749-39952771 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
1182948033 22:34343514-34343536 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1183038421 22:35157986-35158008 CCTCTGATTCAGTAAGTCTGGGG - Intergenic
1183139290 22:35921376-35921398 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1183779863 22:39992424-39992446 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1184207392 22:43014200-43014222 TTTCTGATTCAGTGAGTCTGGGG + Intronic
949096627 3:94173-94195 TTGCCGATTCAGTAAGGTTGGGG - Intergenic
949194627 3:1290075-1290097 TCTGTGATTCAGTAAGTCTGGGG - Intronic
949520073 3:4843515-4843537 TTTCTGACTCAGTAGGTCTGGGG - Intronic
949587500 3:5456278-5456300 ATTCTGACTCAGTAAGTCTGTGG + Intergenic
949735762 3:7170012-7170034 TTTGTGATTCAGTTAGTTTGAGG + Intronic
949933616 3:9099737-9099759 TTTCCGATTCAGTAGGTTTAAGG - Intronic
949951502 3:9232752-9232774 ATTCTGATTCAGTAGGTCTGGGG + Intronic
950219694 3:11185161-11185183 ATTCAGATTCAGAAAGTCTGGGG + Intronic
950710443 3:14810045-14810067 TTTCTGATTCAGTGAGGCTGGGG + Intergenic
950809280 3:15635918-15635940 ATTCTGATTCAGTAGGTCTGGGG - Intronic
950888372 3:16380648-16380670 TTTCTGACTCAGTAGGTCTGTGG - Intronic
950899428 3:16483876-16483898 TTTCTGATTTAGTAAGTCTAGGG - Intronic
950918352 3:16667794-16667816 GTCCTGATTCAGTAAGTTTGTGG - Intronic
950983717 3:17337172-17337194 TTTCTGATTTAGTGAGTCTGGGG + Intronic
951064354 3:18246958-18246980 GTTCTGATTCAGTAAGTTTGGGG - Intronic
951243062 3:20309123-20309145 TTTTTCATTCAGTAAGTCTGGGG - Intergenic
951273332 3:20654700-20654722 TTTCTGATTCAGCAAGTCTGGGG - Intergenic
951337856 3:21446092-21446114 TTTCTGATTCAGTATGTATAGGG + Intronic
951360392 3:21717998-21718020 TTTCAAATTCAATAAGTCTGGGG + Intronic
951372412 3:21866579-21866601 TTTCTGATTCAGTAGGTATGGGG + Intronic
951557605 3:23936503-23936525 TTTCTGATTCATTAAATCTGAGG + Intronic
951574725 3:24101885-24101907 TTTCTGATTCAGTAGGCCTGGGG + Intergenic
951588682 3:24240743-24240765 TTTCTGATTCAGTTAGTTTGGGG + Intronic
951594684 3:24305245-24305267 TTTCTGATTCAGTAGGTCTCAGG - Intronic
951609088 3:24471256-24471278 TTTCTGATTCAGTCAGTCTAGGG - Intronic
952304369 3:32132677-32132699 TTTCTGATTCAGTAGGTTTCAGG + Intronic
952418809 3:33113654-33113676 TTTCTGATTCAGAAAGTCTGGGG - Intergenic
952525768 3:34208927-34208949 TTGCCCATTCAGCAGGTGTGTGG + Intergenic
952669412 3:35948164-35948186 TTTCTCATTCAGTACGTCTGGGG - Intergenic
952831845 3:37571600-37571622 TTTCTGATTCAGTGGGTCTGGGG + Intronic
953056870 3:39394879-39394901 TTCCTGATTCAGTAAGTCTGGGG - Intronic
953096553 3:39782474-39782496 TTTTGGATACAGTAAGTTTGAGG - Intergenic
953204874 3:40817254-40817276 TTTCTGATTCAGTATGTCTGGGG - Intergenic
953212584 3:40889260-40889282 ATTCTGATTCAGGAAGTGTGAGG + Intergenic
953370132 3:42380579-42380601 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
953484599 3:43283561-43283583 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
953596015 3:44314792-44314814 TTTCTGATTCATTAAGTCTGGGG + Intronic
953749341 3:45597246-45597268 TTTCTGATTCAGTAGGTCTTGGG - Intronic
954165447 3:48753686-48753708 ATTCTGATTCAGTAAATCTGGGG + Intronic
954734811 3:52697918-52697940 TTTCAGATTCAGGAATTGTAGGG - Exonic
954837671 3:53484192-53484214 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
955591521 3:60540973-60540995 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
955639600 3:61068041-61068063 TTTCTGATTAAGTAAGTGTAGGG + Intronic
955661836 3:61307722-61307744 TTTCTCATTCATTAAGTCTGGGG - Intergenic
956094291 3:65699935-65699957 TTTTTGATTCAGTAGGTCTGGGG - Intronic
956339604 3:68207526-68207548 TTTCAGATTGTGTAAGTCTGAGG - Intronic
956345076 3:68269486-68269508 ATTCTGATTCAGTAGGTCTGAGG + Intronic
956435942 3:69234756-69234778 TTTCTGATCCAGTAGGTCTGGGG - Intronic
956525036 3:70149490-70149512 TTTCTGCTTCAGTAGGTCTGGGG - Intergenic
956806192 3:72814402-72814424 GTTCTGATTCAGTGAGTGTGAGG + Intronic
956871907 3:73426769-73426791 TTTCTGATTCAGTAGCTCTGGGG + Intronic
957912304 3:86636319-86636341 TTGCCTATTCAGTACGTGTGAGG + Intergenic
958917429 3:100065186-100065208 ATTCAGATTCAGTAAGTCTGGGG - Intronic
958919107 3:100083406-100083428 TTTCTGATTCAGTAGGCCTGGGG - Intronic
959533704 3:107462124-107462146 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
959762440 3:109982340-109982362 TTTCTGATTCAGTTGGTCTGGGG + Intergenic
959844263 3:111014778-111014800 ATTCTGATTCAGTTGGTGTGAGG - Intergenic
959878465 3:111415170-111415192 ATTCTGATTCAGTAGGTCTGGGG + Intronic
960522372 3:118670210-118670232 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
