ID: 976064168

View in Genome Browser
Species Human (GRCh38)
Location 4:81164668-81164690
Sequence CCGATTCAGTAAGTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1223
Summary {0: 1, 1: 2, 2: 39, 3: 257, 4: 924}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976064154_976064168 25 Left 976064154 4:81164620-81164642 CCACCATTAGAGTGTTAGGTGTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064153_976064168 26 Left 976064153 4:81164619-81164641 CCCACCATTAGAGTGTTAGGTGT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064162_976064168 -9 Left 976064162 4:81164654-81164676 CCCAACTTGAGTTTCCGATTCAG 0: 1
1: 0
2: 1
3: 13
4: 142
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064161_976064168 -8 Left 976064161 4:81164653-81164675 CCCCAACTTGAGTTTCCGATTCA 0: 1
1: 0
2: 2
3: 17
4: 241
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064156_976064168 22 Left 976064156 4:81164623-81164645 CCATTAGAGTGTTAGGTGTGGAT 0: 1
1: 0
2: 2
3: 7
4: 107
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924
976064163_976064168 -10 Left 976064163 4:81164655-81164677 CCAACTTGAGTTTCCGATTCAGT 0: 1
1: 0
2: 5
3: 22
4: 166
Right 976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG 0: 1
1: 2
2: 39
3: 257
4: 924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976064168 Original CRISPR CCGATTCAGTAAGTGTGGGG TGG Intronic
900177016 1:1295432-1295454 CCCTCGCAGTAAGTGTGGGGTGG - Exonic
900899880 1:5509196-5509218 CTGACTCAGCAGGTGTGGGGCGG - Intergenic
901435000 1:9242068-9242090 CTGATCCAGTAGGTGTAGGGTGG - Intronic
902178644 1:14670576-14670598 CTGATTCAGTAGATCTGGGGAGG + Intronic
902182040 1:14696711-14696733 CTGATTCAGCAGGTCTGGGGTGG + Intronic
902186135 1:14726786-14726808 CTGATTCAGCAGGTCTGGGGCGG - Intronic
902212551 1:14914147-14914169 CTGATTCAGGAGGTCTGGGGTGG + Intronic
902427660 1:16337204-16337226 CAGATTCAGTAAGCCTCGGGTGG + Intronic
902471863 1:16653455-16653477 CTGATTCATTAAATGTGGGATGG + Intergenic
902486941 1:16753989-16754011 CTGATTCATTAAATGTGGGATGG - Intronic
902520133 1:17011386-17011408 CCGATTAAGTGGGCGTGGGGTGG + Intronic
902563246 1:17291870-17291892 CTGATTCAGAAGGTGTGGGTGGG - Intergenic
902714336 1:18262066-18262088 CTGATTCAGCAGGTCTGGGGCGG + Intronic
902959457 1:19952364-19952386 CTAATTCAGTAAGTGTGGGGTGG - Intergenic
902984461 1:20147209-20147231 CAGATTCAGTAGGTCTGGGTGGG - Intronic
903139281 1:21329191-21329213 CTAACTCAGTAAGTGTCGGGGGG - Intronic
903573518 1:24323307-24323329 CTGATTCAGTAGGTCTAGGGTGG - Intronic
903673503 1:25050413-25050435 CTGATTCGGCATGTGTGGGGTGG + Intergenic
903912688 1:26739377-26739399 CTGATTCAGTAGGTGTGGGCTGG + Intronic
904683614 1:32245651-32245673 CAGATTCAGTATGTATGGGGTGG - Intergenic
904798326 1:33074261-33074283 CTGATTCAATAGGTTTGGGGTGG - Intronic
904844314 1:33397368-33397390 CAGATTCAGCAGGTCTGGGGTGG - Intronic
904974059 1:34442520-34442542 CTGATTCAGTGCGTGTGGAGTGG + Intergenic
905144968 1:35881256-35881278 TCGATTCAGTAGGTGTTGGGTGG - Intronic
905461398 1:38125215-38125237 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
905556413 1:38888745-38888767 CTGGTTCAGTAGGTCTGGGGTGG - Intronic
905588471 1:39141318-39141340 CTGATTCAGTAGGTCTGGGGTGG + Intronic
905795093 1:40811464-40811486 CTGATTCAGTAAGTTTGAAGTGG - Intronic
907553975 1:55328743-55328765 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
907922623 1:58927897-58927919 CTGATTCAGTCAGTCTGGAGTGG - Intergenic
907952575 1:59197784-59197806 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
908046336 1:60173560-60173582 CTGATTCAGCAAGTGTGGCATGG + Intergenic
908197159 1:61756418-61756440 CTGATTCAGTAGGTCTGAGGTGG - Intronic
908443284 1:64177081-64177103 CAGATTCAGTAGGTCTGAGGTGG + Intronic
909323380 1:74318315-74318337 CTGATTCAGTAATTCTGGAGGGG + Intronic
909414987 1:75396040-75396062 CTGATTCAATAAGTCTGGGATGG + Intronic
909569041 1:77087380-77087402 CTGATTCAGTAGGTCTGAGGTGG + Intergenic
909688561 1:78378574-78378596 CTGATTTAGTAAGTCTGGGCTGG + Intronic
910059291 1:83069096-83069118 CTGATTCAGCAAGTCTGGGATGG - Intergenic
910250755 1:85196330-85196352 CAGATTCTATAGGTGTGGGGTGG - Intronic
910303807 1:85738940-85738962 CTGATTTATTAAGTCTGGGGTGG + Intronic
910474147 1:87589022-87589044 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
910919752 1:92330906-92330928 CTCATTCAGTAAATATGGGGTGG - Intronic
911012988 1:93301089-93301111 CCGTTTCAATAAGTCTGGGGTGG + Intergenic
911417133 1:97589023-97589045 CTGATTCAGTAAGTCTGGGGTGG - Intronic
912253924 1:108039838-108039860 CTGATTCAGTAATGCTGGGGTGG - Intergenic
912477970 1:109953740-109953762 CTGACTCAGTAAGTCTGAGGTGG - Intergenic
912584936 1:110753806-110753828 CCGATTCAGTAAATCTAGGATGG - Intergenic
913058855 1:115186529-115186551 CTGGTTCAGTAGCTGTGGGGTGG - Intergenic
913062211 1:115218921-115218943 CAGATTCAGTAGGTCTGGGGTGG + Intergenic
913344755 1:117797163-117797185 CAGATTCAGTAGGTCTGGAGTGG - Intergenic
913439955 1:118886747-118886769 CTGATTCTGTAAGTCTGGGGTGG + Intronic
913454583 1:119018300-119018322 CTCATTCAGTAGGTGTGGGGTGG + Intergenic
914344155 1:146783796-146783818 CCGATTCCGTAGGTCTGGGCTGG + Intergenic
914387162 1:147180882-147180904 CTGATTCTGTAAGTCTGGAGTGG + Intronic
914390422 1:147216788-147216810 CTGATTCAGTAGGTCTGAGGTGG - Intronic
915165177 1:153944378-153944400 CAGATGCAGTGAGTGAGGGGGGG - Exonic
916213027 1:162373775-162373797 CTGATTCAGTAGGTCTGAGGAGG + Exonic
916561422 1:165936825-165936847 CTGATTCAGAAACTCTGGGGAGG + Intergenic
916875369 1:168963133-168963155 CTGATTCAGTACGTTTGGAGTGG + Intergenic
917057331 1:170997467-170997489 CTGATTCAGTAGGTCTGAGGTGG - Intronic
917634844 1:176925424-176925446 CTAATTCAGTAAGTCTGGGTGGG - Intronic
917640926 1:176982474-176982496 CTGATTCAGTAGGTCTGGGGTGG + Intronic
917748758 1:178036136-178036158 CTGATTCAGTAGGTCTGGGATGG - Intergenic
917772573 1:178295672-178295694 CTGATGCAGTAGGTCTGGGGTGG + Intronic
918420760 1:184362197-184362219 CTGATTCAGTAGGTTTGGGATGG - Intergenic
918516221 1:185366725-185366747 CTGACTCAGTAAGTCTGGGGTGG - Intergenic
919034728 1:192292416-192292438 CTGATTCAGTAGGTTTGGGCGGG - Intergenic
919090556 1:192974033-192974055 CCGTTTCAGTAGGTCAGGGGTGG - Intergenic
919328613 1:196140071-196140093 CAGTTTCCGTAAGTGTGGTGTGG + Intergenic
919536285 1:198791708-198791730 CTGATTCAGGAAGTCTAGGGTGG + Intergenic
919703460 1:200654470-200654492 CTGATTCAGTAGGTGTGAGTTGG - Intronic
919939155 1:202274620-202274642 CTGATTTAGTAAGTCTGGGGTGG + Intronic
920128931 1:203715943-203715965 CCAATTCAGTAAATCTGGGGTGG - Intronic
920567496 1:206986536-206986558 CTGATTCAGTAGGTCTGGGATGG + Intergenic
921066555 1:211626981-211627003 CCGATTCAGAAACTGAGGGTGGG - Intergenic
921124128 1:212161969-212161991 CTGATTCAGTGAGTCTGAGGGGG - Intergenic
921286264 1:213612148-213612170 CAGATTCAGTAGGTCTGGGGTGG - Intergenic
921315850 1:213889627-213889649 CTGTTTCAGAAAATGTGGGGTGG + Intergenic
921996984 1:221430956-221430978 TCCATTCAGTTAGTGTGGGGTGG + Intergenic
922063053 1:222109899-222109921 CAGATTCAGTAGGTCTGGGGCGG - Intergenic
922089917 1:222386156-222386178 CTGATTCAGTAGGTTTGGGTGGG + Intergenic
922121357 1:222672511-222672533 CGGATTCAGGATGTCTGGGGTGG + Intronic
922408299 1:225341992-225342014 CAGATTCAGTAAGTCTGTGGCGG - Intronic
923006865 1:230057229-230057251 CTGATTCAGTAGGTCTGGGATGG + Intergenic
923607900 1:235461348-235461370 AAGATTCAGTAGGTCTGGGGTGG + Intronic
924098741 1:240582026-240582048 CTGATTCAGGAAGTCTGGGGTGG + Intronic
924736614 1:246762920-246762942 CTGATTCAGTAGGTCTGGAGTGG + Intronic
924737721 1:246773487-246773509 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1063784702 10:9367452-9367474 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1063817090 10:9787876-9787898 CTGATTTAGAAAGTTTGGGGTGG - Intergenic
1064378254 10:14816481-14816503 CTGATTCAGTGGGTCTGGGGTGG - Intergenic
1064847815 10:19675525-19675547 CTGATTCATTAAGTCTGGGGTGG - Intronic
1065023981 10:21524577-21524599 CCGATTCACTAAGGCGGGGGGGG + Intronic
1065308838 10:24394961-24394983 CTGATTCAGTAGGTCTAGGGTGG + Intronic
1065315402 10:24459012-24459034 CTGATTCAGTAGGTCTCGGGTGG - Intronic
1065360692 10:24886567-24886589 GTGATTCTGTATGTGTGGGGTGG + Intronic
1065476578 10:26144829-26144851 CTGACTCAGTAGGTTTGGGGTGG - Intronic
1065738599 10:28776115-28776137 CTGATTCAGTAAATCTGGGGTGG + Intergenic
1065779307 10:29151915-29151937 CAGATTCAGTGGGTCTGGGGTGG + Intergenic
1066112528 10:32210112-32210134 CCGCTTCAGTAGGTCTGAGGCGG - Intergenic
1067176763 10:43955493-43955515 CTGATTCAGTAGGTCTGAGGTGG + Intergenic
1067374674 10:45716853-45716875 CCGATTCAGTAGGTCCAGGGTGG - Intergenic
1067379059 10:45755691-45755713 CCGATTCAGTAGGTCCAGGGTGG + Intronic
1067717398 10:48699967-48699989 ACAAGTCAGTAAGTCTGGGGTGG - Intronic
1067853948 10:49775222-49775244 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
1067886762 10:50096354-50096376 CCGATTCAGTAGGTCCAGGGTGG + Intronic
1067938678 10:50634008-50634030 CTGATTCAGTAGGTCCGGGGTGG - Intergenic
1068188134 10:53613633-53613655 TCAATTCAGTAAGTCTGGGGAGG + Intergenic
1068410884 10:56652921-56652943 CTGATTCAGTTAGTCTGGGGTGG - Intergenic
1068476008 10:57526283-57526305 CTGATTCAGTAGGTTTGGGTGGG + Intergenic
1068928907 10:62568536-62568558 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1069375185 10:67786300-67786322 CTGATTCAGTGGGTCTGGGGTGG + Intergenic
1069827747 10:71264727-71264749 CTGATTCAGTCGGTGTGGGGTGG - Intronic
1069850221 10:71399278-71399300 CTGATTCAGAAGGTCTGGGGTGG - Intronic
1070028524 10:72654827-72654849 CTAATTCAGTAAGACTGGGGTGG - Intergenic
1070045138 10:72826148-72826170 CTGATTCAGTAAGTCAGAGGTGG + Intronic
1070276757 10:75014694-75014716 CCGGTTCAGTAGGTCAGGGGTGG - Intronic
1070481588 10:76888210-76888232 CCAATTCAGTAGGTCTGGGTGGG - Intronic
1070514261 10:77189096-77189118 CTGATTTAGTAGGTTTGGGGTGG + Intronic
1070625307 10:78046934-78046956 CTGATTCAGTAATTCTAGGGTGG - Intronic
1070714638 10:78710419-78710441 CTGATTCAGTGTGTCTGGGGTGG + Intergenic
1070804372 10:79262279-79262301 CTGATTCAGTGGGTCTGGGGTGG - Intronic
1070994101 10:80760599-80760621 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1071129644 10:82376087-82376109 CTGTTTCAGTAGGTCTGGGGTGG + Intronic
1071331341 10:84564129-84564151 CTGATTCAGTAGGTCTGGGTGGG - Intergenic
1071451035 10:85791511-85791533 CTGTTTCAGAAAGTGTAGGGAGG - Intronic
1071786985 10:88912188-88912210 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1072110606 10:92316529-92316551 TCTATTCAGTAAAAGTGGGGTGG - Intronic
1072576039 10:96701121-96701143 CCTATTCAGTAGGTCTGGGGTGG + Intronic
1072755259 10:98016487-98016509 CGGATTTGGTAGGTGTGGGGTGG + Intronic
1072908949 10:99483145-99483167 CTCATTCAGTAAGTCTGGGGTGG - Intergenic
1072908990 10:99483405-99483427 CTGATTCAGTAGGTTTGGGAGGG + Intergenic
1073463787 10:103681959-103681981 CTGATTCAGTAGGTCTGGGCAGG + Intronic
1073541206 10:104317414-104317436 CCGATTCAGTAAGTGTGGGTGGG - Intronic
1073722650 10:106191003-106191025 CTGATTCAGTAAGTCTGGAGAGG - Intergenic
1074685132 10:115954913-115954935 CTCATTCAGTAGGTCTGGGGTGG + Intergenic
1074904799 10:117852218-117852240 CTGGTTCAGTGAGTCTGGGGTGG + Intergenic
