ID: 976065320

View in Genome Browser
Species Human (GRCh38)
Location 4:81180657-81180679
Sequence CAAGTGTCCCACATTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976065320 Original CRISPR CAAGTGTCCCACATTGATTC TGG Intronic
901512454 1:9724273-9724295 CAGCTGTTCCACATTGATTTTGG + Exonic
901884080 1:12210540-12210562 CAAGTGTAAAATATTGATTCTGG - Intergenic
908995439 1:70147107-70147129 GAAGTGCCACACATTGATTTGGG - Intronic
909944172 1:81644745-81644767 CAAATGTACCACACTGGTTCAGG + Intronic
911304575 1:96217267-96217289 TCAGTGGCCCAGATTGATTCAGG + Intergenic
912465017 1:109866489-109866511 CAAATGTCCCACACTATTTCGGG + Intergenic
916583139 1:166126293-166126315 CAAGTGTCCAATATAGATCCTGG - Intronic
919115273 1:193273843-193273865 CAATTGTCCCAAATTTATTGAGG + Intergenic
919843223 1:201623976-201623998 CAAATGTCCCACAATGAATTGGG - Intronic
920225355 1:204434481-204434503 CACATGTTCCACATTGATTTTGG - Exonic
1071297504 10:84232828-84232850 GCAGTGTCCCACCTTGACTCCGG - Exonic
1071800323 10:89053191-89053213 CATGTGTCCCACAAACATTCAGG - Intergenic
1072276773 10:93830981-93831003 AAAGTGGTCCACATGGATTCTGG - Intergenic
1074330328 10:112500687-112500709 CAAGAGTCCAACATTGATCTAGG - Intronic
1077700071 11:4432975-4432997 CAAGTGTCCTATATGGATGCTGG + Intergenic
1078536444 11:12178945-12178967 CCACTGTCCCACTTTGGTTCAGG + Intronic
1080323977 11:31049387-31049409 CAAGTGTCCAACAAAGTTTCTGG + Intronic
1086858167 11:91891900-91891922 TAAGTTTCCCACATTAACTCTGG + Intergenic
1087558627 11:99754712-99754734 CAAGTGTACCACTCTGGTTCAGG - Intronic
1088070944 11:105784304-105784326 AAAGTCTCCCAAATTGATTCTGG - Intronic
1092128609 12:6092827-6092849 CATATGTCCCACATTCATTTTGG - Intronic
1095195887 12:39316689-39316711 CAGATCTCCCACATTGTTTCAGG - Intronic
1098952372 12:76654252-76654274 CAAGTGCCACACTTTTATTCGGG + Intergenic
1101366498 12:104076351-104076373 CAAGTCTCCCACTGTGATTGTGG + Intronic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1107054647 13:36089974-36089996 CAAGTGTGCCACATGCATTGTGG + Intronic
1111089271 13:83421608-83421630 CAATTGTCCAACATTATTTCTGG + Intergenic
1111181315 13:84669868-84669890 CAAGTTTCTCACTTTGATGCTGG + Intergenic
1115304889 14:31923737-31923759 CAAGGGTCCCTCATGGATTAAGG - Intergenic
1117594042 14:57308030-57308052 CAAATGTACCACATGGATTGTGG - Intergenic
1117763263 14:59055111-59055133 AAAGTGTCCCAGATTTATTATGG - Intergenic
1122002341 14:98669656-98669678 CAAGGGTCTCGCATTGTTTCAGG - Intergenic
1127166266 15:56246622-56246644 AAAATGAGCCACATTGATTCTGG - Intronic
1128728187 15:70003109-70003131 CTAGGGTTCCACATTGATTTGGG + Intergenic
1134282583 16:12830851-12830873 CAAGTCTTCCACAATGATTAAGG - Intergenic
1135861659 16:26061573-26061595 CAAAAGTCCTACATTAATTCTGG - Intronic
1136500069 16:30665558-30665580 CCAGTGTCCCAGCTTGGTTCTGG + Intronic
1137552274 16:49445844-49445866 CAGGTTTCCCACCTTGATTTTGG - Intergenic
1139160850 16:64507199-64507221 CAAGTGGCCCACACTGGTGCTGG + Intergenic
1140943275 16:79743656-79743678 TAAGTGTCCATCATAGATTCTGG - Intergenic
1141389190 16:83650130-83650152 CAGGTGCAACACATTGATTCTGG - Intronic
1143904960 17:10200664-10200686 CAGTTGTCCTACCTTGATTCAGG - Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1147789187 17:43002592-43002614 CTAGTGTCCCACAAGGATTTGGG + Intronic
1149138215 17:53396222-53396244 CAAATGTTCCACATTGACTAAGG + Intergenic
1152598473 17:81249588-81249610 CATGTGTCCCACGTGGCTTCTGG - Intronic
1157358454 18:46956520-46956542 AAAGTGTCCCTTCTTGATTCAGG + Intronic
1157602101 18:48900167-48900189 TAAGTGTACCACATTGATATGGG + Intergenic