960631305 3:119734112-119734134 TTTCCGATTCAGTAGGTCTGAGG + Intronic
960636390 3:119788987-119789009 ATTCCCATTCAGTAGGTCTGTGG - Intronic
960788477 3:121399952-121399974 TTTCTGATTCAGTAGGTCTGAGG + Intronic
961061833 3:123835183-123835205 TTTCTGATTCAGCAGGTCTGGGG - Intronic
961133458 3:124489778-124489800 ATTCTGATTTAGTAGGTGTGGGG - Intronic
961871817 3:129993891-129993913 TTTCTGATTCAGTAGTTCTGGGG - Intergenic
961925678 3:130477665-130477687 TTTCGGATTCGGTAGGTCTGGGG - Intronic
961993986 3:131221383-131221405 TTTCTGATTCAGTAGGTTGGAGG + Intronic
962032416 3:131615066-131615088 TTTGTGATTCAGTAAGTTTGGGG + Intronic
962115337 3:132499933-132499955 TTTCTGATTCAGTGAGTCTGGGG + Intronic
962130389 3:132667178-132667200 ATTCTGATTCAGTATGTCTGAGG - Intronic
962181234 3:133208185-133208207 TTTCTGATTCAGTGGGTCTGAGG + Intronic
962265034 3:133938734-133938756 TTTCCGACTCAGTAAGTCTGGGG - Intronic
962364528 3:134769276-134769298 ATTCTGATTCAGTAGGTCTGAGG - Intronic
962747685 3:138409615-138409637 TTTCTGATTCATTAGGTCTGGGG - Intergenic
963054571 3:141175139-141175161 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
963314050 3:143739841-143739863 CTTCAAATTCAGTAAGTCTGGGG - Intronic
963501884 3:146137700-146137722 TTTCTGATTCAGTTTGTATGGGG + Intronic
963709510 3:148730744-148730766 TTTCTGATTCAGTAGGTCTGTGG + Intronic
963924782 3:150939594-150939616 TTTCTGATTCAGTGGGTCTGGGG + Intronic
963957963 3:151276225-151276247 TTTCTGATTCTGTAGGTTTGGGG + Intronic
965168327 3:165225796-165225818 GTTCAGATTCAGTATGTCTGGGG - Intergenic
965294844 3:166931638-166931660 TTTTTGATTCAGTAGGTTTGGGG - Intergenic
965491267 3:169339314-169339336 TTTCTGATTCAATAAGTCTGGGG - Intronic
965507458 3:169532201-169532223 TTTCTGATTCAGTGTGTCTGGGG + Intronic
965521260 3:169669660-169669682 ATTCTGATTCAGTAAGCCTGGGG + Intergenic
965814077 3:172618946-172618968 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
966068197 3:175841986-175842008 TTTCATATTCAGTAGGTTTGAGG - Intergenic
966080980 3:176000084-176000106 TTTCTGATTCTGTAAGTCTTGGG + Intergenic
966285386 3:178289131-178289153 ATTCTGATTCAGTAAGTCTGGGG - Intergenic
966434265 3:179865764-179865786 ACTCCGATTCAGTAGGTCTGAGG + Intronic
966486948 3:180481713-180481735 TTTCTGATTGAGTAGGTCTGGGG + Intergenic
966557065 3:181274494-181274516 ATTCAGATTCAGTAAGTCTGGGG - Intergenic
966560142 3:181310504-181310526 TTTCTAATTCAGTAGGTTTGAGG + Intergenic
966584330 3:181604717-181604739 TTTCTGATTCGGTAGGTCTGTGG + Intergenic
966692907 3:182759961-182759983 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
966755570 3:183368199-183368221 TTTCTGATTCAGTAAGTCTAGGG - Intronic
966960509 3:184933045-184933067 TTTCTGATTCAGGAGGTCTGAGG - Intronic
966989371 3:185213319-185213341 TTTCTGATTCATTAAATCTGGGG - Intronic
967079540 3:186036630-186036652 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
967348261 3:188482937-188482959 ATTCTGATTCAGTAGGTCTGGGG - Intronic
967505895 3:190252230-190252252 TTTCTGATTCAGTAGGTTTGGGG - Intergenic
967881926 3:194307554-194307576 TTTCTGATTCAGTAATCCTGGGG + Intergenic
968193746 3:196690150-196690172 TTTCTGATTCAGTAAGTCTGGGG - Intronic
968643854 4:1728777-1728799 TGTCTGAGCCAGTAAGTGTGAGG + Exonic
969051426 4:4376012-4376034 TTCCTGATTCAGCAAGTCTGGGG + Intronic
969952811 4:10854945-10854967 TTTCTGATTCAGTAAATTTGGGG - Intergenic
970150576 4:13085272-13085294 TTTCTGATTCAGTAGTTCTGAGG + Intergenic
970321326 4:14878428-14878450 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
970384151 4:15539200-15539222 TTTCAGGTTCAGTAAGTCTCAGG - Intronic
970680938 4:18507160-18507182 TTTCTGATTCTGGATGTGTGAGG + Intergenic
970884829 4:20976237-20976259 TTTCCAATTCAGTAAATCTGGGG - Intronic
971226780 4:24761426-24761448 ATTCTGATTCAGTGAGTCTGGGG + Intergenic
972064283 4:34920592-34920614 TCTCAGAGTCAGTAAGTGTGAGG + Intergenic
972308053 4:37851241-37851263 TTTCCGATTCAGTAGGTCTGGGG + Intronic
972355668 4:38277791-38277813 TTTTTGGTTCAGTATGTGTGAGG - Intergenic
972440826 4:39089762-39089784 TTTCATATTCAGTAGGTGTGGGG - Intronic
972730971 4:41794727-41794749 ATTCTGATTCAGTATGTCTGGGG - Intergenic
973583898 4:52371958-52371980 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
973662658 4:53123837-53123859 TTTCTGATTCAGTAGGTCTAGGG + Intronic
973691472 4:53437601-53437623 TTTCTGATTCAGTAAGTCTGGGG - Intronic
973868734 4:55142556-55142578 TTTCTGATTCAGTAGGCTTGAGG + Intergenic
974794313 4:66729188-66729210 ATTCTGATTCAGTAAGTTTGGGG - Intergenic
975532988 4:75420385-75420407 TCTCCCATTCAGGAGGTGTGGGG + Intergenic