1074920310 10:118001913-118001935 CTGATTCAGTAGGTCTGGGTAGG + Intergenic
1074963947 10:118472476-118472498 CTGATTCAGTAGGTATGGGGTGG - Intergenic
1074984220 10:118642963-118642985 CTGATTCAGTGGGTCTGGGGTGG - Intergenic
1075187494 10:120276176-120276198 CCAAATCAGTAGGTCTGGGGAGG - Intergenic
1075197105 10:120369362-120369384 CGGATTCAGTACGTTTGGGGAGG + Intergenic
1075853818 10:125610468-125610490 CCGATTCAGCAGGTTTGGGTGGG - Intronic
1077587082 11:3462098-3462120 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1078268724 11:9774927-9774949 CTGATTCAGTAGGTTTGGGGTGG - Intergenic
1078370734 11:10742624-10742646 CTGATTCAGTAGGTATGGGGTGG - Intergenic
1078655670 11:13236495-13236517 ATGATTCAGTAGGTCTGGGGTGG + Intergenic
1078732197 11:13985058-13985080 CTGATTCAGTAAGTCTGGATGGG - Intronic
1078756700 11:14217950-14217972 CTGATTCAGTAGGTGTAGGCTGG - Intronic
1078814297 11:14803495-14803517 CTGATTCACTAAGTCTTGGGTGG - Intronic
1078883568 11:15477482-15477504 TGGATTCAGTAAGTCTGGGCTGG + Intergenic
1079015754 11:16867258-16867280 CTGATTCAGTAGGCCTGGGGTGG + Intronic
1079154464 11:17931815-17931837 CTGATTCAGTAGGTCTGGGAAGG - Intronic
1079442671 11:20531079-20531101 CCAATTCAGCAGGTTTGGGGTGG + Intergenic
1079498499 11:21074209-21074231 CTGATTCAGTAGGTCTGGGAGGG - Intronic
1080115107 11:28613270-28613292 CTGTTTTAGTAAGTGTGTGGTGG + Intergenic
1080603096 11:33840009-33840031 CAGATTCAGTAACTCTGGGTTGG + Intergenic
1080611649 11:33909334-33909356 CTGATTGAGTAAGTCTAGGGTGG - Intergenic
1080612359 11:33915532-33915554 TTGATTCAGTAGGTCTGGGGTGG + Intergenic
1080637339 11:34135499-34135521 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1080757380 11:35215090-35215112 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1080757573 11:35216836-35216858 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1080758910 11:35228833-35228855 CTGATTCAGCAGGTTTGGGGTGG + Intronic
1080873104 11:36253976-36253998 CTGATTCAGTAGGTCTGGGGAGG + Intergenic
1080887798 11:36382504-36382526 CCGATTCAGTAGGTCTGGGCTGG + Intronic
1081067177 11:38558733-38558755 CTGATTCAGTAAGTTTTGGTAGG - Intergenic
1081637368 11:44729417-44729439 CCAATTCAGGAAAAGTGGGGTGG - Intronic
1081932960 11:46885297-46885319 CTGATTCAGTAAGTCTAGGGTGG + Intronic
1083140730 11:60719001-60719023 CTAATTCAGTAAGTCTGGGATGG - Intergenic
1083274106 11:61587299-61587321 CCGAGTCTGGTAGTGTGGGGTGG + Intergenic
1084069677 11:66726367-66726389 ACGATTCAGTACTTCTGGGGTGG + Intronic
1084103089 11:66962970-66962992 ATGATTCAGTCAGTTTGGGGTGG + Intergenic
1084130800 11:67132812-67132834 CTGGTTCAGTAAGTTTGGGGTGG - Intronic
1084243077 11:67836110-67836132 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1084292364 11:68182346-68182368 CTGATTCAGTAGCTTTGGGGTGG - Intronic
1084450343 11:69233123-69233145 CTGATTCAGTCAGTGTGAGGTGG + Intergenic
1084454306 11:69258702-69258724 CTGATTCAGCAAGTCTGAGGAGG - Intergenic
1084549611 11:69833321-69833343 CCCATGAAGTAAGTGTGGTGGGG - Intergenic
1084829913 11:71760832-71760854 CTGATTCATTAGGTCTGGGGTGG + Intergenic
1084909003 11:72372643-72372665 CTGATTGAGTATGTCTGGGGTGG - Intronic
1085198145 11:74684407-74684429 CCGATTCAGCAGATGTGAGGTGG - Intergenic
1085389609 11:76175749-76175771 CCAATTCGGTAGGTCTGGGGTGG + Intergenic
1085389803 11:76176562-76176584 CCAATTCGGTAGGTCTGGGGTGG + Intergenic
1085442599 11:76578048-76578070 CTGATTCAGCAGGTCTGGGGCGG + Intergenic
1085617955 11:78016007-78016029 CTGATTCAGTAGGTCTGAGGTGG + Exonic
1085844653 11:80051350-80051372 CTGATTCAGTGTGTCTGGGGTGG + Intergenic
1085906064 11:80764529-80764551 CTGACCCAGTATGTGTGGGGTGG + Intergenic
1086059910 11:82689958-82689980 CAGATCCAGTAGGTCTGGGGTGG - Intergenic
1086344725 11:85884389-85884411 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1086446509 11:86876623-86876645 CTGATTCAGTAGGTCTGTGGTGG - Intronic
1086482773 11:87260881-87260903 AAGATTCAGTAGGTCTGGGGTGG + Intronic
1086856026 11:91867120-91867142 CCAATTCAGTAGGTCTGGTGAGG + Intergenic
1086948945 11:92871399-92871421 CCGATTCAGTGGATTTGGGGTGG - Intronic
1086980075 11:93186888-93186910 CCCACTCAGTAAGTCTGGGGTGG + Intronic
1087177212 11:95106880-95106902 TCTATTCAGTATGTCTGGGGTGG - Intronic
1087275196 11:96154206-96154228 CTGATTCAGTAGGTCTCGGGTGG + Intronic
1087679217 11:101200493-101200515 TCTATTCAGTAGGTGAGGGGTGG - Intergenic
1087971045 11:104484565-104484587 TTGATTCAGTAGGTCTGGGGTGG - Intergenic
1088001705 11:104889583-104889605 CTTATTCAGTAGGTCTGGGGTGG - Intergenic
1088496513 11:110436594-110436616 GTGACTCAGTAAGTCTGGGGCGG - Intronic
1088615249 11:111620051-111620073 CCAATTCAGTATGTCTGGGATGG + Intronic
1089364412 11:117912314-117912336 CTTATTCAGTAGGTCTGGGGGGG - Intronic
1089412733 11:118260453-118260475 CTAATTCAGTAGGTCTGGGGTGG - Intronic
1089793983 11:120965780-120965802 CTGATTCAGTAGGCCTGGGGTGG - Intronic
1089807791 11:121106886-121106908 CTGACTCAGTAGGTGTGGGGTGG - Intronic
1089951602 11:122533378-122533400 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1089996020 11:122908264-122908286 CTGATTCAGCAGGTGTAGGGTGG + Intronic
1090344181 11:126054674-126054696 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1090477000 11:127032126-127032148 CTGATTCAGTAAATCTGGAGGGG - Intergenic
1090479360 11:127054627-127054649 CTGATTCAGTAGGTCTGAGGTGG - Intergenic
1090561756 11:127940010-127940032 CTGATTCAGTAGGTCTGGGATGG + Intergenic
1091076615 11:132624290-132624312 CAGTTTCAGTAAGGGTGTGGTGG - Intronic
1091610036 12:1999128-1999150 CTGATTCAGTAGGTTTGGGCAGG - Intronic
1091805271 12:3351454-3351476 CTAATTCAGTAAGTCTGGGGTGG + Intergenic
1091834274 12:3574391-3574413 CTGATTCAGTAGGTCTGGCGTGG + Intronic
1091960310 12:4688666-4688688 CTGATTCAGTAGGTCTGGGGTGG - Exonic
1092234382 12:6797086-6797108 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1092413323 12:8270845-8270867 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1092480971 12:8858693-8858715 CTCATTCAGTAGGTGTGGGCTGG - Intronic
1093133250 12:15417570-15417592 CTGATTTAGTAAGTCTGGGGTGG - Intronic
1093947072 12:25121130-25121152 CGGATTCAGTAAGTTTGAGGTGG + Intronic
1094059094 12:26294429-26294451 CTCATTCAGTAAGTCTGGGGTGG - Intronic
1094166246 12:27446818-27446840 CTGATTCAGTAAGTCTGGGAGGG + Intergenic
1094182558 12:27607565-27607587 CTGATTCAGTAGGTGTGGGGTGG + Intronic
1094607165 12:31959113-31959135 CTGATTCAGTAGGTTTGGGGTGG - Intergenic
1094697931 12:32840130-32840152 CTGATTCAGAAGGTCTGGGGTGG + Intronic
1095499490 12:42820908-42820930 CCGATTCAGTAGGTCTGGAGAGG - Intergenic
1095641245 12:44487506-44487528 CAGATTCATTAAGTGTTGTGAGG - Intergenic
1095797546 12:46236825-46236847 CTGATTCTGTAAGTCTGGGGTGG - Intronic
1095988356 12:48016066-48016088 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1096558182 12:52417009-52417031 CTGATTTAGTAAGTCTGGGCTGG - Intergenic
1096657612 12:53101457-53101479 CTGATTCAGGAGGTGTGGGGTGG + Intronic
1096756978 12:53807887-53807909 CCTCTTCAGTAAGTCAGGGGTGG - Intergenic
1097283014 12:57857001-57857023 CTGATTCAGTAGGTGTGAGGTGG - Intergenic
1097416032 12:59317742-59317764 CCCATTCTGTAAGTGGGGCGTGG - Intergenic
1097972601 12:65650576-65650598 TTGATTCAGTAAGTCTGGGGTGG - Intergenic
1098136205 12:67405111-67405133 CTGATTCAGGAAGTCTGGGGTGG + Intergenic
1098288941 12:68936185-68936207 CTGATTCAGTAGGTTTGGAGTGG - Intronic
1099012300 12:77305923-77305945 CTGATTCAGTAGGTCTTGGGTGG - Intergenic
1099543384 12:83944282-83944304 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1100213592 12:92424390-92424412 CTGATTCAGTGAGTCTGGGATGG - Exonic
1100377547 12:94031328-94031350 CAGATTCAGTTCGTGTGGGGTGG - Intergenic
1100611095 12:96193158-96193180 CAGATTCAGTAGGTCGGGGGTGG - Intergenic
1100728501 12:97436557-97436579 CCGAATCAGTAACTGTGGTAAGG + Intergenic
1101076239 12:101132467-101132489 CTGATTCAGTAAGTATATGGTGG + Intergenic
1101400044 12:104379303-104379325 CTCATTCAGTAGGTCTGGGGTGG + Intergenic
1101521970 12:105492359-105492381 CTGATCCAGTCAGTCTGGGGTGG - Intergenic
1101540816 12:105663552-105663574 CAGATTCAGTATGCCTGGGGTGG + Intergenic
1101578423 12:106019420-106019442 CTGATCCAGTATGTTTGGGGTGG + Intergenic
1102077943 12:110074921-110074943 CTGATACAGTTAGTGTGGGTGGG - Intergenic
1102100410 12:110274105-110274127 TCAATTCAGTAGGTCTGGGGTGG - Intergenic
1102308968 12:111828903-111828925 CTGATTCCTTAGGTGTGGGGTGG - Intergenic
1102545366 12:113650643-113650665 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1102922713 12:116804311-116804333 CTGAATCAGTAGGTCTGGGGTGG - Intronic
1102922719 12:116804325-116804347 CTGATTCAGAAACTGTGAGGTGG + Intronic
1102939719 12:116928778-116928800 CAGATTCAGGAAGTCTGCGGTGG + Intronic
1103128182 12:118443011-118443033 CTGATTCAGCAGGTTTGGGGAGG + Intergenic
1103290327 12:119840351-119840373 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1103300967 12:119926476-119926498 CTGATTCAGCAGGTTTGGGGTGG - Intergenic
1103915877 12:124375441-124375463 CTGATTCAGTACGTGTGGACTGG + Intronic
1103959645 12:124600959-124600981 CCGATTCAGCAGGTTTGGGGTGG + Intergenic
1104004905 12:124885045-124885067 CTGATTCAGTAGGTCTGGGTGGG + Intergenic
1104048877 12:125183521-125183543 CTGGATCTGTAAGTGTGGGGAGG - Intergenic
1104427443 12:128689839-128689861 CAGATTCAGCAGGTCTGGGGTGG - Intronic
1105664060 13:22532657-22532679 CTGATGCAGTAGATGTGGGGTGG + Intergenic
1105967654 13:25399255-25399277 CTGATTCAGGAAGTCTGGGATGG + Intronic
1105982052 13:25527357-25527379 CTGATTCAGTACGTCTGGGGTGG - Intronic
1106285180 13:28312471-28312493 CTACTTCTGTAAGTGTGGGGAGG - Intronic
1106444404 13:29812459-29812481 ATGATTCAGTATGTCTGGGGTGG - Intronic
1106506779 13:30377253-30377275 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1106527830 13:30558818-30558840 CTGATTCAGTGGGTCTGGGGTGG - Intronic
1106798906 13:33235749-33235771 CCGATTTAGGAAGTCTGGAGGGG - Intronic
1107095486 13:36530765-36530787 CTGATTGAGTAGGTCTGGGGTGG + Intergenic
1107496194 13:40928036-40928058 CAAATTCAGTAAGTATGGGGTGG + Intergenic
1107755279 13:43614904-43614926 CTGATTCAGTAGTTCTGGGGTGG - Intronic
1108000690 13:45903145-45903167 CTGATTTAGTAGGTCTGGGGTGG + Intergenic
1108225110 13:48281311-48281333 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1108379441 13:49842143-49842165 CAGATTCAGTAGGTCTGGGTGGG + Intergenic
1108589160 13:51896850-51896872 CAGATTCAGTATGTCTGGAGTGG - Intergenic
1108674943 13:52728444-52728466 CCCATTCAGTAGGTCTGGGGTGG + Intronic
1108750507 13:53443254-53443276 CTGATTCAGTCAGTGTAGAGTGG + Intergenic
1109088113 13:58002153-58002175 CAGTTTCAGTAAGTGAAGGGAGG + Intergenic
1109204367 13:59465403-59465425 CAGATTCAGTGGGTCTGGGGTGG - Intergenic
1109279957 13:60344694-60344716 CTGATTCAGTAGGTTTGGGATGG - Intergenic
1110278962 13:73670556-73670578 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
1110370254 13:74731898-74731920 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1110435104 13:75470435-75470457 TTGATTCAGTAAGTCTAGGGTGG - Intronic
1111657709 13:91174297-91174319 CTGATTCAGTAGGCTTGGGGTGG - Intergenic
1111667896 13:91292997-91293019 CTGATTCAGCACGTATGGGGTGG - Intergenic