975781387 4:77843866-77843888 TTTCTAATTCAGTAGGTCTGAGG - Intergenic
975833705 4:78398349-78398371 ATTCTGATTCAGAAAGTCTGTGG + Intronic
975997800 4:80336367-80336389 TTTCAGAATCAATTAGTGTGAGG - Intronic
976064166 4:81164665-81164687 TTTCCGATTCAGTAAGTGTGGGG + Intronic
977466624 4:97390315-97390337 TTTCTAATTCAGTATGTCTGAGG + Intronic
978398151 4:108304342-108304364 TTTCTGGTTCAGTATGTCTGAGG + Intergenic
978530666 4:109709236-109709258 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
978714198 4:111822462-111822484 TTTCCTATTCATTAAGTTTATGG - Intergenic
978739722 4:112122880-112122902 ATTCTGATTCATTAAGTCTGAGG + Intergenic
978745180 4:112185405-112185427 TTTCTGATTCAGTAAGTCAGGGG - Intronic
978791748 4:112670006-112670028 TTTCTGATTCAATAGGTCTGGGG + Intergenic
978924590 4:114227592-114227614 TTTCTGTTTCAGTAGGTCTGAGG + Intergenic
979431288 4:120634904-120634926 TTTCTGATTCAGTAGGTCTGAGG - Intergenic
979545980 4:121940380-121940402 TCTCCTACTCAGTAAGTGGGAGG + Intronic
979632213 4:122916179-122916201 TTTCTGATTCAGTAGGTCTATGG - Intronic
980129376 4:128804029-128804051 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
980707311 4:136516272-136516294 TTTCAGTTTGAGCAAGTGTGAGG + Intergenic
980805434 4:137807156-137807178 ATTCTGATTCAGTAAGTCTAGGG - Intergenic
981009431 4:139910241-139910263 TTTCTGATTCAGAAAGCCTGGGG - Intronic
981143567 4:141299731-141299753 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
981244816 4:142523202-142523224 TTTCTGATTTAGTAGGTCTGGGG - Intronic
981274460 4:142882307-142882329 ATTCTGATTCAGTAAGTCTAAGG + Intergenic
981691569 4:147514961-147514983 TTCCTGATTCAGTAGGTCTGGGG - Intronic
982073702 4:151718114-151718136 TTTCCGATTCAGTAGGTCGAGGG + Intronic
982085421 4:151830695-151830717 TTTCTGATTCAGTAAGTTTGAGG - Intergenic
982123593 4:152164979-152165001 ATTCTGATTCAGTAGGTGTAGGG + Intergenic
982138551 4:152295728-152295750 TTTTGGATTCAGTAGGTCTGGGG + Intergenic
982658584 4:158178877-158178899 TTTCCGATTCCATAAGTCTCCGG - Intergenic
982673378 4:158348591-158348613 TTTCTGATTCAGTAGGTCTGGGG - Intronic
983370808 4:166855766-166855788 TTTCTGATTCATTAGGTGTGGGG + Intronic
983544184 4:168945157-168945179 GTTCTGATTCAGTAGGTTTGGGG - Intronic
983924872 4:173389603-173389625 TTTCTGATTCAGTAGGTCTGGGG + Intronic
984047290 4:174816079-174816101 ATTCTGATTCAGTGAGTATGTGG + Intronic
984152632 4:176153079-176153101 TTTCTGATTCTGTAGGTCTGAGG - Intronic
984258824 4:177419735-177419757 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
984594568 4:181653269-181653291 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
984795595 4:183657887-183657909 ATTCTGATTCAGTAGGTCTGGGG + Intronic
985179094 4:187237223-187237245 ATTCCCATTCAGTTACTGTGAGG + Intergenic
986638430 5:9847961-9847983 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
987287977 5:16478380-16478402 TTTCTGATTCAGTAGGTCTAGGG - Intronic
988689979 5:33562120-33562142 ATTCTGATTCAGTAGGTCTGGGG + Intronic
988953226 5:36286576-36286598 TTTCTGATTCAGAAATTCTGAGG - Intronic
989108688 5:37886921-37886943 TTTCTGATCCAGTAGGTCTGGGG - Intergenic
989114497 5:37939255-37939277 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
989621820 5:43392058-43392080 TTTCTGATTCAGTAAATCTGAGG + Intronic
989704228 5:44308883-44308905 TTTCTGATTCAATAAGTCTGTGG - Intronic
990173269 5:53079058-53079080 TTTCTGATTCAGTAGGTCTAGGG + Intronic
990273519 5:54171403-54171425 TTTACTATTCAGGGAGTGTGTGG + Intronic
990356773 5:54975481-54975503 TTGCTGATTCAGTAGGTTTGAGG - Intergenic
990533563 5:56697653-56697675 TTTCTGATTCAGTAGGACTGGGG + Intergenic
990980547 5:61599035-61599057 TTTCTGATTCAGTAAGTCTGGGG + Intergenic
991114679 5:62940482-62940504 TTTCTTATCCTGTAAGTGTGAGG - Intergenic
991503739 5:67303287-67303309 TTCCTGATTCAGTAGGTCTGGGG - Intergenic
992202220 5:74395676-74395698 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
992204776 5:74420934-74420956 GTTCTGATTCAGTAGGTTTGGGG - Intergenic
992522130 5:77565136-77565158 CTTCTGATTCAGTAAGCCTGGGG - Intronic
992599329 5:78382127-78382149 TTTCTCATTCAGTAGGTCTGGGG - Intronic
993156636 5:84233273-84233295 ATTCAAATTCAGTAGGTGTGGGG - Intronic
993386187 5:87266447-87266469 TTTCTGATTCAGAAGGTCTGAGG + Intergenic
993681731 5:90886453-90886475 ATTCTGATTCAGTATGTTTGGGG - Intronic
993865745 5:93192906-93192928 ATTCAGATTCAGTAGGTGTGGGG - Intergenic
993871496 5:93259997-93260019 TTTCTGATTCACTAAATCTGGGG - Intergenic
994366301 5:98921448-98921470 ATTCTGATTCAGTACGTCTGGGG + Intronic
994431540 5:99670129-99670151 ATTCTGATTTAGTAACTGTGAGG + Intergenic