1111804948 13:93029367-93029389 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1111888668 13:94054432-94054454 CTAATTCAGTAGGTCTGGGGTGG + Intronic
1111958042 13:94779681-94779703 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1112017988 13:95347271-95347293 CCAATTCAGTAGGCCTGGGGTGG + Intergenic
1112237961 13:97653156-97653178 CTGATTCAGTAGGTTTGGGTGGG - Intergenic
1112290463 13:98141650-98141672 CCGATTCAGTAGGTTTGGGGTGG - Intergenic
1112366007 13:98756060-98756082 CTGATTCAGTAGCTCTGGGGCGG - Intergenic
1112684958 13:101814193-101814215 CTGATTCAGTAGTTGTGGGATGG - Intronic
1113333741 13:109357747-109357769 CTGATTCACTAGGTCTGGGGAGG + Intergenic
1113882164 13:113633278-113633300 ACGAGTCAGTAAGTGTGTGCCGG + Exonic
1113882185 13:113633419-113633441 ACGAGTCAGTAAGTGTGTGCCGG + Intronic
1114288210 14:21265956-21265978 CTAATTAAGTAAGTCTGGGGTGG - Intronic
1114735809 14:25042743-25042765 CTGATTCAGTAGGTCTGGGATGG - Intronic
1114988272 14:28256844-28256866 CCAATTTAGTATGTGTGGAGTGG - Intergenic
1115200936 14:30853516-30853538 CTGATTCAGTATGTGTGGGGTGG - Intergenic
1115272347 14:31567821-31567843 CTGATTCAGTAAGCCTAGGGTGG - Intronic
1115351539 14:32400816-32400838 CTGATCCAGTAAGTCTGGAGTGG + Intronic
1115424610 14:33243466-33243488 CTGATTCAGTAAGTCTATGGTGG + Intronic
1115490974 14:33957760-33957782 CTGATTCAGTAGGTCTGGGATGG + Intronic
1115537140 14:34383957-34383979 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1115705908 14:35998055-35998077 CTGATTCAGTATGTCTGGGATGG - Intergenic
1115727219 14:36230123-36230145 CTGATTCAGTAAGTCTGGTGTGG + Intergenic
1116868446 14:50050084-50050106 CTGATTCAGTAGGGCTGGGGTGG - Intergenic
1116999919 14:51361909-51361931 CAGACTCAGTAATTCTGGGGTGG + Intergenic
1117045773 14:51811643-51811665 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1117062935 14:51981343-51981365 CAGATTCAGTAAGCCTGGGCTGG + Intergenic
1117142677 14:52805651-52805673 CTGATTCAGTAAGTGCGGGATGG - Intergenic
1117288034 14:54306490-54306512 CCGATTTATTCAGTCTGGGGTGG + Intergenic
1117665912 14:58055671-58055693 CTGATTCAGGAGGTGTAGGGTGG - Intronic
1117668465 14:58081276-58081298 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1118055972 14:62080253-62080275 CTGATTCAGTAGGTCTGGAGTGG - Intronic
1118150248 14:63181313-63181335 CTGATTCAGTAGGTCTGAGGTGG - Intergenic
1118161733 14:63297595-63297617 CTGATTCAGTAGGTCTGGGCTGG - Intergenic
1118626991 14:67668769-67668791 CTGATTCAATAGGTCTGGGGTGG + Intronic
1118912078 14:70069874-70069896 CTGATTCAGTAGATCTGGGGTGG + Intronic
1118998247 14:70857235-70857257 TTGATTCAGTAGGTCTGGGGTGG - Intergenic
1119131825 14:72179818-72179840 TTGATTCAGTAGGTCTGGGGTGG - Intronic
1119136557 14:72226631-72226653 CCGATTCAGGATATGTGGGCTGG - Intronic
1119192969 14:72696833-72696855 CTGATTCAGTCAGTCTGGGGTGG - Intronic
1119466736 14:74864111-74864133 TCAATTCAGTAGATGTGGGGTGG + Intronic
1119566037 14:75630170-75630192 CAGATTCAGAAAGTTTGGGTTGG + Intronic
1119628663 14:76206681-76206703 CGGATTCAGTAGGTCTGGTGAGG - Exonic
1119661200 14:76453041-76453063 CAGATTCAGTAGGTCTGGGGTGG - Intronic
1119748533 14:77061665-77061687 CCAATTCAGTGGGTCTGGGGTGG - Intergenic
1119893471 14:78200476-78200498 CAGATTCAGGAAGTCTGGGGTGG - Intergenic
1119953731 14:78772672-78772694 CTGATTCACTAGGTCTGGGGTGG + Intronic
1120009870 14:79401412-79401434 CTGAGTCAGTAAGTCTGGTGTGG - Intronic
1120453562 14:84702444-84702466 CTGATTCAGTAGGTGTCAGGTGG + Intergenic
1120909559 14:89653724-89653746 CTGACTCAGTAAGTGTGGGGTGG + Intergenic
1121179953 14:91921555-91921577 CTGACTCAGTAGGTCTGGGGTGG - Intronic
1121225886 14:92321988-92322010 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1121230570 14:92354667-92354689 CTGATTCAGTAGATCTGGGGTGG + Intronic
1121345152 14:93130079-93130101 CTGATTCAGTGGGTCTGGGGCGG + Intergenic
1121489371 14:94346810-94346832 CTGGTTCAGTAGGTGTGCGGTGG + Intergenic
1121658862 14:95619718-95619740 CTGAGTTATTAAGTGTGGGGAGG + Intergenic
1122334451 14:100960964-100960986 CTGATTCAGTAGGTTTGGTGTGG + Intergenic
1124019764 15:25909602-25909624 GGGATTCAGTAGGTCTGGGGTGG - Intergenic
1124505444 15:30268698-30268720 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1124544937 15:30618147-30618169 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1124738108 15:32269933-32269955 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1124778459 15:32607552-32607574 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1125335722 15:38624389-38624411 CTGATTCTGTAGGTCTGGGGTGG + Intergenic
1125983847 15:44029775-44029797 CCGATTCAGTAGGTCTGGGGTGG + Intronic
1126168349 15:45672956-45672978 CTGATTCAGTAGGTCTAGGGTGG + Intronic
1126197312 15:45946659-45946681 CTGATTCGGTAAGTCTGGGGTGG - Intergenic
1126427332 15:48542695-48542717 CCGATTCAGTAGATGTGGCATGG + Intronic
1126437982 15:48655371-48655393 CAGATTCAGTAGGTCTGAGGTGG + Intergenic
1126494217 15:49272468-49272490 CTGATTCAGTAGGTCTGGGATGG + Intronic
1126847752 15:52776941-52776963 CAGGTTCAGTAGGTGTGGGGTGG + Intronic
1126874994 15:53032023-53032045 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1126985358 15:54300655-54300677 CTGATTCAGTAGGTCTGGGATGG - Intronic
1127064128 15:55219536-55219558 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1127070036 15:55279988-55280010 CAGATTCAGTAGGTCTGGAGTGG + Intronic
1127107070 15:55627886-55627908 CTGACTCACTAAGTCTGGGGTGG + Intronic
1127361828 15:58251220-58251242 CTGATTCAGTAAGTTTGAGCTGG + Intronic
1127619107 15:60716092-60716114 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1127621341 15:60737503-60737525 CTGATTCAGTCAGTCTGGGATGG - Intronic
1127634869 15:60859439-60859461 CAGATTCAGTAAGTCTGGGGTGG - Intronic
1127646972 15:60968376-60968398 CTGATTCAGGAAATCTGGGGTGG + Intronic
1127713104 15:61620869-61620891 CCAATTCAGGAAGTCTGAGGAGG - Intergenic
1127738346 15:61869824-61869846 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1127782172 15:62326784-62326806 CCAATTCAGTAGGTCTGGGGTGG - Intergenic
1127861778 15:62999869-62999891 CTGACTCAGTAAGTCTAGGGTGG + Intergenic
1127896172 15:63301103-63301125 CTGATTCAGGAAGTGCGGGGTGG + Intronic
1127938800 15:63671625-63671647 CTGATTCAGTAGGTCTGGTGGGG - Intronic
1127942523 15:63714021-63714043 CTGATTCAGAAGGTCTGGGGTGG - Intronic
1128219230 15:65956304-65956326 CTGATTCAGTCAGTCTGGGATGG - Intronic
1128229768 15:66026244-66026266 CTGATTCAGGAGGTGTGGCGAGG + Intronic
1128633466 15:69287854-69287876 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1128804955 15:70523821-70523843 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1128941004 15:71787592-71787614 CTGATACAGTTAGTCTGGGGTGG + Intergenic
1129032189 15:72627568-72627590 CTGATTCAGGAGGTCTGGGGTGG - Intergenic
1129050183 15:72774621-72774643 CAGATTCAGTAGATGTGGGATGG - Intronic
1129092245 15:73163668-73163690 CCGATTCAGAGGGTTTGGGGTGG + Intronic
1129217707 15:74109671-74109693 CTGATTCAGGAGGTCTGGGGTGG + Intronic
1129448374 15:75634727-75634749 CTGATTCAGGAGGTCTGGGGCGG - Intergenic
1129486998 15:75883671-75883693 CTGATTCAGTAGGTCTGTGGTGG + Intronic
1129734869 15:77953966-77953988 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
1129840722 15:78742025-78742047 CTGATTCAGGAGGTCTGGGGTGG - Intergenic
1129956261 15:79639533-79639555 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1130072411 15:80658873-80658895 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1130097754 15:80868466-80868488 CTGATTCGGTAGGTCTGGGGTGG - Intronic
1130264044 15:82382626-82382648 CCTGTTCAATAACTGTGGGGTGG - Intergenic
1130284731 15:82545554-82545576 CTGATTCAGTGGGTTTGGGGCGG - Intronic
1130612940 15:85378094-85378116 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1130916354 15:88308066-88308088 CTGATTCAGCAAATTTGGGGCGG + Intergenic
1131156014 15:90076038-90076060 CTGATTCAGTAGATCTGGGGTGG + Intronic
1131428417 15:92366459-92366481 CCGATTCAGTAGGTCTGGGGTGG + Intergenic
1131446483 15:92502212-92502234 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1131481654 15:92787486-92787508 CTGATTCAGTAGGTGTGGGGTGG - Intronic
1131538773 15:93258707-93258729 CTAATTCAGTATGTCTGGGGTGG + Intergenic
1131643715 15:94319484-94319506 CTGATTCAGTGTGTCTGGGGTGG + Intronic
1132925445 16:2426971-2426993 CTGATTCAGTAAGTTTTGGGTGG - Intergenic
1133354534 16:5126350-5126372 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1133467864 16:6045165-6045187 CTGATTCAGTAAGTCTAGGGTGG + Intronic
1133770691 16:8865914-8865936 GCCATTCAGCAGGTGTGGGGTGG + Intronic
1134234847 16:12457402-12457424 CCCAATCACTAAGAGTGGGGAGG - Intronic
1134346924 16:13399775-13399797 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1134419793 16:14075547-14075569 CTGATTCAGTAGGTCTGGGCTGG + Intronic
1134438344 16:14282171-14282193 CTGATTCAGTTAGTCTGGGCTGG - Intergenic
1134686631 16:16163423-16163445 CCGATTCAGTCATTCTGGGGTGG - Intronic
1134788101 16:16963123-16963145 CTGACTCAGTAAGTTTAGGGTGG + Intergenic
1135165701 16:20137490-20137512 CTGCTTCAGTAAGTCTGGGCAGG - Intergenic
1135396072 16:22132594-22132616 CTGGTTCAGTAGGTCTGGGGTGG + Intronic
1135490070 16:22901417-22901439 CTGATTCAGTAGGTCTAGGGAGG - Intronic
1135569316 16:23536122-23536144 CTGACTCAGTAGGTCTGGGGTGG - Intronic
1135649390 16:24192777-24192799 CTGATTCAGGAGGTCTGGGGTGG - Intronic
1135663657 16:24317753-24317775 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1137734601 16:50714367-50714389 CCCATTCAGTAGGTTTGGGGTGG + Intronic
1137815850 16:51396825-51396847 CTGATTCAGTGGGTCTGGGGTGG - Intergenic
1137855468 16:51790395-51790417 CTGATTCAGTAGATCTGGGGTGG - Intergenic
1138706787 16:58923318-58923340 CTCATTCAGTAAGTCTAGGGTGG + Intergenic
1139005572 16:62567461-62567483 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1139158798 16:64477888-64477910 CTGATTCAGTAAGTCTGAGAGGG - Intergenic
1139279513 16:65758216-65758238 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1139291992 16:65867629-65867651 CCCATTCTGTAGGTCTGGGGAGG + Intergenic
1139989841 16:70931537-70931559 CCGATTCCGTAGGTCTGGGCTGG - Intronic
1140447189 16:75039686-75039708 TGGATTCAGTAGGTCTGGGGTGG - Intronic
1140755691 16:78064649-78064671 CTGATTCATTCAGAGTGGGGTGG + Intronic
1140761510 16:78113198-78113220 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1140854031 16:78961725-78961747 CTGGTTCAGTAAGTCTGAGGAGG + Intronic
1141098365 16:81178978-81179000 CCAATTCGGAAAGTTTGGGGTGG + Intergenic
1141237078 16:82228661-82228683 ATGATTCAGTAGGTCTGGGGTGG + Intergenic
1141238658 16:82244101-82244123 CTGATTCAGCAATTCTGGGGTGG + Intergenic
1141377202 16:83542420-83542442 CTGAATCAGGCAGTGTGGGGAGG - Intronic
1141462772 16:84187513-84187535 CCAATTCGGTGAGTCTGGGGTGG + Intergenic
1143188152 17:5022906-5022928 TGGATTCAGTAGGTCTGGGGTGG - Intronic
1143351224 17:6289680-6289702 CTGATTCAGTAGGTCTGAGGTGG - Intergenic
1143444729 17:7000784-7000806 CTGATTCAGTATGTCTGGGGTGG + Intronic
1143596027 17:7914584-7914606 CTGATTCAGGAAGTCTGGAGTGG + Intergenic
1143902266 17:10183226-10183248 TGGATTCAGTAGGTCTGGGGTGG - Intronic
1143970638 17:10792703-10792725 CAGATTCAGTAGGTCTGGGGAGG - Intergenic
1144038826 17:11390505-11390527 CTGATTTAGTAGGTTTGGGGTGG - Intronic
1144099139 17:11928856-11928878 CTGATTCAGTAAGTTTGGGCAGG + Intronic
1144099668 17:11932515-11932537 CTGATTCAGTAAGTTTGGGTGGG - Intronic
1144213272 17:13032973-13032995 CCGATTCAGTAGGAGTGGAGTGG + Intergenic
1144344520 17:14338024-14338046 CTGATTCAATGGGTGTGGGGAGG + Intronic
1144366192 17:14547208-14547230 CTGATTCAGTAGCTCTGGGGTGG + Intergenic
1144394537 17:14831402-14831424 CTGATTCTGTAGGTCTGGGGTGG + Intergenic
1144462317 17:15468048-15468070 CTGATTCAGTATATGTGGGGTGG + Intronic
1144699079 17:17325047-17325069 CTGATTCAGAAGGTGTAGGGTGG - Intronic
1144805816 17:17966517-17966539 CTGTTTCAGTAGGTTTGGGGTGG - Intronic
1146105428 17:30031291-30031313 CTGATTCAGTAAATATGGGGTGG + Intronic
1146297371 17:31660362-31660384 CTGATTCAGTGAATCTGGGGTGG - Intergenic
1146314389 17:31795757-31795779 CAGATTCAGTGGGTCTGGGGTGG - Intergenic
1146639604 17:34530424-34530446 CTGATTCAGTAGGTATGGGTAGG + Intergenic
1146909563 17:36639840-36639862 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1147546403 17:41405360-41405382 CTGGTTCAGTAAGTCAGGGGTGG + Intergenic
1147711867 17:42472879-42472901 CTGATTCAGTAAGTCTAGGGTGG - Intronic
1148396804 17:47314699-47314721 CTGATTCAGCAGCTGTGGGGTGG - Intronic
1149057861 17:52387259-52387281 CTGATTTAGTAAGTCTGGAGTGG + Intergenic
1149332117 17:55594841-55594863 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1149384002 17:56124131-56124153 CTGATTCAGTAGGTCTGGGACGG + Intronic
1149785972 17:59435308-59435330 TGGATTCAGTATGTTTGGGGTGG - Intergenic
1149910591 17:60563502-60563524 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1149913054 17:60583810-60583832 CTGATTCAGTAAGTCTGGGATGG - Intronic
1150187415 17:63198638-63198660 CCAATTCAATAAGTCTGGAGTGG + Intronic
1150193889 17:63273838-63273860 CTGATTCAGTAGGTGTGGAATGG - Intronic
1150319002 17:64194685-64194707 CTGATTCAGTAGCTGTGGGCAGG - Intronic
1150441591 17:65195932-65195954 CTGATTCAGTAGGAGTGGGTGGG - Intronic
1150602875 17:66665627-66665649 CTGATTCAGGAAGCCTGGGGTGG - Intronic
1150720486 17:67610191-67610213 CCGATTCAGTGGGTCTAGGGTGG - Intronic
1150729426 17:67679000-67679022 CTGAGTCAGTAGGTTTGGGGTGG - Intronic
1151096802 17:71507985-71508007 CTCATTCAGTAAGTCTGGGATGG + Intergenic
1151424515 17:74022125-74022147 CTTGTTCAGTAAGTTTGGGGTGG + Intergenic
1151990791 17:77572687-77572709 CTGATTCAGCAAGTCTGGAGTGG - Intergenic
1152230095 17:79110053-79110075 CCGCTACAGTCAGTGTGGGAAGG - Intronic
1152273462 17:79339581-79339603 CTGATTCAGTATGTGTGGAATGG + Intronic
1153101437 18:1474759-1474781 TGGATTCAGTAGGTCTGGGGAGG + Intergenic
1153197822 18:2620129-2620151 CTGATTCAGTAGGTTTGGGGTGG - Intergenic
1153949751 18:10048089-10048111 CCGATTCAGTAACTGGCCGGTGG - Intergenic
1155300281 18:24422892-24422914 CAGATTCAGTAGGTCTGAGGTGG + Intergenic
1155349430 18:24891945-24891967 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1155509093 18:26559450-26559472 CTGATTCAGCCAGTCTGGGGTGG + Intronic
1155656700 18:28201230-28201252 CTGATTCAGTGGGTCTGGGGTGG + Intergenic
1155668804 18:28344428-28344450 TGGATTCAGTAAGTCTGGGGTGG + Intergenic
1157026220 18:43847125-43847147 CAGATTCAGTACTTTTGGGGTGG + Intergenic
1157108087 18:44793520-44793542 CTAATTCAGTATGTCTGGGGTGG - Intronic
1157681343 18:49609698-49609720 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
1157832757 18:50872118-50872140 CTGATTCAGTGGCTGTGGGGTGG + Intergenic
1157885708 18:51364286-51364308 CTGATTCAGTTGGTCTGGGGTGG + Intergenic
1157899343 18:51499127-51499149 CTGATTCAGTAAATCTGAGGTGG + Intergenic
1157899375 18:51499484-51499506 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1157931451 18:51828257-51828279 CTGATTCAGTAGGTCTGGGATGG - Intergenic
1158123575 18:54077704-54077726 CTGATTCAGTGTGTCTGGGGTGG + Intergenic
1158301870 18:56061564-56061586 CTGATTCAGTAGGGCTGGGGTGG - Intergenic
1158982750 18:62780644-62780666 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1159011571 18:63063297-63063319 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1159058296 18:63488836-63488858 CTGATTCAGTATGTCTGGGGTGG + Intronic
1159143386 18:64424228-64424250 CTGATTCAATAGGTCTGGGGTGG + Intergenic
1159488447 18:69097558-69097580 CTGATTCAGTCAGTCTGGGGTGG - Intergenic
1160270429 18:77378598-77378620 CTGATTCAGTAGGGCTGGGGTGG + Intergenic
1164712528 19:30367624-30367646 TTGATTCAGGAAGTCTGGGGTGG + Intronic
1165392227 19:35545375-35545397 GCGATCGAGTAAGGGTGGGGCGG - Intergenic
1165656421 19:37536325-37536347 CTGATTAAGTAGGTCTGGGGCGG + Intronic
1165695645 19:37898957-37898979 CCAATTGAGTAGGTCTGGGGTGG - Intronic
1166186491 19:41142706-41142728 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1166973540 19:46588600-46588622 CTGATTTAGTAAGTCTGGGGTGG + Intronic
1168083359 19:54026917-54026939 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1168094081 19:54104441-54104463 CTGATTCTGTAGGTCTGGGGTGG + Intronic
1202704263 1_KI270713v1_random:10249-10271 CTGATTCATTAAATGTGGGATGG + Intergenic
925173713 2:1767923-1767945 CGGAGTCAGTAAGTGTGGGGTGG + Intergenic
926080545 2:9982626-9982648 CGGATTCAGTGAGTCTGGGGTGG + Intronic
926418160 2:12671158-12671180 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
926440453 2:12883411-12883433 CTGATTCAGGAAGTTTGTGGTGG + Intergenic
926609218 2:14929148-14929170 CTGATTCAGTAAGTCTGGGATGG - Intergenic
927198430 2:20563864-20563886 CTGATTCAGCAGGTCTGGGGTGG - Intronic
927465798 2:23335610-23335632 CCGATTCAGTAGGCCTGGGTTGG + Intergenic
927507910 2:23626644-23626666 GCCTCTCAGTAAGTGTGGGGTGG + Intronic
927943874 2:27123103-27123125 CCGATACAGTTAGTCTGGAGAGG - Intergenic
928029281 2:27765125-27765147 CTCATTCAGTAGGTCTGGGGTGG + Intergenic
928125962 2:28616450-28616472 CTGATTCAGCAGGTTTGGGGTGG - Intronic
928258884 2:29749198-29749220 CTGATTCAGTAGGTCTGGGGTGG + Intronic
928477692 2:31647276-31647298 CTGATTCAGTGAGTCTGGGATGG + Intergenic
928714741 2:34047352-34047374 TTGATTCAGTAGGTTTGGGGTGG + Intergenic
928726386 2:34178774-34178796 CTGAATCAGTAACTGTGGAGTGG - Intergenic
928726391 2:34178788-34178810 CTGATTCAGTAGATCTGGGGTGG + Intergenic
929238756 2:39631992-39632014 CTGAATCAGTGAGTGTGGGATGG - Intergenic
929434295 2:41915709-41915731 CTGATTCATTAAGTCTGGGGTGG - Intergenic
929752451 2:44729873-44729895 CCGATTCAGCAGGTCTGAGGTGG - Intronic
929837567 2:45420221-45420243 CTGATTCAGTAGGTCTAGGGTGG + Intronic
930014423 2:46960545-46960567 CTGATTCAGTGAGTTTGGGGAGG - Intronic
930142504 2:47966538-47966560 CTTATTCAGTAAGTTTGGGCTGG - Intergenic
930143775 2:47980455-47980477 TTGATTCAGTAGGTGTGGGTGGG + Intergenic
930228824 2:48823017-48823039 CTGACTCAGTAGGTTTGGGGTGG + Intergenic
930366804 2:50449521-50449543 CAGAGTCAGTAGGTGTGTGGGGG + Intronic
930546893 2:52779502-52779524 CTGATTCAGTAGATCTGGGGTGG - Intergenic
930590618 2:53322464-53322486 TTGATTCAGTAAGTCTGGTGGGG - Intergenic
930672115 2:54162557-54162579 CTGATTCAGTACGTCTAGGGTGG - Intronic
930802193 2:55454362-55454384 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
930846540 2:55911605-55911627 CTGATTCAGTCAGTCTGGGGTGG + Intronic
931243337 2:60471849-60471871 CTGATTCAGTAAGTCTGAGGTGG - Intronic
931588223 2:63852297-63852319 CTGATTCAGTAGGTTTGGGGTGG - Intronic
931859049 2:66334487-66334509 CTGGTTCACTAACTGTGGGGCGG + Intergenic
932013389 2:68000295-68000317 CTGATTCAGTAGGTCTGGGCTGG + Intergenic
932027071 2:68145038-68145060 CTGATTCATTATGTTTGGGGAGG - Intronic
932278431 2:70469183-70469205 CTGATTCAGTAGGTCTGGGCTGG - Intronic
932613614 2:73218022-73218044 CTGATTCAGCAGGTCTGGGGTGG + Intronic
933200237 2:79439639-79439661 CAGATTCAGTAAGTCTGGGGTGG + Intronic
933293224 2:80460882-80460904 CTGATTCAGTATATCTGGGGTGG + Intronic
933710802 2:85324455-85324477 CTGATTCATTAGATGTGGGGTGG - Intronic
933934714 2:87192939-87192961 CTTATTCAGTAGGTCTGGGGTGG - Intergenic
934097963 2:88625108-88625130 CTCATTCAGGGAGTGTGGGGTGG + Intronic
934710635 2:96511915-96511937 CCTCTTCAGTAAGTGGGGGGCGG - Intergenic
934929426 2:98408744-98408766 CTGACTCAGTAAGTCTAGGGTGG - Intergenic
934972010 2:98771355-98771377 CTGATTCAGTAGGTCTGGAGAGG - Intergenic
935006152 2:99079484-99079506 CTGATTCAGTAGGTCTGGAGTGG - Intronic
935563429 2:104581933-104581955 CTGATTCAGTGGGTCTGGGGTGG + Intergenic
935584091 2:104785031-104785053 CTGGTTCAGTAAGTATGGCGTGG - Intergenic
936358428 2:111772957-111772979 CTTATTCAGTAGGTCTGGGGTGG + Intronic
936490185 2:112963411-112963433 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
936533891 2:113296101-113296123 CTGATTCAGTAGGTATTGGGTGG - Intergenic
936551568 2:113446938-113446960 CCGATTCAGTAGATCTGGGTTGG - Intronic
936628854 2:114178347-114178369 CTGATTCAGTAGGTCTGAGGTGG + Intergenic
936974856 2:118208655-118208677 CTGATACAGGAAGTCTGGGGTGG + Intergenic
937011133 2:118563707-118563729 TTGATTCAGTAGGTCTGGGGTGG + Intergenic
937209806 2:120261027-120261049 CTGATTCAGTAGGTCTGGAGTGG - Intronic
937419130 2:121739909-121739931 CTGATTCAGTAGGTCTGAGGTGG + Intronic
938050714 2:128168169-128168191 CTGATTCAGTAAGTCTGGGTTGG + Intronic
938590319 2:132729555-132729577 CTGATTCAGTAGGTATGGGGTGG + Intronic
938668596 2:133565278-133565300 ATGATTCAGTAAGTCTGGGGTGG + Intronic
938698330 2:133854546-133854568 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
938743238 2:134252558-134252580 CTGATTCAGTGGGTGTGGGTGGG + Intronic
938771866 2:134507472-134507494 CTGATTCAGTAGGTCTGGGGTGG - Intronic
938920880 2:135993537-135993559 CTGATTCAGTATGTCTGGGATGG - Intergenic
938928736 2:136067434-136067456 TAGAGGCAGTAAGTGTGGGGCGG + Intergenic
939045464 2:137244981-137245003 CTGATTCAATAACTATGGGGGGG + Intronic
939657913 2:144850748-144850770 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
939960622 2:148562006-148562028 CTGATTCAGAAAGTCTGGGCAGG + Intergenic
940739082 2:157486243-157486265 CTGATTCAGTAAGTATGAGATGG - Intronic
940825954 2:158412505-158412527 CTGATTCAGTATTTGTGGGCTGG - Intronic
941282600 2:163572028-163572050 CTGATTCAATAAGTCTAGGGTGG + Intergenic
941283688 2:163582940-163582962 CTGATTCAGTAAGTTTGGAGTGG + Intergenic
941435557 2:165466565-165466587 CTGATTCAGTAGGTATGGGGTGG + Intergenic
941542563 2:166804822-166804844 CTGATTTAGTAAGTCTGGGAAGG - Intergenic
941752048 2:169144045-169144067 CTGATTCAGAAGGTCTGGGGTGG + Intronic
942106924 2:172642510-172642532 GTGATTCAGTAGGTCTGGGGTGG - Intergenic
942494800 2:176528689-176528711 CTGATTCAGTAGGTCTGGGATGG + Intergenic
942551141 2:177120316-177120338 CTGATTCAATAGGTTTGGGGTGG - Intergenic
942611340 2:177745463-177745485 CTGATTCAGTAAGTCTAGGACGG + Intronic
943363310 2:186946520-186946542 CAGATTCAGTAGGTCTGGGTGGG - Intergenic
943395182 2:187324551-187324573 CACTTTCAGTAAGGGTGGGGAGG + Intergenic
943436685 2:187872773-187872795 CTAATTCAGTAGGTTTGGGGTGG + Intergenic
943755592 2:191553768-191553790 CTGATTCAATAGGTCTGGGGTGG - Intergenic
945010845 2:205461733-205461755 CTGATTCAATAGGTCTGGGGTGG + Intronic
945280098 2:208027843-208027865 CTGATACAGTAAGTCTGGGATGG + Intergenic
945412478 2:209527781-209527803 CTGATTCACTAGGTCTGGGGTGG - Intronic
945550697 2:211218463-211218485 CTGATTCAGCAGGTGTGAGGTGG - Intergenic