994452204 5:99956349-99956371 TTGCCAATTCAGTAGGTGTCAGG + Intergenic
995161025 5:108982123-108982145 TTTCTGATTCTGTAGGTGTGGGG - Intronic
995507425 5:112874681-112874703 ATTCTGATTCAGGAAGTCTGGGG - Intronic
995890113 5:116941404-116941426 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
995900016 5:117054495-117054517 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
996536505 5:124583376-124583398 TTTCTGATTGAGTAGGTCTGGGG - Intergenic
996856121 5:128009462-128009484 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
997708519 5:135982223-135982245 ATTCAGATTCACTAAGTCTGTGG - Intergenic
998390023 5:141781234-141781256 TTTCTGATTCAGTAGGTTTGGGG + Intergenic
998512017 5:142721643-142721665 ATTCTGATTCAGTAGGTGTGTGG + Intergenic
998615252 5:143733413-143733435 TTTCTGATTCAGTAGATCTGAGG + Intergenic
998685872 5:144524214-144524236 ATTCTGATTCACTAAGTCTGGGG - Intergenic
999132974 5:149298856-149298878 ATTCTGATTCAGGAGGTGTGCGG - Intronic
999187750 5:149725362-149725384 ATTCCAATTCAGTAGGTCTGGGG - Intergenic
999496764 5:152106804-152106826 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
999540835 5:152570994-152571016 TTTCTGATTCAGTAAGTCAGGGG + Intergenic
999576707 5:152986787-152986809 ATTCTGATTCAGTAATTCTGGGG - Intergenic
999629380 5:153554438-153554460 ATTCCGAGTCAGTAAATCTGGGG + Intronic
999664071 5:153894441-153894463 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1000312169 5:160055592-160055614 TCTCTGATTCAGTAGGTCTGGGG - Intronic
1000370521 5:160531433-160531455 TTTCTGATTCAGTAGATCTGAGG + Intergenic
1000442631 5:161281684-161281706 TTTCTAATTTAGTAAGTTTGGGG - Intergenic
1000670030 5:164049905-164049927 TTTCTGATTCAGTATATGTCGGG + Intergenic
1000765519 5:165284651-165284673 TTTCTGATTCAGTAAATGTGGGG - Intergenic
1001012325 5:168109586-168109608 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1001716574 5:173821245-173821267 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1001780483 5:174364687-174364709 TTTCAGATTCAGTAGATTTGGGG - Intergenic
1001860647 5:175051835-175051857 TCTCCGATTCAGTAGGTCTGGGG + Intergenic
1002060883 5:176625329-176625351 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1002515447 5:179754723-179754745 TTTCTGACTCAGTGAGTATGGGG + Intronic
1002820844 6:723254-723276 TTTCTGATTCATAAAGTCTGGGG + Intergenic
1003328157 6:5108540-5108562 ATTCTGACTCAGTAAGTGAGGGG - Exonic
1003584145 6:7371195-7371217 TTTCTGATTCAGTAATTCTGGGG - Intronic
1004096167 6:12556614-12556636 TTTCTGATGCAGTAAGTCTGGGG + Intergenic
1004120171 6:12813899-12813921 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1004132300 6:12932025-12932047 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1004278366 6:14257906-14257928 TTGCTGATTCAGTGAGTCTGAGG - Intergenic
1004344973 6:14840732-14840754 GTTGTGATTCAGTAAGTCTGGGG + Intergenic
1004534766 6:16489894-16489916 TTTCTGATTCAGTAGGCTTGGGG + Intronic
1004582548 6:16968174-16968196 ATTCTGATTCAGTAGGTGGGTGG + Intergenic
1004645364 6:17555142-17555164 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1004729316 6:18342427-18342449 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
1004767932 6:18752471-18752493 TTTCTGATTCATTAGGTCTGAGG - Intergenic
1005251982 6:23957140-23957162 TGTCTGATTCAATAGGTGTGGGG + Intergenic
1005488038 6:26319888-26319910 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1005595193 6:27372472-27372494 TTTTTGATTCAGTAGGTCTGGGG - Intergenic
1005712379 6:28514662-28514684 TTTCTGATTCAGTAAGTTTTAGG - Intronic
1005872667 6:29986683-29986705 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1006184569 6:32173846-32173868 TTTCTGATTCAGTAGATCTGGGG - Intronic
1006741318 6:36311095-36311117 TTTCCGATTCAGTAGGTGCAGGG - Intergenic
1007108617 6:39300069-39300091 TTTCTGATCCAGTAGGTCTGGGG - Intronic
1007931973 6:45699964-45699986 ATTCCGAATCAGTAAGTCTGAGG + Intergenic
1007949559 6:45859341-45859363 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1007962461 6:45972650-45972672 GTTCTGATTCAGTAAGTATGGGG - Intronic
1008003027 6:46380535-46380557 TTTCTGAATCAGTAAATCTGGGG - Intronic
1008036457 6:46749969-46749991 TTTCAGATTCTGTAAGTCTGGGG + Exonic
1008127101 6:47681096-47681118 ATTCTGATTCATTAAGTCTGGGG + Intronic
1008341183 6:50366241-50366263 TTTCCGATTCAGTAGGTCTTGGG + Intergenic
1008639658 6:53448946-53448968 TTTCAGATTCAGTGAGGCTGAGG - Intergenic
1008653020 6:53582787-53582809 TTTCTGATTCAGTAAATCTGGGG + Intronic
1008698770 6:54073625-54073647 TTTCTTATTTAGTAAGTCTGAGG + Intronic