945727049 2:213483620-213483642 CTGATTTAGTAAGTTTGGGAAGG + Intronic
946398913 2:219458454-219458476 CCGATTCAGTAGGTCGGGGCTGG - Intronic
946548833 2:220777747-220777769 CCGATTCAGTAAGTCTGGGGTGG + Intergenic
946990293 2:225321663-225321685 CTGATTCAGCAAGTCTGGAGAGG + Intergenic
947141012 2:227019369-227019391 CTGATTCTGTAGGTCTGGGGCGG + Intronic
947299111 2:228668205-228668227 CTGATTCGGTAGGTCTGGGGTGG + Intergenic
947606616 2:231490100-231490122 CCGACTGGGAAAGTGTGGGGGGG - Intergenic
947834952 2:233168771-233168793 CAGATTCAGTAGGTCTGGGGTGG + Intronic
947908103 2:233780368-233780390 CTGATTCAGTAAGTCTGGGGTGG + Intronic
948052194 2:234987139-234987161 CTGATTCTGTAGGTCTGGGGTGG - Intronic
948225353 2:236305532-236305554 CTGATACAGTAGGTCTGGGGTGG + Intergenic
1169004343 20:2194249-2194271 CTGATTCAGCGAGTCTGGGGCGG + Intergenic
1169093937 20:2879315-2879337 CTGAATCAGTAGGTTTGGGGTGG + Intronic
1169260538 20:4135107-4135129 CGGATCCAGTAGGTTTGGGGTGG - Intronic
1169304804 20:4480183-4480205 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1169343391 20:4812609-4812631 CTGATTCAGTAATTCTGGGGTGG + Intronic
1169542419 20:6614477-6614499 CAGATTCAGTAGATCTGGGGTGG - Intergenic
1169562099 20:6812657-6812679 CTGATTTAGTAGGTCTGGGGTGG + Intergenic
1169686346 20:8277589-8277611 CTGATTCAGTATGTCTGGGTTGG - Intronic
1169727276 20:8749186-8749208 CTGATTCAGTAGGTCTGGGGCGG + Intronic
1169768465 20:9175147-9175169 CTGATCCAGTAGGTCTGGGGTGG - Intronic
1169782109 20:9320848-9320870 CTGATTCTGTAGGTCTGGGGTGG - Intronic
1169858316 20:10126797-10126819 CTGATTCAGTAAGTCTGGGGAGG - Intergenic
1169872863 20:10265879-10265901 CCAATCCAATAAGTCTGGGGTGG + Intronic
1169916607 20:10689797-10689819 TTGATTCAGAAAGTCTGGGGTGG + Intergenic
1169939722 20:10924107-10924129 CTGATTCAGTAGGTGTGGGTGGG + Intergenic
1170035775 20:11988127-11988149 CTGATTCAGCAAATGTGAGGTGG + Intergenic
1170036207 20:11992912-11992934 CTGATTTAGTAGGTCTGGGGTGG - Intergenic
1170284573 20:14692163-14692185 CTGAATCAGTAGGTGTGGGGTGG - Intronic
1170468663 20:16646436-16646458 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1170542010 20:17398549-17398571 CAGATTCAGTCAGTCTGGGCTGG + Intronic
1170633176 20:18082579-18082601 CTGACTCAGTGAGTCTGGGGTGG - Intergenic
1170741588 20:19063322-19063344 CAGACTCAGTAAGTCTGGGTGGG - Intergenic
1170785270 20:19462233-19462255 CTGATTCCGTGGGTGTGGGGAGG + Intronic
1171089032 20:22266950-22266972 CCCATTCAGTAGGCCTGGGGAGG - Intergenic
1171302708 20:24077770-24077792 CCGATTTAGTAGGTCTGGGCAGG + Intergenic
1171390363 20:24797900-24797922 CTGATTCAGTGAGTCTGGGGTGG - Intergenic
1172248522 20:33462793-33462815 CTGAATCAGTAACTCTGGGGTGG - Intergenic
1172488081 20:35311615-35311637 CTGACTCAGCAAGTCTGGGGCGG - Intronic
1172603348 20:36198349-36198371 CTGATTCAGTAGGTCTGGGCTGG - Intronic
1172699605 20:36845166-36845188 CTGATTCAGCAAGTCTGGGTTGG - Intronic
1173040903 20:39461338-39461360 CTGATTCAGAAAGTCTGGGATGG - Intergenic
1173331775 20:42081245-42081267 CTGATTCAGTAAATCTGGAGTGG + Intronic
1173338737 20:42135427-42135449 CTGATTCAGTGAGTCTGGGCTGG - Intronic
1173338743 20:42135441-42135463 CTGAATCAGAAACTGTGGGGTGG + Intronic
1173339119 20:42138104-42138126 CTGATTCAGTAAGTCTGGGGTGG + Intronic
1173436846 20:43041020-43041042 CTGATTTAGTAGGTCTGGGGTGG - Intronic
1173438658 20:43055899-43055921 TGGATTCAGTAAGTCTGGGCTGG - Intronic
1173538707 20:43835431-43835453 CCCATTCAGTGGGTCTGGGGTGG - Intergenic
1173551042 20:43933433-43933455 CTGATTCAGTAGGTCTGGGGCGG + Intronic
1173897823 20:46564002-46564024 CTGATTCAGCAAGTCTGGGGTGG + Intronic
1174475184 20:50791190-50791212 CTGATTCAGAACGTCTGGGGTGG + Intergenic
1174647959 20:52102324-52102346 CTGATTGAGTAGGTATGGGGTGG + Intronic
1174732837 20:52934950-52934972 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1174741786 20:53021319-53021341 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1174891855 20:54403731-54403753 CTGATTCAGTAGGTCTGGGGAGG - Intergenic
1175597855 20:60249690-60249712 CTGAATCAGCAAGTCTGGGGAGG + Intergenic
1176965929 21:15211342-15211364 TTGATTCAGTATGTGGGGGGAGG + Intergenic
1177438742 21:21090123-21090145 CTGATTCAGTGATTCTGGGGTGG - Intronic
1177799041 21:25809261-25809283 ATGATTCAGTAGGTCTGGGGTGG + Intergenic
1177984419 21:27955764-27955786 CCAATTAAGTGAGTGTTGGGGGG + Intergenic
1178058419 21:28825267-28825289 CTGATTCAGTAGGTCTGGAGAGG + Intergenic
1178083976 21:29094397-29094419 CTGATTCAGAAAGTCTAGGGTGG + Intronic
1178156785 21:29863260-29863282 CTGATTCAGTAAGTCAGGGGTGG + Intronic
1179283213 21:39952752-39952774 TTGATTCAGTAGGTCTGGGGTGG + Intergenic
1179427556 21:41294089-41294111 CTGATTCTGTAGGTCTGGGGTGG + Intergenic
1180597879 22:16990842-16990864 CTGATTCAGTAAGTCTGGAGTGG + Intronic
1181756981 22:25030982-25031004 CCGATTCACTTGGTCTGGGGAGG + Intronic
1182322544 22:29487678-29487700 CTGATTCAGCAGGTCTGGGGAGG - Intronic
1182933035 22:34193077-34193099 CCGATTCAGTAGGTCTGGGATGG + Intergenic
1183024367 22:35053162-35053184 CTGATTCAGTTGGTTTGGGGTGG - Intergenic
1183038420 22:35157983-35158005 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1183222466 22:36524876-36524898 CTGATTCAGTGGGTATGGGGTGG - Intronic
1183652943 22:39169462-39169484 CTGACTCAGTGGGTGTGGGGTGG - Intergenic
1185007527 22:48290845-48290867 CTGATTCAGCAGGTGTTGGGTGG - Intergenic
949194626 3:1290072-1290094 GTGATTCAGTAAGTCTGGGGAGG - Intronic
949334958 3:2964549-2964571 CTGATTCAGAAAGTTTGGGATGG + Intronic
949416545 3:3821076-3821098 TTGATTCAGTAAGTCTGGGATGG - Intronic
949572421 3:5306409-5306431 CTGATTCAGTAGATCTGGGGTGG - Intergenic
949745078 3:7281758-7281780 CTGATTCAGTAGGTCTGGGGTGG - Intronic
949834533 3:8253746-8253768 ATGGTTCAGTAAGTCTGGGGTGG - Intergenic
949894476 3:8759043-8759065 CTGACTCAGTAGGTCTGGGGTGG - Intronic
949933614 3:9099734-9099756 CCGATTCAGTAGGTTTAAGGTGG - Intronic
949951503 3:9232755-9232777 CTGATTCAGTAGGTCTGGGGTGG + Intronic
950236683 3:11327850-11327872 CTGATTCAGCAGGTCTGGGGAGG + Intronic
950393500 3:12715649-12715671 CTGATTCAGTAGATGTGGGATGG - Intergenic
950710444 3:14810048-14810070 CTGATTCAGTGAGGCTGGGGAGG + Intergenic
950912554 3:16609751-16609773 CTGATTCAGTAGGTTTAGGGTGG - Intronic
950964299 3:17135680-17135702 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
950983718 3:17337175-17337197 CTGATTTAGTGAGTCTGGGGTGG + Intronic
951044525 3:18023195-18023217 CTGATTCAGTAGGTGTGGGCTGG - Intronic
951063402 3:18236631-18236653 CTGATTCAGTAGGTCTTGGGTGG - Intronic
951082777 3:18471197-18471219 GAGATTCAGTATGTTTGGGGAGG + Intergenic
951094436 3:18611607-18611629 CTGATTCAGTAGGTCTGGGATGG + Intergenic
951119472 3:18908261-18908283 CTGATTCATTAAATGTGGGATGG - Intergenic
951199968 3:19865335-19865357 CCGATTCAGTATGTCCAGGGTGG - Intergenic
951360393 3:21718001-21718023 CAAATTCAATAAGTCTGGGGAGG + Intronic
951360502 3:21719211-21719233 CTGATTGAGGAGGTGTGGGGTGG - Intronic
951372413 3:21866582-21866604 CTGATTCAGTAGGTATGGGGTGG + Intronic
951597058 3:24329879-24329901 CTGATTCAGTAGGTCTGGAGTGG - Intronic
951609087 3:24471253-24471275 CTGATTCAGTCAGTCTAGGGTGG - Intronic
951612945 3:24511818-24511840 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
951624229 3:24642577-24642599 CTGACTCAGTAGGTCTGGGGAGG + Intergenic
951981411 3:28571120-28571142 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
952001153 3:28787226-28787248 CTGATTCAGTAGGTCCGGGGTGG - Intergenic
952121836 3:30254450-30254472 CTGATTCGGTAGGTGTGGGATGG - Intergenic
952122277 3:30259877-30259899 CAGATTCAGTAGGTCTTGGGTGG - Intergenic
952219765 3:31313347-31313369 CTAATTCAGTAGGCGTGGGGTGG - Intergenic
952418808 3:33113651-33113673 CTGATTCAGAAAGTCTGGGGTGG - Intergenic
952467470 3:33605202-33605224 CTGATTCAGTAATTTTGGGGTGG - Intronic
952470619 3:33647377-33647399 CTGATTCAGTAGGTTTGGGTTGG - Intronic
952530724 3:34259275-34259297 CTGATTCAGTAGGTCTGGGATGG + Intergenic
952839914 3:37637608-37637630 CTGATTCAGTGGGTCTGGGGTGG - Intronic
952857071 3:37781035-37781057 CCGATTTATTAAGTCTGGGGTGG - Intronic
953182087 3:40605317-40605339 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
953204873 3:40817251-40817273 CTGATTCAGTATGTCTGGGGTGG - Intergenic
953344465 3:42163607-42163629 CTGATTCAGTAGGTCTGGAGTGG - Intronic
953370133 3:42380582-42380604 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
953484600 3:43283564-43283586 CTGATTCAGTAGGTCTGAGGTGG + Intergenic
953596016 3:44314795-44314817 CTGATTCATTAAGTCTGGGGTGG + Intronic
953749340 3:45597243-45597265 CTGATTCAGTAGGTCTTGGGTGG - Intronic
953757038 3:45655629-45655651 CTGACTTAGTAAGTGTGGGAAGG - Intronic
953780816 3:45868951-45868973 CTGAGTCAGTAGGTCTGGGGTGG - Intronic
954892294 3:53942034-53942056 CCAATTAAGTATGAGTGGGGAGG - Intergenic
955591520 3:60540970-60540992 CTGGTTCAGTAGGTCTGGGGTGG - Intronic
955776769 3:62441974-62441996 CTGATTCAGTCATTCTGGGGTGG - Intronic
955783167 3:62507673-62507695 CTGATTCAGCAGGTCTGGGGTGG - Intronic
955788611 3:62565516-62565538 CTGATACAGTAAGTCTGGGGTGG - Intronic
955837066 3:63067723-63067745 CTGAGTCAGTAGGTCTGGGGCGG - Intergenic
956435941 3:69234753-69234775 CTGATCCAGTAGGTCTGGGGTGG - Intronic
956525035 3:70149487-70149509 CTGCTTCAGTAGGTCTGGGGTGG - Intergenic
956641752 3:71422384-71422406 CTGATTCAGTCGGTCTGGGGTGG + Intronic
956768500 3:72504866-72504888 CGGGAGCAGTAAGTGTGGGGAGG + Intergenic
956776775 3:72571724-72571746 CCGATGCCGCAAGTCTGGGGTGG + Intergenic
956806193 3:72814405-72814427 CTGATTCAGTGAGTGTGAGGTGG + Intronic
956841391 3:73143420-73143442 CCGACTCAGTAGGTCTGGCGGGG + Intergenic
956871908 3:73426772-73426794 CTGATTCAGTAGCTCTGGGGCGG + Intronic
956903099 3:73737089-73737111 CTGATTCAGTAGGTCTAGGGTGG - Intergenic
957058424 3:75462035-75462057 CTGATTCATTAGGTCTGGGGTGG - Intergenic
957265183 3:77954368-77954390 CGCATTCAGTAGGTGTGAGGTGG + Intergenic
957530690 3:81437692-81437714 CTGATTTAGTAAATCTGGGGTGG + Intergenic
958440705 3:94152990-94153012 CCAATTCACAAATTGTGGGGAGG - Intergenic
958745616 3:98130016-98130038 CTGTTTCAGTAATTCTGGGGTGG - Intergenic
958898282 3:99854952-99854974 CCAATTCAGTAGGTCTGGGGTGG + Intronic
958917428 3:100065183-100065205 CAGATTCAGTAAGTCTGGGGTGG - Intronic
959533705 3:107462127-107462149 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
959844262 3:111014775-111014797 CTGATTCAGTTGGTGTGAGGTGG - Intergenic
959910805 3:111761690-111761712 CTGATTCAGTACATGTGGGTGGG + Intronic
960165292 3:114394606-114394628 CTGATTCAGCATGTCTGGGGTGG + Intronic
960366049 3:116774026-116774048 CTGATTTAGTAAGTCTGGTGTGG - Intronic
960435754 3:117624617-117624639 CTCATTCAGTAGGTCTGGGGTGG - Intergenic
960522373 3:118670213-118670235 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
960631307 3:119734115-119734137 CCGATTCAGTAGGTCTGAGGTGG + Intronic
960636388 3:119788984-119789006 CCCATTCAGTAGGTCTGTGGTGG - Intronic
960855832 3:122101253-122101275 CTGAATCAGTAAGTCTTGGGTGG + Intronic
960914574 3:122682410-122682432 CAGGTTCAGTGAATGTGGGGTGG + Intronic
961144135 3:124580141-124580163 CTGATTTAGTAGGTCTGGGGTGG - Intronic
961890878 3:130129497-130129519 CTGATTCATTAGGTCTGGGGTGG - Intergenic