1008959720 6:57254099-57254121 TTTCTGATTCAGTGGGTTTGGGG + Intergenic
1009903714 6:69842007-69842029 TTTCTGATCCAGTAAGTCTGGGG + Intergenic
1010152348 6:72748430-72748452 ATTCTGATTCATTAAGTCTGGGG - Intronic
1010208092 6:73341027-73341049 TTTCTGACTCAGTAGGTCTGAGG + Intergenic
1010308948 6:74359993-74360015 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
1010550295 6:77213604-77213626 TTTCCGATTTAGTAGGTTTGGGG - Intergenic
1010828730 6:80504649-80504671 TTTCTGATTCAGTAGGTCTAAGG + Intergenic
1010935920 6:81861277-81861299 ATTCTGATTCAGTAGGTCTGTGG + Intergenic
1011739989 6:90349940-90349962 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1012255634 6:97028182-97028204 TTTCCCATCTAGTAAGTGTCGGG + Intronic
1012394124 6:98776200-98776222 TTTTTGATTGAGTAAGTTTGGGG - Intergenic
1012797432 6:103780363-103780385 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1012993802 6:105952559-105952581 ATTCCGATTCAGTAGTTGAGTGG - Intergenic
1013275179 6:108578218-108578240 TTTCTGATTTAGTCTGTGTGGGG - Intronic
1013301806 6:108810929-108810951 TCTCTGATTCAGTAAGTCTCGGG + Intergenic
1013987611 6:116214590-116214612 TTTCTGATTCAGTAGGTTTGGGG - Intronic
1014015328 6:116523010-116523032 TGTCTGATTCAGTAGGTCTGGGG + Exonic
1014274397 6:119370270-119370292 CTTCTGATTCAGTAAGTCTGGGG + Intergenic
1014832008 6:126113817-126113839 ATTCAGATTCAATAGGTGTGAGG - Intergenic
1014974144 6:127857704-127857726 GTTCTGATTCAGTAGGTCTGGGG - Intronic
1014991241 6:128079935-128079957 TTTCTGATTCAGTATTTCTGGGG + Intronic
1015031423 6:128600521-128600543 TTCCCCATTCATTCAGTGTGAGG - Intergenic
1015416187 6:132951299-132951321 ATTCTGATTCAGGAGGTGTGAGG + Intergenic
1015581696 6:134731832-134731854 TTTCCAATTCAGTAACTCTGGGG + Intergenic
1016547867 6:145244536-145244558 TTTCTGATTCAGTAGATCTGGGG + Intergenic
1016673501 6:146736013-146736035 TTTCTGATACAGTAAATTTGAGG + Intronic
1017546620 6:155458441-155458463 TTTTAGATTCAATGAGTGTGAGG + Intergenic
1017648960 6:156563694-156563716 TTTCTGATTCAGGAAGTCTAGGG + Intergenic
1017795067 6:157836544-157836566 TTTCTGATTCAGGAGGTCTGGGG + Intronic
1017951647 6:159140311-159140333 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1018314296 6:162541560-162541582 CTTCTGATTCAGTAGGTTTGAGG + Intronic
1018678522 6:166243552-166243574 TTTCTGGTTCAGTAGGTCTGGGG + Intergenic
1018731353 6:166653439-166653461 TGTCTGATTCAATAACTGTGTGG - Intronic
1018832645 6:167456432-167456454 TTTCCAATTCAGTAGGTCTGGGG - Intergenic
1019061162 6:169259257-169259279 ATTCCGACTCAGTAGGTGTGGGG + Intergenic
1021180286 7:17497959-17497981 TTTCTGATCCAGCAAGTTTGGGG - Intergenic
1021937857 7:25648797-25648819 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1022202337 7:28128555-28128577 TTTCTAATTCATTAAGTCTGGGG - Intronic
1022205148 7:28156659-28156681 TTTCTGATTTCGTAGGTGTGGGG + Intronic
1022538450 7:31113254-31113276 TTTCTGATTCAGCAGGTCTGAGG + Intergenic
1023216274 7:37866487-37866509 TTTCTGATTTAGTAAGTCTGAGG - Intronic
1023395691 7:39749856-39749878 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1023676463 7:42635300-42635322 TTTCTGATTCAGTGGGTCTGGGG - Intergenic
1023894366 7:44419535-44419557 TTTCCCACTCAGGAGGTGTGGGG - Intronic
1025048987 7:55718197-55718219 TTTCAAAATCAGGAAGTGTGAGG - Intergenic
1025263219 7:57436561-57436583 TTTCAAATGCAATAAGTGTGAGG - Intergenic
1025636000 7:63319381-63319403 TTTCAGATGCAATAAATGTGAGG + Intergenic
1025646696 7:63428799-63428821 TTTCAGATGCAATAAATGTGAGG - Intergenic
1026110409 7:67454927-67454949 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1026366663 7:69655504-69655526 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
1026371344 7:69702710-69702732 ATTCTGATTCAGTAAGTCTAGGG - Intronic
1026429638 7:70331849-70331871 TTGCCCATTCAGTATGTCTGTGG - Intronic
1026473313 7:70712573-70712595 TTTCCAATTCTGTAGGTTTGGGG - Intronic
1026534843 7:71230917-71230939 TTTCTGATTCAATGAGTCTGCGG - Intronic
1027377535 7:77567588-77567610 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1027842707 7:83334110-83334132 GTTCTGATTCAGTAGGTCTGAGG + Intergenic
1027980124 7:85207526-85207548 TTTCCATTTCAGGAAATGTGTGG + Intergenic
1028140445 7:87268443-87268465 TTTCTGATATAGTAAGTCTGAGG - Intergenic
1028350100 7:89836041-89836063 TTTCTGATGCAGTAAGTCTGAGG + Intergenic
1028673399 7:93430759-93430781 TTTCCTATTCAGTAGGTCTGGGG - Intronic
1028981399 7:96971324-96971346 ATTCTGATTCAGTAAGCCTGAGG + Intergenic
1029417543 7:100452542-100452564 TTTTTGATTCAGTAGGTCTGCGG + Intergenic