961936131 3:130585843-130585865 CTGATTCAGTAAGTGTGGGATGG + Intronic
962036295 3:131655236-131655258 CTGATTCAGTAGGTCTAGGGTGG - Intronic
962115338 3:132499936-132499958 CTGATTCAGTGAGTCTGGGGTGG + Intronic
962210471 3:133473118-133473140 CTGCTTCAGTACGTCTGGGGTGG + Intronic
962265032 3:133938731-133938753 CCGACTCAGTAAGTCTGGGGTGG - Intronic
962364527 3:134769273-134769295 CTGATTCAGTAGGTCTGAGGTGG - Intronic
962685310 3:137842085-137842107 CTGATTCAGGAAGTCTGGGATGG + Intergenic
962747684 3:138409612-138409634 CTGATTCATTAGGTCTGGGGTGG - Intergenic
962990409 3:140572671-140572693 CTCATTCAGTAGGTCTGGGGTGG - Exonic
963083643 3:141417084-141417106 CAGATTCAGTCAGTCTGGAGTGG + Intronic
963152810 3:142064321-142064343 CTGATACAGTAGGTCTGGGGTGG - Intronic
963272597 3:143300537-143300559 CTGATTCAGTAGGCCTGGGGTGG + Intronic
963314049 3:143739838-143739860 CAAATTCAGTAAGTCTGGGGTGG - Intronic
963662667 3:148147124-148147146 CTGATTCAGTAGGTCTGGGCTGG + Intergenic
963709511 3:148730747-148730769 CTGATTCAGTAGGTCTGTGGTGG + Intronic
963734409 3:149003660-149003682 CTGATTCTGTAGGTCTGGGGTGG + Intronic
964283693 3:155094970-155094992 CAGATTCAGTAGGTCTGAGGCGG - Intronic
964479041 3:157123816-157123838 CTGATTCACTAGGTCTGGGGTGG - Intergenic
964757101 3:160098290-160098312 CAGATTCAGTAGGTCTGGGTGGG - Intergenic
964807696 3:160629689-160629711 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
964932011 3:162036938-162036960 CTGATTCAGTAGGTTTGGTGTGG + Intergenic
965294843 3:166931635-166931657 TTGATTCAGTAGGTTTGGGGAGG - Intergenic
965486162 3:169281181-169281203 CCGATTCAGCATTTCTGGGGTGG - Intronic
965507459 3:169532204-169532226 CTGATTCAGTGTGTCTGGGGTGG + Intronic
965521261 3:169669663-169669685 CTGATTCAGTAAGCCTGGGGTGG + Intergenic
965733530 3:171797452-171797474 CTGATTCAGTAGGTCTGGGCTGG - Intronic
965814076 3:172618943-172618965 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
966252367 3:177880624-177880646 CCTATTCAGTAGGTCTGGGTGGG + Intergenic
966317280 3:178661735-178661757 CTGATTCAGTAGATTTGGGGCGG - Intronic
966557064 3:181274491-181274513 CAGATTCAGTAAGTCTGGGGTGG - Intergenic
966801110 3:183764926-183764948 CCGATGCAGTAAGTTTGAGATGG - Intronic
966989370 3:185213316-185213338 CTGATTCATTAAATCTGGGGTGG - Intronic
967079541 3:186036633-186036655 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
967505894 3:190252227-190252249 CTGATTCAGTAGGTTTGGGGTGG - Intergenic
967670590 3:192230100-192230122 CTGATTCAGTAAGTGTGGAATGG - Intronic
967855034 3:194110953-194110975 CGGATTCAGTAGGTTTAGGGTGG + Intergenic
967881927 3:194307557-194307579 CTGATTCAGTAATCCTGGGGTGG + Intergenic
967988861 3:195116381-195116403 CTGAGTCAGTAGGTCTGGGGTGG + Intronic
968193745 3:196690147-196690169 CTGATTCAGTAAGTCTGGGGTGG - Intronic
968217082 3:196901957-196901979 CTGATTCAGTAGGTGTGGGATGG - Intronic
969051428 4:4376015-4376037 CTGATTCAGCAAGTCTGGGGTGG + Intronic
969673956 4:8604737-8604759 CCGATTCTGTTTGAGTGGGGAGG - Intronic
969751742 4:9116599-9116621 CTGATTCATTAGGTCTGGGGTGG + Intergenic
969811654 4:9652897-9652919 CTGATTCATTAGGTCTGGGGTGG + Intergenic
969954730 4:10877235-10877257 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
970028492 4:11650015-11650037 CTGATTCACGAAGTCTGGGGTGG - Intergenic
970178620 4:13364327-13364349 TTGATTCAGTAGGTGTGGGGTGG - Intronic
970887427 4:21002648-21002670 CTGATTGAGTAGGTCTGGGGTGG - Intronic
970891106 4:21045298-21045320 TTAATTCAGTAAGTCTGGGGTGG + Intronic
971172947 4:24252273-24252295 CTGATTCAGTAGATCTGGGGAGG - Intergenic
971226781 4:24761429-24761451 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
971464048 4:26935595-26935617 CTGATTCAGTAGGGTTGGGGTGG - Intronic
972313491 4:37902875-37902897 TTGATTCAGTAGGTCTGGGGTGG + Intronic
972408320 4:38766874-38766896 AAGATTCATGAAGTGTGGGGTGG + Intergenic
972554163 4:40164238-40164260 CAGATTCAGAAAGTTTGAGGGGG + Intergenic
972637703 4:40898909-40898931 CTGATTCAGTAGGTCTGGGTAGG + Intronic
972649165 4:40999673-40999695 CTGATTCAGTAGGTCTGGGTTGG - Intronic
972730970 4:41794724-41794746 CTGATTCAGTATGTCTGGGGTGG - Intergenic
973583897 4:52371955-52371977 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
973691471 4:53437598-53437620 CTGATTCAGTAAGTCTGGGGTGG - Intronic
973723564 4:53749838-53749860 CTGATTCAGTAAGTGTGGGTGGG - Intronic
974121046 4:57639722-57639744 CAGATTCAGTGAGTCTGAGGTGG - Intergenic
974373095 4:61042752-61042774 CTGATTCAGTAGGTCTGGGATGG - Intergenic
974604022 4:64125548-64125570 CTGATTCAGTTGGTTTGGGGTGG + Intergenic
975390208 4:73807373-73807395 CCAATTCAGTAAGTGGTGGTGGG + Intergenic
975611477 4:76208118-76208140 CTGATTCAGCAAGTCTGGGATGG + Intronic
975833706 4:78398352-78398374 CTGATTCAGAAAGTCTGTGGTGG + Intronic
976064168 4:81164668-81164690 CCGATTCAGTAAGTGTGGGGTGG + Intronic
977127031 4:93182899-93182921 CTGATTCAGTAGGTCTGGGCTGG - Intronic
977540311 4:98311036-98311058 CTGATTCAGTAGTTTTGGGGTGG + Intronic
978143283 4:105341921-105341943 CTGATTCAGCAAGTCTGGGATGG - Intergenic
978572401 4:110152626-110152648 CTGATTCAGTGGGTCTGGGGTGG + Intronic
978719494 4:111890657-111890679 CTGATTCAGTAAGTTTGGATGGG + Intergenic
978791749 4:112670009-112670031 CTGATTCAATAGGTCTGGGGTGG + Intergenic
979431287 4:120634901-120634923 CTGATTCAGTAGGTCTGAGGAGG - Intergenic
980129377 4:128804032-128804054 CTGTTTCAGTAGGTCTGGGGTGG + Intergenic
980805433 4:137807153-137807175 CTGATTCAGTAAGTCTAGGGTGG - Intergenic
981143568 4:141299734-141299756 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
981274461 4:142882310-142882332 CTGATTCAGTAAGTCTAAGGTGG + Intergenic
982073704 4:151718117-151718139 CCGATTCAGTAGGTCGAGGGTGG + Intronic
982570179 4:157039579-157039601 ATGATTCAGTAAGTTTGGGATGG - Intergenic
982673377 4:158348588-158348610 CTGATTCAGTAGGTCTGGGGTGG - Intronic
983370809 4:166855769-166855791 CTGATTCATTAGGTGTGGGGAGG + Intronic
983924873 4:173389606-173389628 CTGATTCAGTAGGTCTGGGGAGG + Intronic
984047291 4:174816082-174816104 CTGATTCAGTGAGTATGTGGTGG + Intronic
984258825 4:177419738-177419760 CTGATTCAGTAGGTGTGGGGAGG + Intergenic
984795596 4:183657890-183657912 CTGATTCAGTAGGTCTGGGGTGG + Intronic
985029817 4:185778289-185778311 CTGATTCAGTAGGTCTGGCGGGG + Intronic
985884175 5:2663631-2663653 CTGATTTAGGAAGTGTGTGGGGG - Intergenic
986766446 5:10932363-10932385 CTGGTTCAGTAGGTTTGGGGTGG + Intergenic
986771355 5:10976981-10977003 CTGATTCAGTAGGTCTGGAGTGG - Intronic
988116036 5:26892342-26892364 TTGATTCAGTAGGTCTGGGGTGG + Intronic
988478139 5:31606200-31606222 TCTATTCAGCAAGTCTGGGGAGG - Intergenic
988689980 5:33562123-33562145 CTGATTCAGTAGGTCTGGGGAGG + Intronic
989225074 5:39017889-39017911 CTGATTTAGTAGGTCTGGGGTGG + Intronic
989469409 5:41797788-41797810 CTAATTCAGTAAGTGTGGTGAGG + Intronic
989684360 5:44067719-44067741 CTGATTCAGTAAGTCTGAGATGG + Intergenic
989788048 5:45355391-45355413 CTGATTCAGTAGGTCTGGAGTGG - Intronic
990173270 5:53079061-53079083 CTGATTCAGTAGGTCTAGGGTGG + Intronic
990356772 5:54975478-54975500 CTGATTCAGTAGGTTTGAGGTGG - Intergenic
990515502 5:56527637-56527659 CTCATTCAGTAAGTCTGGGTTGG - Intronic
990542169 5:56784448-56784470 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
990731369 5:58812370-58812392 CTGATTCAGGAGGTCTGGGGTGG - Intronic
990758534 5:59102742-59102764 CTGATTCAGTACTTCTGGGGTGG - Intronic
990980548 5:61599038-61599060 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
991112272 5:62914341-62914363 CTGATTCAGTAGGTCTGGGCTGG + Intergenic
991295599 5:65076793-65076815 CGGGTTCAGTAGGTCTGGGGTGG + Intergenic
992202219 5:74395673-74395695 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
992204775 5:74420931-74420953 CTGATTCAGTAGGTTTGGGGTGG - Intergenic
992519855 5:77539430-77539452 GTGATTCAGTAGGTCTGGGGTGG + Intronic
992532933 5:77670073-77670095 CTGATTCAGTAAGTCTGGAGTGG - Intergenic
992599328 5:78382124-78382146 CTCATTCAGTAGGTCTGGGGTGG - Intronic
992614729 5:78537056-78537078 CCGATTCAGTGGGTCTGGGTTGG - Intronic
992647411 5:78824496-78824518 CTGATTCAGTCAGGCTGGGGTGG - Intronic
993600284 5:89914631-89914653 CTGATTCAGTAGGTCTGGGATGG - Intergenic
993681730 5:90886450-90886472 CTGATTCAGTATGTTTGGGGTGG - Intronic
993865744 5:93192903-93192925 CAGATTCAGTAGGTGTGGGGTGG - Intergenic
993871495 5:93259994-93260016 CTGATTCACTAAATCTGGGGCGG - Intergenic
994150098 5:96437688-96437710 CTGATTCAGTAGTTCTGGGGTGG - Intergenic
995161024 5:108982120-108982142 CTGATTCTGTAGGTGTGGGGTGG - Intronic
995239717 5:109872272-109872294 CCAATTCAGTAGGTCCGGGGTGG - Intergenic
995507424 5:112874678-112874700 CTGATTCAGGAAGTCTGGGGTGG - Intronic
995576972 5:113547297-113547319 CAGATTCAATAAGTCTGGGATGG - Intronic
995900013 5:117054492-117054514 CTGATTCAGTAAGTCTGAGGGGG - Intergenic
996138120 5:119870194-119870216 CTGATTCAATAAGTCTGGAGTGG - Intergenic
996238513 5:121165349-121165371 CTGATTTAGTAGGTTTGGGGTGG - Intergenic
996471406 5:123865208-123865230 CTGATTCAGTAGGTCTGGGCAGG - Intergenic
996856120 5:128009459-128009481 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
997033112 5:130154934-130154956 CTGATTCACTAGGTTTGGGGTGG + Intronic
997708518 5:135982220-135982242 CAGATTCACTAAGTCTGTGGTGG - Intergenic
997747946 5:136316070-136316092 CTGACTCAGTAAGTCTAGGGTGG - Intronic
998390024 5:141781237-141781259 CTGATTCAGTAGGTTTGGGGAGG + Intergenic
998685871 5:144524211-144524233 CTGATTCACTAAGTCTGGGGTGG - Intergenic
999116501 5:149168917-149168939 CCAATTCAGTAAGTCTGGGGTGG + Intronic
999125488 5:149242917-149242939 CGAATTCAGTAAGCCTGGGGTGG - Intronic
999132973 5:149298853-149298875 CTGATTCAGGAGGTGTGCGGTGG - Intronic
999187748 5:149725359-149725381 CCAATTCAGTAGGTCTGGGGTGG - Intergenic
999540836 5:152570997-152571019 CTGATTCAGTAAGTCAGGGGTGG + Intergenic
999629382 5:153554441-153554463 CCGAGTCAGTAAATCTGGGGTGG + Intronic
999635900 5:153622135-153622157 CTGATTCAGTAGGTCTGGGATGG - Intronic
999835379 5:155364657-155364679 CTGATTCAGCAAGTCTCGGGTGG - Intergenic
999960713 5:156753105-156753127 CTGATTCAGTAAGTCTAGAGGGG - Intronic
1000254458 5:159524784-159524806 CTAATTCAGTAGGTCTGGGGTGG + Intergenic
1001018965 5:168166585-168166607 CTGATTCTCTAAGTCTGGGGAGG + Intronic
1001110335 5:168890837-168890859 CTGATTCAGTAGGTTTGGGATGG - Intronic
1001218175 5:169875257-169875279 CTGAATCAGAGAGTGTGGGGTGG - Intronic
1001228250 5:169963874-169963896 CTAATTCAGTGGGTGTGGGGTGG + Intronic
1001716575 5:173821248-173821270 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1001756948 5:174177722-174177744 CTGATTCAGCAAGTTTGGGCTGG - Intronic
1001827571 5:174758131-174758153 CTGATTCAGTAGGTCTGGGATGG + Intergenic
1001860649 5:175051838-175051860 CCGATTCAGTAGGTCTGGGGTGG + Intergenic
1002060882 5:176625326-176625348 CTGATTCAGTAGGTCTGAGGTGG - Intronic
1003013998 6:2453190-2453212 TGGATTCAGTTAGTGAGGGGAGG - Intergenic
1003141696 6:3477333-3477355 CTGATTCTGTAAGTCTGGGCGGG - Intergenic
1003188474 6:3852628-3852650 TTGATTCAGTAGGTCTGGGGTGG - Intergenic
1003279033 6:4676110-4676132 CTCTTTCAGTAAGTCTGGGGAGG + Intergenic
1003492055 6:6631602-6631624 CTGATTCAGTACGTCTGGGTAGG - Intronic
1003525583 6:6894042-6894064 CTGATTCAGCAGGTGTGGGTCGG + Intergenic