1029849553 7:103447616-103447638 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1030133637 7:106224665-106224687 TTTCTGCTTCAGCTAGTGTGAGG - Intergenic
1030215302 7:107039061-107039083 TTTCAGATTCAGTAAGTCTGAGG - Intergenic
1030689689 7:112519657-112519679 CTTCTGATTCTGTAAGTCTGCGG + Intergenic
1030714747 7:112794320-112794342 TTCCTGATTCAGTAGGTCTGGGG - Intergenic
1030851962 7:114499038-114499060 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1031485945 7:122324494-122324516 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1032205982 7:129865929-129865951 GTTCCAATTGAGTAAGGGTGGGG + Intronic
1032446380 7:131987339-131987361 TTTCTTATTCAGGAATTGTGTGG + Intergenic
1032677123 7:134141327-134141349 TTTCTGATTCGGTAGGTTTGGGG + Intronic
1032732985 7:134662379-134662401 TTTCGGAATCAGTAGGTCTGGGG + Intronic
1033993363 7:147315154-147315176 ATTCTGATTCAGTAGGTATGAGG + Intronic
1034020937 7:147641491-147641513 TTTCTGATTCAGTAGGTCTCAGG + Intronic
1034545673 7:151787060-151787082 TTTCAGACACAGTAAGTGTGTGG - Intronic
1036235249 8:7034357-7034379 TTTCTGATTCAATAGGTCTGAGG - Intergenic
1036727253 8:11231152-11231174 TTTCAGATCCAGTAGGTCTGGGG - Intergenic
1036969713 8:13341453-13341475 TTTCTGATTCACTAGGTTTGGGG + Intronic
1038222641 8:25625367-25625389 ATTCCAATTCAGTAAGTTTGAGG + Intergenic
1038555153 8:28506488-28506510 TTTTCATTTCAGTTAGTGTGTGG + Intronic
1038609170 8:29043672-29043694 ATTCTGATTTAGTAAGTCTGAGG + Intronic
1038887765 8:31684148-31684170 TTTCTGATTCAATAGGTCTGGGG - Intronic
1038935097 8:32241123-32241145 TTTCTGATTCACTAGGTCTGGGG + Intronic
1039072920 8:33662426-33662448 TTTCTGATTAAGTAGGTCTGGGG + Intergenic
1039273173 8:35905554-35905576 TTTCTGATTCAGTAGGTTTCAGG + Intergenic
1039297749 8:36175399-36175421 TTTCTGATTCAGTATGTCTGGGG - Intergenic
1039392808 8:37195483-37195505 TGTCCGATTCAGCAGGTCTGGGG - Intergenic
1040888053 8:52286858-52286880 TTTCTGATTCAGGAAGTCTGGGG - Intronic
1041006776 8:53503339-53503361 TTTCTGACTCAGTAGGTCTGGGG - Intergenic
1041349353 8:56933198-56933220 TTTCTGAGTCAGTAATTCTGGGG + Intergenic
1041642059 8:60213995-60214017 TTGCTGATTCAGTAGGTCTGGGG - Intronic
1042206363 8:66333765-66333787 CTTCTGATTCAATAGGTGTGGGG - Intergenic
1042314189 8:67408137-67408159 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1042871244 8:73401523-73401545 TTTTGGATTCAGTAAGTCTAGGG + Intergenic
1043992174 8:86768885-86768907 ATTCTGATTCAGTAAGTTTGAGG - Intergenic
1044541820 8:93416948-93416970 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
1044683502 8:94805097-94805119 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1044865149 8:96563586-96563608 TTTCTGATTCATTAGGTCTGGGG + Intronic
1045280236 8:100743592-100743614 TTTCTGATTCAGTAGGTCGGAGG + Intergenic
1045444987 8:102251847-102251869 TTTCTGATTCAGTAAGTCTTTGG - Intergenic
1045605100 8:103764030-103764052 TTTCCTATTCAGTAAGTCTGGGG + Intronic
1045615630 8:103907161-103907183 TTTCTGATTCATTAAGTCTAGGG + Intronic
1045642571 8:104268262-104268284 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
1045901648 8:107288539-107288561 ATTCTGATTCAGTATGTCTGGGG + Intronic
1046190083 8:110783606-110783628 TTTCTTATTCAGAAAGTTTGTGG + Intergenic
1046298050 8:112247770-112247792 TTTCTGATTCAGTGTGTCTGGGG - Intronic
1046885484 8:119362368-119362390 TTTCTCATTCAGCAAGTATGTGG - Intergenic
1046912711 8:119646396-119646418 TTTCTCATTCAGTAGGTATGAGG - Intronic
1046928426 8:119818231-119818253 TTTCTGATTCAGTGGGTCTGGGG + Intronic
1047000328 8:120566720-120566742 TTTCTGATTCAGTTGGTCTGGGG + Intronic
1047004258 8:120603561-120603583 TTTCTGATTCAGTAGGTTTGAGG - Intronic
1047158313 8:122347407-122347429 ATTCTGATTCAGTTAGTCTGGGG + Intergenic
1047472756 8:125195061-125195083 TTTCAGATTCAGTAGGTCTAGGG - Intronic
1047583659 8:126244707-126244729 TTTCTGATTCAGTAAGTGGGAGG - Intergenic
1047658384 8:127004020-127004042 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1048232657 8:132659106-132659128 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1048481700 8:134801957-134801979 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1048488444 8:134869901-134869923 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1048930612 8:139312633-139312655 TTTGCAAAGCAGTAAGTGTGAGG - Intergenic
1049930902 9:455534-455556 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1050110529 9:2210948-2210970 TTTTTGATTCATTAGGTGTGAGG + Intergenic
1050242343 9:3650118-3650140 TCTCTGATTCAGTTAGTTTGGGG + Intergenic
1050247273 9:3703792-3703814 TTTCTGATTCAGGAATTCTGGGG - Intergenic
1050256504 9:3797520-3797542 ATTCCAATTCAGTAGGTCTGAGG - Intergenic
1050392732 9:5163159-5163181 TTTCTGATTCAGTAGGTTTGAGG + Intronic
1050460857 9:5876188-5876210 TTTCTGATTTAGTAAGTCTGGGG + Intergenic
1050702442 9:8355782-8355804 GTTCTTATTCAGTAAGTCTGGGG + Intronic
1050710273 9:8453758-8453780 TTTCTGATTTAGTAGGTCTGAGG + Intronic
1050853902 9:10325186-10325208 ATTCTGTTTCAGTAAGTGTGAGG + Intronic
1051044978 9:12861994-12862016 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
1051764848 9:20512454-20512476 TTTCTGATTCATTAAATTTGGGG - Intronic
1051848285 9:21477673-21477695 TTTCTGATTCAATAGGTCTGTGG - Intergenic
1051885205 9:21885389-21885411 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1052017513 9:23486357-23486379 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1052118692 9:24681199-24681221 TTTCTGATTCTGTAAGTGTAGGG + Intergenic
1052343910 9:27389213-27389235 TTTCTGATCCAGTAAGTTTGGGG - Intronic
1053259069 9:36645884-36645906 ATTCTGATTCAGTAGGTCTGAGG - Intronic
1053279350 9:36807446-36807468 TTTCTGACTCAGTAAGTCGGGGG + Intergenic
1054814581 9:69462867-69462889 TTTCTGACTCAGTAGGTTTGGGG + Intronic
1055004205 9:71486925-71486947 TTTCTGATCCAGTAGGTCTGGGG - Intergenic
1055019700 9:71656571-71656593 TTTCTGATTCATTAGGTCTGGGG - Intergenic
1055134517 9:72812581-72812603 TTTCTGATTCAGTAGATCTGAGG + Intronic
1055286306 9:74731874-74731896 TTTCTGCTTCAGTAGGTTTGGGG - Intronic
1055483104 9:76729303-76729325 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1056115348 9:83435805-83435827 ATTCTGATTCAGTAAATATGAGG + Intronic
1056336720 9:85577415-85577437 GGTCTCATTCAGTAAGTGTGTGG - Intronic
1056449880 9:86706667-86706689 TTTCCAATTCAGGAAGTCTGAGG - Intergenic
1056520147 9:87393659-87393681 TTTCTGATTCAGTAAGTCAGGGG - Intergenic
1056724681 9:89104346-89104368 TTTGTGATTCAGTAAGTCAGAGG - Intronic
1056973857 9:91232758-91232780 GTTCTGATTCAGTGAGTATGAGG + Intronic
1057998660 9:99843717-99843739 TTTCTAATTCAGTAGGTCTGTGG + Intronic
1058021283 9:100091810-100091832 GTTCTGATTCAGTAGGTCTGAGG + Intronic
1058079538 9:100687595-100687617 TGTCCGACTCAGTAGGTTTGGGG - Intergenic
1058523441 9:105834594-105834616 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1058568580 9:106314368-106314390 TTTGCTATCCAGTAACTGTGTGG - Intergenic
1058674274 9:107387362-107387384 AGTCTGATTCAGTAGGTGTGGGG + Intergenic
1058734665 9:107883373-107883395 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
1059057367 9:110998044-110998066 TGTCTGATTCAGTAGGTCTGGGG + Intronic
1059601154 9:115780813-115780835 ATTCTGATTCAGTGAGTTTGTGG - Intergenic
1059777850 9:117493783-117493805 ATCCTGATTCAGTAAGTTTGGGG - Intergenic
1059802599 9:117765238-117765260 CTTCTGATTCAGTAGGTCTGGGG + Intergenic
1059847915 9:118302224-118302246 GTTCTAATTCAGTAAGTCTGGGG + Intergenic
1059877694 9:118653855-118653877 TTTCCCACCCAGAAAGTGTGAGG - Intergenic
1059915052 9:119090075-119090097 TTTCTCATTCAGTATGTCTGGGG + Intergenic
1060116314 9:120944023-120944045 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
1060237587 9:121876822-121876844 TTTCTGAGTCAGTAGGTCTGGGG - Intronic
1060363255 9:122981576-122981598 TTTCCAATTAACTAAGTCTGGGG - Intronic
1060705430 9:125794299-125794321 TTTCTGATTCAGTAGTTCTGAGG - Intronic
1060762554 9:126268100-126268122 TTTCTGCTTCAGTAGGTCTGGGG - Intergenic
1060883035 9:127131932-127131954 TTTCTGATTCAGTAAATCTGGGG + Intronic
1061607276 9:131720477-131720499 TTTCTGATTCAGTAGGTCTGTGG - Intronic
1186708929 X:12172542-12172564 TTTCTGATTCAGCAGGTCTGGGG + Intronic
1186806963 X:13149655-13149677 TTTCTGATTCAGTAGGTCTAAGG - Intergenic
1186837168 X:13449646-13449668 TTCCTGGTTCAGTAGGTGTGGGG + Intergenic
1186919067 X:14257596-14257618 TGTCCGATTCAGTAGGTCTTGGG - Intergenic
1186985856 X:15012743-15012765 TTTCCAATTCAGTAGGTCTGGGG - Intergenic
1187118255 X:16375662-16375684 ATTCTGATTCAGTAGGTTTGAGG + Intergenic
1187120761 X:16403992-16404014 ATTCTGATTCAGTGAGTCTGGGG + Intergenic
1187206116 X:17183249-17183271 TATCCGCTTTAGTAAGTATGAGG + Intergenic
1187305348 X:18090367-18090389 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1187433440 X:19245358-19245380 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1187510527 X:19913581-19913603 TTTCTGATTCAGGAGGTCTGGGG + Exonic
1187566492 X:20454656-20454678 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1187657795 X:21498351-21498373 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1187671020 X:21665920-21665942 TTTCTGATTCAGCAGGTTTGGGG - Intergenic
1187688536 X:21840295-21840317 ATTCCGATTCAGCAGGTCTGCGG + Intronic