1003584144 6:7371192-7371214 CTGATTCAGTAATTCTGGGGTGG - Intronic
1003638351 6:7855333-7855355 CTGACTCAGTAAGCTTGGGGAGG - Intronic
1004096168 6:12556617-12556639 CTGATGCAGTAAGTCTGGGGTGG + Intergenic
1004132299 6:12932022-12932044 CTGATTCAGTAGGTCTTGGGTGG - Intronic
1004191216 6:13465443-13465465 CTGATTCTGTAGGTCTGGGGTGG - Intronic
1004304696 6:14488998-14489020 CTGATGCAGTAGGAGTGGGGAGG - Intergenic
1004344974 6:14840735-14840757 GTGATTCAGTAAGTCTGGGGTGG + Intergenic
1004382377 6:15143631-15143653 CTGATTTAGTAGGTCTGGGGAGG - Intergenic
1004480821 6:16017911-16017933 TTGATTCAGTAGGTTTGGGGTGG - Intergenic
1004534767 6:16489897-16489919 CTGATTCAGTAGGCTTGGGGTGG + Intronic
1004566779 6:16805362-16805384 CTGATGCAGTCGGTGTGGGGTGG + Intergenic
1005108659 6:22253322-22253344 CCTATTCAGTGAGCCTGGGGCGG - Intergenic
1005250119 6:23935824-23935846 CTGATTTAGTAGGTCTGGGGTGG - Intergenic
1005458538 6:26045084-26045106 CCGATTCAGTAAGTTTGAGTGGG - Intergenic
1005653646 6:27909418-27909440 CCAATGTAGTAAGTCTGGGGTGG - Intergenic
1005703907 6:28431507-28431529 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1005712376 6:28514659-28514681 CTGATTCAGTAAGTTTTAGGGGG - Intronic
1006352094 6:33528497-33528519 CAGATTCAGTAGGTCTGGGCTGG - Intergenic
1006717485 6:36129997-36130019 CTGACTCAGTAGGTTTGGGGTGG - Intronic
1006904815 6:37526107-37526129 CTGATTCAGTAAACCTGGGGTGG - Intergenic
1007670181 6:43545966-43545988 CTGATTTAGTATGTCTGGGGTGG + Intronic
1007814048 6:44507717-44507739 CAGAATCAGTTGGTGTGGGGTGG + Intergenic
1007931975 6:45699967-45699989 CCGAATCAGTAAGTCTGAGGTGG + Intergenic
1007949560 6:45859344-45859366 CTGATTCAGTAGGTCTAGGGAGG + Intergenic
1008056721 6:46953197-46953219 CAGATTCAGTAAATCTGGGGAGG + Intronic
1008127102 6:47681099-47681121 CTGATTCATTAAGTCTGGGGTGG + Intronic
1008341185 6:50366244-50366266 CCGATTCAGTAGGTCTTGGGTGG + Intergenic
1008583717 6:52929932-52929954 CTGATTCAGTAAGGCTGGGGTGG + Intergenic
1009903715 6:69842010-69842032 CTGATCCAGTAAGTCTGGGGTGG + Intergenic
1010124277 6:72414118-72414140 CTGATTCAGTCAGTTCGGGGCGG - Intergenic
1010152347 6:72748427-72748449 CTGATTCATTAAGTCTGGGGTGG - Intronic
1010211827 6:73368237-73368259 CTGATTCAGTACTTTTGGGGTGG - Intergenic
1010308949 6:74359996-74360018 CTGATTCAGTAGGTGTGGGGTGG + Intergenic
1010550293 6:77213601-77213623 CCGATTTAGTAGGTTTGGGGTGG - Intergenic
1010769555 6:79812655-79812677 CTGATTCAGCAAGTCTGGGATGG - Intergenic
1011007936 6:82668959-82668981 CTGATTCAGTAAGTCTGGAGTGG - Intergenic
1011029055 6:82901453-82901475 TAGATTCAGTAAGTCTGGAGTGG - Intronic
1011338532 6:86286375-86286397 CCAATTCAGTAGTTCTGGGGTGG + Intergenic
1011396813 6:86918996-86919018 TTGATTCAGTAAGTTTAGGGTGG + Intergenic
1011511481 6:88105859-88105881 CTAATTCAGTTAGTCTGGGGAGG + Intergenic
1011614154 6:89182685-89182707 CCAATTAAGTAGGTTTGGGGTGG - Intronic
1012031828 6:94079452-94079474 CTGATTTAATAGGTGTGGGGTGG - Intergenic
1012280424 6:97321621-97321643 CTGATTCAGTAAGTCTGGGTGGG - Intergenic
1013577582 6:111500109-111500131 CCTATTCAGTAAGTCTGGGATGG - Intergenic
1013594216 6:111646271-111646293 CTTATTCAGTAAGTCTGGGAGGG + Intergenic
1013760920 6:113516575-113516597 TTGATTCAGTAGGTTTGGGGTGG - Intergenic
1013987610 6:116214587-116214609 CTGATTCAGTAGGTTTGGGGTGG - Intronic
1014264790 6:119264183-119264205 CTGATTCAGTAAATCTGGGTTGG - Intronic
1014274398 6:119370273-119370295 CTGATTCAGTAAGTCTGGGGCGG + Intergenic
1014452015 6:121592694-121592716 CTGATTCAGTAGGTCCGGGGTGG + Intergenic
1014551128 6:122790214-122790236 CAGATTCAGTAGGTCTGGGATGG - Intronic
1014641375 6:123914962-123914984 TTGATTCAGTAAATGTGAGGTGG - Intronic
1014832007 6:126113814-126113836 CAGATTCAATAGGTGTGAGGTGG - Intergenic
1014991242 6:128079938-128079960 CTGATTCAGTATTTCTGGGGAGG + Intronic
1015416188 6:132951302-132951324 CTGATTCAGGAGGTGTGAGGAGG + Intergenic
1015805323 6:137102524-137102546 CTGAGTCAGAAAGTTTGGGGTGG + Intergenic
1015944155 6:138482973-138482995 CTGATTCAGTAGGTCTGGGATGG + Intronic
1016547868 6:145244539-145244561 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1016878712 6:148889141-148889163 CTGATTCAGTGGGTCTGGGGTGG + Intronic
1017648961 6:156563697-156563719 CTGATTCAGGAAGTCTAGGGTGG + Intergenic
1017703129 6:157095134-157095156 GTGATTCAGTAGTTGTGGGGTGG + Intronic
1017777075 6:157688867-157688889 CCGACTCAGTGAGTGGAGGGTGG - Intergenic
1017795068 6:157836547-157836569 CTGATTCAGGAGGTCTGGGGTGG + Intronic
1017838523 6:158202350-158202372 CCGATTAAGTGGGTGTGGGCTGG + Intergenic
1017951648 6:159140314-159140336 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1018678523 6:166243555-166243577 CTGGTTCAGTAGGTCTGGGGTGG + Intergenic
1018832643 6:167456429-167456451 CCAATTCAGTAGGTCTGGGGTGG - Intergenic
1021180285 7:17497956-17497978 CTGATCCAGCAAGTTTGGGGTGG - Intergenic
1021191782 7:17628896-17628918 CTGATTCAGTAGGCCTGGGGTGG + Intergenic
1021283737 7:18752930-18752952 CTAATTCAGTAAGTCTGGAGTGG + Intronic
1021483111 7:21139923-21139945 CTGATTCAGTAGGTCTGGGATGG - Intergenic
1021486494 7:21173930-21173952 CAGATAGAGTAGGTGTGGGGAGG - Intergenic
1021596506 7:22322774-22322796 CTAATTCAGTATGTTTGGGGTGG - Intronic
1021606323 7:22412825-22412847 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
1021687785 7:23204253-23204275 CTGATTCAGTAAGTTTGGGGTGG - Intergenic
1021888667 7:25165731-25165753 CTGTTTCAGTAAATCTGGGGTGG + Intronic
1021937858 7:25648800-25648822 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1022324342 7:29317494-29317516 CTGATTCAGTAGGTCTGGGCAGG - Intronic
1022403680 7:30065927-30065949 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1022620296 7:31976976-31976998 CTGATTCAGTAGGTCTGGGATGG - Intronic
1022810719 7:33865208-33865230 CCGATTCAGTGAGTCTGGGTAGG - Intergenic
1022847820 7:34228446-34228468 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1023141511 7:37106905-37106927 CTGACTCAGTAGGTGTGGGTTGG + Intronic
1023216273 7:37866484-37866506 CTGATTTAGTAAGTCTGAGGTGG - Intronic
1023332597 7:39134341-39134363 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1023520335 7:41044126-41044148 CTGATTCTGTAGGTGTGGAGAGG - Intergenic
1023676462 7:42635297-42635319 CTGATTCAGTGGGTCTGGGGAGG - Intergenic
1023730714 7:43189307-43189329 CTGATTCAGTAGGTGAGGGTGGG + Intronic
1023951789 7:44852069-44852091 CAGATTCAGCAGGTCTGGGGTGG - Intergenic
1024687054 7:51757442-51757464 TCAATTCAGTAGGTATGGGGAGG + Intergenic
1025016046 7:55439924-55439946 CTGATTCAGTAGGTCTGGGTGGG + Intronic
1026336307 7:69396931-69396953 CTGATTCAGTAGGTCTGGGTAGG + Intergenic
1026366662 7:69655501-69655523 CTGGTTCAGTAGGTCTGGGGTGG - Intronic
1026459383 7:70600032-70600054 CTGATTCAGTAGCTGTGGGTGGG - Intronic
1026473311 7:70712570-70712592 CCAATTCTGTAGGTTTGGGGTGG - Intronic
1026576339 7:71574711-71574733 CTGATTCAGTAGGTCTGGGATGG - Intronic
1026613050 7:71877997-71878019 CTGTTTCAGTAAGTCTGGAGTGG + Intronic
1027268356 7:76506050-76506072 CTGATGCAGGAAGTGGGGGGGGG - Intergenic
1027377534 7:77567585-77567607 CTGATTCAGTAGGTCTGAGGTGG - Intronic
1027775104 7:82455099-82455121 CTGATTCAGTAGGTCTGGGTGGG + Intergenic
1028350101 7:89836044-89836066 CTGATGCAGTAAGTCTGAGGTGG + Intergenic
1028376804 7:90154101-90154123 CCGGTTCAGTATGTCTGGGATGG - Intergenic
1028550286 7:92053829-92053851 CAGTTTCAGTAGGTCTGGGGTGG - Intronic
1028673397 7:93430756-93430778 CCTATTCAGTAGGTCTGGGGTGG - Intronic
1028853186 7:95559689-95559711 TTGATTCAGTAAGTCTAGGGTGG - Intergenic
1028943199 7:96548442-96548464 CTGATTCAGTAGGCCTGGGGTGG - Intronic
1029031491 7:97472267-97472289 CTGATTCAGTAGGTCTTGGGTGG - Intergenic
1029849554 7:103447619-103447641 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1029960208 7:104682361-104682383 CCGGTTCAGTGGGTCTGGGGTGG - Intronic
1030215301 7:107039058-107039080 CAGATTCAGTAAGTCTGAGGTGG - Intergenic
1030272387 7:107684657-107684679 CTGATTCAATAGGTTTGGGGTGG - Intronic
1030297501 7:107943647-107943669 CTGATTCAGTAGGTCTGGGTGGG + Intronic
1030506727 7:110433901-110433923 CTGATTCAGTAAGTCTGATGTGG + Intergenic
1030975720 7:116120464-116120486 CAAATTCAGTAAGTCTTGGGTGG - Intronic
1031376151 7:121028178-121028200 CTGATTCAGTAAGAATGGAGAGG + Intronic
1031485946 7:122324497-122324519 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1031494425 7:122428901-122428923 ATGATTCTGTAAGTGTGGGGAGG - Intronic
1031874276 7:127120497-127120519 CTCATTCAGTAGGTCTGGGGTGG - Intronic
1032205986 7:129865932-129865954 CCAATTGAGTAAGGGTGGGGGGG + Intronic
1032417053 7:131743810-131743832 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1032568802 7:132977265-132977287 CTGATTCAGCAAGTGTGGGATGG - Intronic
1032677124 7:134141330-134141352 CTGATTCGGTAGGTTTGGGGCGG + Intronic
1032679939 7:134171924-134171946 CTAATTCAGTAGATGTGGGGAGG + Intronic
1033257724 7:139816640-139816662 CTGATTCAGTAATTCTGGGTTGG - Intronic
1033275035 7:139965393-139965415 CCGATTCCATAAGTCTGGGCTGG + Intronic
1033674920 7:143531334-143531356 CCAAATCAGTAGGTCTGGGGCGG + Intergenic
1033696916 7:143798106-143798128 CCAAATCAGTAGGTCTGGGGCGG - Intergenic
1033900443 7:146132358-146132380 CTGATTCAGTAAATCTGGAGTGG + Intronic
1034066432 7:148141076-148141098 CTGATTCAGTAGGTTTGGGGTGG - Intronic
1034093741 7:148387601-148387623 CTGATTTAGTCAGTATGGGGAGG - Intronic
1034590784 7:152137277-152137299 CCCATTCAGTAAATCAGGGGAGG - Intronic
1034783110 7:153900074-153900096 CTGATTCAGTAGGTCTGGGTGGG - Intronic
1034859616 7:154584097-154584119 CAGATTGAAGAAGTGTGGGGCGG - Intronic
1035060122 7:156062878-156062900 CGGATTCAGTAGGTGTGGGATGG + Intergenic
1035126379 7:156610861-156610883 CTGATTCAGTGAGTCTGGAGTGG + Intergenic
1035198100 7:157240016-157240038 CAGATTCAGAAGGTCTGGGGTGG - Intronic
1035786716 8:2266822-2266844 CGGATTCAGCAAGTTTGGGTGGG + Intergenic
1035806091 8:2454894-2454916 CGGATTCAGCAAGTTTGGGTGGG - Intergenic
1036374948 8:8192029-8192051 CTGATTCATTAGGTCTGGGGTGG + Intergenic
1036727252 8:11231149-11231171 CAGATCCAGTAGGTCTGGGGTGG - Intergenic
1036854595 8:12231122-12231144 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1036875954 8:12473615-12473637 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1037700858 8:21272643-21272665 CCAATTCAGTAGCTGTGGGAGGG - Intergenic
1038110338 8:24489986-24490008 CAGATTCAGTAAGTATGGAGTGG + Intronic
1038222643 8:25625370-25625392 CCAATTCAGTAAGTTTGAGGTGG + Intergenic
1038609171 8:29043675-29043697 CTGATTTAGTAAGTCTGAGGTGG + Intronic
1039303992 8:36241345-36241367 CAGATTCAGTAGGTCTGGGATGG + Intergenic
1039400456 8:37264971-37264993 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1041349354 8:56933201-56933223 CTGAGTCAGTAATTCTGGGGTGG + Intergenic
1042012097 8:64258185-64258207 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1043028432 8:75101359-75101381 CTGATTCAGTAGGTGTGAGACGG - Intergenic
1043160091 8:76836322-76836344 CTGATTCAGTAGGTCTGGGTTGG - Intronic
1043389761 8:79781188-79781210 CTGATTCTGTAAGTCTGGGTTGG + Intergenic
1043546210 8:81318788-81318810 CGAATTCAGTAGGTCTGGGGCGG - Intergenic
1043865269 8:85367621-85367643 CTGATTCAGTAGGTCTGGGATGG + Intronic