1187740860 X:22353942-22353964 TTTCTGATTCAGCAGGTCTGCGG - Intergenic
1187797696 X:23022414-23022436 TTTCTGATTCAGTAGGTCTTAGG - Intergenic
1187819934 X:23276656-23276678 TTTCTGATTCATTAAGTTTGGGG - Intergenic
1187827354 X:23345334-23345356 ATTCTGATTCAGTAGGTCTGAGG + Intronic
1187827384 X:23345601-23345623 TTTCTGAGTCAGTAGGTCTGGGG + Intronic
1187882231 X:23857952-23857974 CTTCTGATTCAGTCAGTCTGGGG + Intronic
1187969983 X:24649378-24649400 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1187997609 X:24945612-24945634 TTTCTGATTGAGTAGGTCTGGGG + Intronic
1188009794 X:25043514-25043536 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
1188286958 X:28338936-28338958 CTTCTGATTCAGTAGGTCTGGGG + Intergenic
1188398440 X:29715317-29715339 TTTCTGATTTAGTAAGTCTAGGG + Intronic
1188637379 X:32451197-32451219 TTTCTGATTCAGTGAGTCTTGGG - Intronic
1189097163 X:38152486-38152508 TTTCTGATTCAGTAGGTCTCTGG - Intronic
1189148379 X:38678919-38678941 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1189205109 X:39231191-39231213 ATTCTGATTCAGTAAGTCTTGGG - Intergenic
1189236859 X:39493882-39493904 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1189363036 X:40368176-40368198 TCTCTGATTCAGCAAGTCTGAGG - Intergenic
1190013406 X:46805144-46805166 GTTCAGATTCAGTAGGTCTGTGG + Intergenic
1190475169 X:50820132-50820154 TTTTGAAGTCAGTAAGTGTGAGG + Intergenic
1190702889 X:53001212-53001234 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1190827639 X:54032233-54032255 TTTCTGATTCAGTCAGTCTGGGG + Intronic
1190831011 X:54059480-54059502 TTTCAGATTCTGTAGGTTTGAGG + Intergenic
1191025829 X:55912158-55912180 TTTCTGAATCAGTATGTCTGGGG - Intergenic
1191676185 X:63794730-63794752 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1192910913 X:75603131-75603153 TTTCAGAGTCAGAAAGTGAGTGG + Intergenic
1193853213 X:86565440-86565462 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1194011844 X:88571177-88571199 TTTCTGATTCAGCAAGTCTGGGG + Intergenic
1194644226 X:96439058-96439080 TTTCTGATTCAGTAGGTCTCAGG + Intergenic
1194748319 X:97654703-97654725 TTTCTGATTCTGTAATTTTGAGG - Intergenic
1194912315 X:99661501-99661523 ATTCTGATTCAGTAAGTCTGAGG - Intergenic
1195179409 X:102342355-102342377 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1195317019 X:103689013-103689035 CTTCTGATTCATTAAGTTTGAGG - Intergenic
1195372371 X:104189984-104190006 TTTCTGATTCACTATGTCTGGGG - Exonic
1195373583 X:104203481-104203503 ATTCTGATTCAGTAAGTCTGTGG + Intergenic
1195526144 X:105891672-105891694 TTTCTGATTCAGTAGATTTGGGG + Intronic
1195954381 X:110314023-110314045 TTTCTGATTCAGTTGGTGTGGGG - Intronic
1196035311 X:111137417-111137439 ATTCAGATTCAGTTAGTCTGGGG - Intronic
1196057388 X:111370406-111370428 CTTCTGATTCAGTAAGTCTGAGG - Intronic
1196089441 X:111724311-111724333 TTTCTGATTCAGTAAGTCTGAGG + Intronic
1196120704 X:112047374-112047396 TTTCTGATTCAGTTGGTCTGAGG + Intronic
1196129917 X:112144405-112144427 TTTCTGATTCAGTAGATCTGAGG + Intergenic
1196576083 X:117320726-117320748 CTTCTGATTCAGAAAGTCTGAGG - Intergenic
1196963951 X:121035155-121035177 TTTCTGATTCAGTAAATCTGGGG - Intergenic
1197225518 X:123952483-123952505 ATTCTGATTCTGTAAGTTTGTGG - Intergenic
1197406107 X:126052773-126052795 TTTACTTTTCAGTAAGAGTGAGG - Intergenic
1197669240 X:129257658-129257680 TTTCAGTTTCAGAAAGTGTAAGG - Intergenic
1197674123 X:129311639-129311661 TTTCTGATTCAGTAAATCTGAGG + Intergenic
1197890564 X:131265933-131265955 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1198085455 X:133278100-133278122 ATTCTGATTCAGTAAGTCTGGGG - Intergenic
1198090705 X:133326404-133326426 TTTCTGATTCAGTAACTCTGGGG - Intronic
1198254167 X:134910897-134910919 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1198380785 X:136081479-136081501 TTCCCGATTTAGTAGATGTGGGG - Intergenic
1198559140 X:137829810-137829832 TTTTTGATTCAGTAGGTTTGGGG - Intergenic
1198562057 X:137861087-137861109 TTTCTGATTCAGTAGAAGTGGGG + Intergenic
1198685147 X:139220925-139220947 ATTCTGATTCAGAAAGTCTGGGG - Intronic
1198816652 X:140598660-140598682 TTTACTATTCATTAAGTGGGAGG - Intergenic
1199115636 X:143988810-143988832 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1199725472 X:150575650-150575672 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1199731292 X:150635003-150635025 ATTCTGATTCAGTAGGGGTGAGG + Intronic
1201332680 Y:12843488-12843510 ATTCTGATTCAGATAGTGTGGGG - Intronic
1202364732 Y:24150712-24150734 TTTCTGATTCAGTAGGTCTGTGG + Intergenic
1202506049 Y:25519410-25519432 TTTCTGATTCAGTAGGTCTGTGG - Intergenic