1043992173 8:86768882-86768904 CTGATTCAGTAAGTTTGAGGAGG - Intergenic
1044069184 8:87735088-87735110 CTGATTCAATAAGTGGGGTGAGG - Intergenic
1044859756 8:96511394-96511416 ACGATTCAGTAAGTCTCAGGTGG - Intronic
1044865150 8:96563589-96563611 CTGATTCATTAGGTCTGGGGTGG + Intronic
1045003402 8:97897157-97897179 CTGATTCAGTAGGTCTGGGTTGG + Intronic
1045102768 8:98861991-98862013 CAGATTCAGTAAATGTGCAGGGG + Intronic
1045444986 8:102251844-102251866 CTGATTCAGTAAGTCTTTGGTGG - Intergenic
1045605102 8:103764033-103764055 CCTATTCAGTAAGTCTGGGGTGG + Intronic
1045615631 8:103907164-103907186 CTGATTCATTAAGTCTAGGGTGG + Intronic
1045777562 8:105823750-105823772 CTGATTCAGTAGGAGTGGGGAGG + Intergenic
1045901649 8:107288542-107288564 CTGATTCAGTATGTCTGGGGTGG + Intronic
1046517876 8:115286892-115286914 CCTATTCAGAAGGTATGGGGTGG - Intergenic
1047000329 8:120566723-120566745 CTGATTCAGTTGGTCTGGGGTGG + Intronic
1047310985 8:123691751-123691773 CTGATTCAGTAGGTCTGGTGGGG + Intronic
1048064564 8:130954484-130954506 CCAATTCAGTAGGTGTGGGTGGG - Intronic
1048296096 8:133215193-133215215 CTGATTCAACAAGTCTGGGGTGG - Intronic
1048481699 8:134801954-134801976 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1048488443 8:134869898-134869920 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1048643932 8:136396470-136396492 GCGAGTCAGTAAGTGAGGGGTGG - Intergenic
1048869844 8:138788175-138788197 CTGATTTAGTATGTCTGGGGTGG - Intronic
1049044373 8:140137605-140137627 CTGATTCAGCAGGTGCGGGGTGG - Intronic
1049901429 9:170204-170226 CCGATTCAGTAGATCTGGGTTGG + Intronic
1050051722 9:1608998-1609020 CTGGTTCAGCAAGTCTGGGGTGG + Intergenic
1050086801 9:1974314-1974336 CTGATTCAGTATGTCTGGGATGG - Intergenic
1050112571 9:2231991-2232013 CTGATTCAGTAGGTCTGGAGTGG + Intergenic
1050154787 9:2655041-2655063 CTGATTCAGTAGGTCTGGGATGG - Exonic
1050247272 9:3703789-3703811 CTGATTCAGGAATTCTGGGGAGG - Intergenic
1050256502 9:3797517-3797539 CCAATTCAGTAGGTCTGAGGTGG - Intergenic
1050339375 9:4620461-4620483 CTGATTCAGTAGGGCTGGGGTGG - Intronic
1050460858 9:5876191-5876213 CTGATTTAGTAAGTCTGGGGTGG + Intergenic
1050644667 9:7706411-7706433 CTGATTCAGCAGATGTGGGGTGG - Intergenic
1050702443 9:8355785-8355807 CTTATTCAGTAAGTCTGGGGTGG + Intronic
1050834698 9:10061924-10061946 CCGATTCAGTATTTGTGGGTGGG - Intronic
1050853903 9:10325189-10325211 CTGTTTCAGTAAGTGTGAGGTGG + Intronic
1051121295 9:13755294-13755316 CCGATTCAATAATTTTGGGCTGG + Intergenic
1051235239 9:14992657-14992679 CTGATTCAGTAAGTCTGGGTAGG + Intergenic
1051764847 9:20512451-20512473 CTGATTCATTAAATTTGGGGTGG - Intronic
1051885206 9:21885392-21885414 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1052083882 9:24239966-24239988 CTGATTCAGCAAGTCTGGGTGGG + Intergenic
1052216614 9:25973475-25973497 CTGATTCAGTAGGTCTGGGTGGG - Intergenic
1052343909 9:27389210-27389232 CTGATCCAGTAAGTTTGGGGTGG - Intronic
1053070071 9:35096012-35096034 CTGATTCAGTAGATCTGGGGTGG - Intronic
1053279351 9:36807449-36807471 CTGACTCAGTAAGTCGGGGGTGG + Intergenic
1053456670 9:38238317-38238339 CTGATTCAGTAAGTGTGGAATGG - Intergenic
1053744465 9:41180511-41180533 CCGATTCAGTAGATCTGGGTTGG + Intronic
1054482805 9:65684698-65684720 CCGATTCAGTAGATCTGGGTTGG - Intronic
1054683879 9:68250739-68250761 CCGATTCAGTAGATCTGGGTTGG - Intronic
1054820337 9:69515663-69515685 CTGATTCAGAAAGTATGGAGTGG - Intronic
1054907924 9:70426895-70426917 TTGATTCAGTATGTTTGGGGTGG + Intergenic
1055004204 9:71486922-71486944 CTGATCCAGTAGGTCTGGGGTGG - Intergenic
1055019699 9:71656568-71656590 CTGATTCATTAGGTCTGGGGTGG - Intergenic
1055098009 9:72434325-72434347 CTGATCCAGTAAGTGGGGAGGGG + Intergenic
1055365202 9:75536496-75536518 CTGATTCAGTAAGTGTGGATTGG - Intergenic
1056031797 9:82560941-82560963 CTGATTCAGGAAGTAGGGGGTGG + Intergenic
1056115349 9:83435808-83435830 CTGATTCAGTAAATATGAGGTGG + Intronic
1056960985 9:91122964-91122986 CTGACTCAGTAGGTGTGGGTGGG - Intergenic
1057665944 9:97045643-97045665 CTGATTCAGTAGGTCTGGGACGG + Intergenic
1057894162 9:98893749-98893771 CAGATTCAGTAGGTCTGGGGTGG - Intergenic
1058001654 9:99872071-99872093 CTGATTCAGTAACTCTGGAGTGG - Intergenic
1058115071 9:101076143-101076165 CTGATTCAGGAGGTCTGGGGTGG - Intronic
1058703225 9:107618211-107618233 CTGATTTAGTAGGTATGGGGTGG - Intergenic
1058734664 9:107883370-107883392 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1058817326 9:108696410-108696432 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1058875619 9:109242262-109242284 CTGATCCAGTAGGTCTGGGGTGG + Intronic
1059048745 9:110899659-110899681 CTGATTCAGTAGGTCTGGAGTGG + Intronic
1059057368 9:110998047-110998069 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1059175338 9:112165016-112165038 CCAATTCAGTTGGTCTGGGGAGG + Intronic
1059379472 9:113912025-113912047 CTGATTCAGCAGGTGTGGGCGGG + Intronic
1059777848 9:117493780-117493802 CTGATTCAGTAAGTTTGGGGTGG - Intergenic
1059802600 9:117765241-117765263 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1059915053 9:119090078-119090100 CTCATTCAGTATGTCTGGGGTGG + Intergenic
1059971483 9:119673211-119673233 CTGATTCAGTAAGTCTGGAGTGG + Intergenic
1060116315 9:120944026-120944048 CTGTTTCAGTAGGTCTGGGGTGG + Intergenic
1060363253 9:122981573-122981595 CCAATTAACTAAGTCTGGGGTGG - Intronic
1061443589 9:130624406-130624428 CTGATTCAGTAGATCTGGGGTGG - Intronic
1062125182 9:134856333-134856355 CTGGTTCAGTAGGTATGGGGCGG + Intergenic
1186375282 X:8992012-8992034 CCGATTCAGTAGGTCTGGGATGG + Intergenic
1186587904 X:10896436-10896458 CTGATTCAGTAGGTTTGGAGTGG - Intergenic
1186625040 X:11284249-11284271 CAGATTCAGTAGGTGTGGGAGGG + Intronic
1186693564 X:12005252-12005274 CCGATTCAGTAGGTCTGGGATGG + Intergenic
1186708930 X:12172545-12172567 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1186894670 X:13993881-13993903 CTCATTCAGTAGGTCTGGGGTGG - Intergenic
1186919065 X:14257593-14257615 CCGATTCAGTAGGTCTTGGGTGG - Intergenic
1187120762 X:16403995-16404017 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
1187292621 X:17969748-17969770 CTTATTCAGTAGGTCTGGGGTGG + Intergenic
1187305349 X:18090370-18090392 CTGATTCAGTGGGTCTGGGGTGG + Intergenic
1187369117 X:18689610-18689632 CTGATTTAGTAGGTCTGGGGTGG - Intronic
1187421039 X:19133880-19133902 CTGATTCAGTAGTTTTGGGGAGG + Intergenic
1187510528 X:19913584-19913606 CTGATTCAGGAGGTCTGGGGTGG + Exonic
1187566493 X:20454659-20454681 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1187712448 X:22067758-22067780 CTAATTCAGTAGGTCTGGGGTGG - Intronic
1187776845 X:22769916-22769938 CTGATTCAATAGGTGTGCGGTGG + Intergenic
1187819933 X:23276653-23276675 CTGATTCATTAAGTTTGGGGTGG - Intergenic
1187827385 X:23345604-23345626 CTGAGTCAGTAGGTCTGGGGTGG + Intronic
1187882232 X:23857955-23857977 CTGATTCAGTCAGTCTGGGGTGG + Intronic
1187962938 X:24583880-24583902 CAGATTCAGTAGGTCTGGTGGGG - Intronic
1187969917 X:24648713-24648735 CTGATTCAGTAAGTCTGGGGTGG + Intronic
1187969982 X:24649375-24649397 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1187997610 X:24945615-24945637 CTGATTGAGTAGGTCTGGGGTGG + Intronic
1188286959 X:28338939-28338961 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1188355013 X:29179896-29179918 CCGATTCAGAAAGTTGGGTGGGG + Intronic
1188398441 X:29715320-29715342 CTGATTTAGTAAGTCTAGGGTGG + Intronic
1189148380 X:38678922-38678944 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1189363035 X:40368173-40368195 CTGATTCAGCAAGTCTGAGGTGG - Intergenic
1189396965 X:40631740-40631762 CCCATGCAGTAGGTCTGGGGTGG + Intronic
1190455773 X:50626585-50626607 GTGATTCAGTAAGTGGGGAGTGG - Intronic
1190702890 X:53001215-53001237 CTGATTCAGTGGGTCTGGGGAGG + Intergenic
1190827640 X:54032236-54032258 CTGATTCAGTCAGTCTGGGGTGG + Intronic
1191666094 X:63704315-63704337 CTGATTCAGTAAGTCTGGGTTGG + Intronic
1191676186 X:63794733-63794755 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1191831063 X:65416817-65416839 TTGATTCAGTAAGTCTGGAGTGG - Intronic
1191865642 X:65701576-65701598 CCATTTCAGTAAGCTTGGGGTGG + Intronic
1191916738 X:66209377-66209399 CTGATTCAGTAGGTGTGTGATGG + Intronic
1192819260 X:74626355-74626377 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1193150960 X:78124315-78124337 CTGATTCGGTAGGTCTGGGGTGG - Intronic
1193500143 X:82264805-82264827 CCCATTCAGTTAGTGTTAGGGGG + Intergenic
1194011845 X:88571180-88571202 CTGATTCAGCAAGTCTGGGGTGG + Intergenic
1194396047 X:93387634-93387656 CTGATTCAGTAGGTTTGGGAGGG + Intergenic
1195026705 X:100884712-100884734 CTGATTCAGTAGGTCAGGGGAGG - Intergenic
1195046387 X:101058176-101058198 ACAATTCAGTAAGTGTGGGGTGG + Intergenic
1195179410 X:102342358-102342380 CTGATTCAGTAGGTCTAGGGTGG + Intergenic
1195317018 X:103689010-103689032 CTGATTCATTAAGTTTGAGGTGG - Intergenic
1195373065 X:104199191-104199213 CTGATTGAGTAGGTCTGGGGTGG + Intergenic
1195545846 X:106111736-106111758 CCTATTCAGTAAGTCTGCAGTGG - Intergenic
1195591721 X:106636387-106636409 CAGATTCAGTAGGTCTAGGGTGG - Intronic
1195713324 X:107793251-107793273 CTGATTCAGTAGGTTTGGAGAGG - Intronic
1195954380 X:110314020-110314042 CTGATTCAGTTGGTGTGGGGTGG - Intronic
1195981230 X:110580697-110580719 CTGATTCAGTAAATCTGGGTTGG + Intergenic
1196089442 X:111724314-111724336 CTGATTCAGTAAGTCTGAGGTGG + Intronic
1196576082 X:117320723-117320745 CTGATTCAGAAAGTCTGAGGTGG - Intergenic
1196820636 X:119697692-119697714 CTGATTCAGTAGGTCTCGGGTGG - Intergenic
1196936878 X:120739164-120739186 CTGACTCAGTAGGTTTGGGGTGG - Intergenic
1196948764 X:120854812-120854834 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1196963950 X:121035152-121035174 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1197337074 X:125221406-125221428 CTTATTCAGTGGGTGTGGGGTGG - Intergenic
1197536957 X:127702158-127702180 CTGATTCAGTAGGTTTGGGAGGG - Intergenic
1197802556 X:130367052-130367074 CTGATTTAGTAAGTATGGAGTGG + Intronic
1197961000 X:132006132-132006154 CTGATTCAGTAGGTCTGGAGTGG - Intergenic
1197995234 X:132365869-132365891 CTGAATCAGAAATTGTGGGGTGG + Intergenic
1198047943 X:132921292-132921314 CTGATTCAGTAGGTCAGGGGTGG - Intronic
1198090704 X:133326401-133326423 CTGATTCAGTAACTCTGGGGTGG - Intronic
1198319496 X:135505571-135505593 CTGATTGAGTAAATGTGGGTGGG + Intergenic
1198559139 X:137829807-137829829 TTGATTCAGTAGGTTTGGGGTGG - Intergenic
1198562058 X:137861090-137861112 CTGATTCAGTAGAAGTGGGGTGG + Intergenic
1198685146 X:139220922-139220944 CTGATTCAGAAAGTCTGGGGTGG - Intronic
1198709054 X:139481520-139481542 CAGATTCATCAAGTCTGGGGTGG - Intergenic
1198765572 X:140076184-140076206 CTGATTCAGTAGGTCTGGGTTGG - Intergenic
1198851453 X:140968987-140969009 CAGATTCAGAAACTGAGGGGAGG - Intergenic
1199008893 X:142735730-142735752 CTGATTCAGCAAGTCTGGGGTGG + Intergenic
1199725473 X:150575653-150575675 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1199737939 X:150702309-150702331 CTGATTCAGTAAATCTGGGATGG - Intronic
1199927577 X:152484159-152484181 TTGATTCAGTATGTCTGGGGTGG - Intergenic
1199933792 X:152551664-152551686 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1201470658 Y:14331145-14331167 CTGATTCAGTAGGTCTGGAGTGG + Intergenic