1158746750 18:60208755-60208777 CAAGTGTGCCCCATAGATGCAGG + Intergenic
925986808 2:9223025-9223047 CAAGAGTCCCACTTTAATTTGGG + Intronic
926563690 2:14445723-14445745 CAAGTGTCCCAGATACAATCTGG - Intergenic
927439133 2:23097917-23097939 CAAGGGCCCCACACTGATGCTGG + Intergenic
933409365 2:81905894-81905916 CCAGAGTCACACATTTATTCTGG - Intergenic
935282925 2:101534602-101534624 CCAGTGTCACACAGTGAGTCAGG - Intergenic
935787957 2:106566325-106566347 CATGTGTCCCACAGTGATGGAGG + Intergenic
937282140 2:120725839-120725861 CACGTGTCCCACATTTGGTCAGG + Intergenic
941032617 2:160529703-160529725 CAAATGACCAACATTGACTCAGG - Intergenic
943508484 2:188793640-188793662 CATGTATGCCACATTCATTCAGG + Intergenic
944679141 2:202061013-202061035 CCAGTGTCCCACATTGCTTTGGG + Intergenic
944680967 2:202076360-202076382 AAATTGTCCAACAATGATTCTGG - Intronic
1173057579 20:39630709-39630731 AAAGTTTCTCTCATTGATTCTGG - Intergenic
1181687622 22:24540551-24540573 CAACTGTCCCACATGGCTTCAGG + Intronic
949752420 3:7369816-7369838 CAAGTGATCCACATGGATTCTGG - Intronic
951916053 3:27801904-27801926 CAAGTATCACAAATTCATTCTGG + Intergenic
952562490 3:34611455-34611477 CTCGTGTCCAACATTGACTCAGG - Intergenic
962427043 3:135279497-135279519 AAAGTATTCTACATTGATTCTGG - Intergenic
963446116 3:145410287-145410309 CAAATGTCCCACACTGACTCAGG - Intergenic
965254768 3:166391949-166391971 CAACTCTCCCACATTAAATCAGG - Intergenic
966098528 3:176237856-176237878 CAAATGTTCCACACTGATGCAGG + Intergenic
967521777 3:190440492-190440514 TCAGTGTCCCACATTGCTTGCGG - Intronic
969242251 4:5907303-5907325 TTAGTGTCCCACATGGATTTTGG - Intronic
970685860 4:18566450-18566472 TAAGTTTCCCATATTGATTAAGG + Intergenic
970887087 4:20998900-20998922 TAAGTGCCCAACATTGATGCAGG + Intronic
972091614 4:35293268-35293290 CAGCTCTCCCACATTCATTCTGG - Intergenic
974660276 4:64879446-64879468 TAAGTGGCCTACATTTATTCTGG + Intergenic
976065320 4:81180657-81180679 CAAGTGTCCCACATTGATTCTGG + Intronic
979538040 4:121846646-121846668 CAAGTATACCAGATTCATTCAGG - Intronic
979952735 4:126914691-126914713 CAAATGTCCCACCTTGGTGCTGG + Intergenic
983698985 4:170568030-170568052 CATGTGTGCCACATTAAATCAGG + Intergenic
989301792 5:39903587-39903609 CCAGTGTCCTACAGAGATTCTGG + Intergenic
990363600 5:55047041-55047063 CAAATGTCCCACACTGAACCTGG + Intergenic
991068437 5:62449710-62449732 CAACTGTCCCTAATTGGTTCTGG - Intronic
992076803 5:73199295-73199317 GAAATGTCACACATTGCTTCTGG - Intergenic
993428504 5:87800374-87800396 CCAGGTTCCCACATTGATTCTGG + Intergenic
996090783 5:119349554-119349576 CAGGTCTCCCAAATTGAGTCTGG + Intronic
996325196 5:122265094-122265116 CAAATGTACCACCATGATTCTGG - Intergenic
996491620 5:124104949-124104971 CAGATGTCCCACAATGATACTGG + Intergenic
998421225 5:141988412-141988434 CAAGTGCCCCACAGTGTTTGTGG - Exonic
1001749643 5:174118808-174118830 TAAATGTCCCACAGTCATTCAGG + Intronic
1003128507 6:3375496-3375518 CCACTGGCCCACATTGATTCTGG - Intronic
1003642239 6:7885858-7885880 CATGTGCCCAACATTGAGTCTGG + Intronic
1005515686 6:26552017-26552039 CAAGAGTCCTTCATTTATTCGGG + Intergenic
1006216409 6:32447078-32447100 CAAGTGTACCACATTAATACAGG - Intergenic
1006220845 6:32489813-32489835 CAAGTGTACCACAATGATGCAGG - Intergenic
1006221039 6:32491954-32491976 CAAGTGTGCCACACTAATGCAGG - Intergenic
1006225967 6:32536316-32536338 CAAGTGTACCACACTGATGCAGG - Intergenic
1007879244 6:45143973-45143995 CAACTGTCCCAGATTGAATCAGG + Intronic
1008659615 6:53652487-53652509 CAAGTGTCACACATTTTTACTGG - Intronic
1011304640 6:85912633-85912655 CAAATGTCACACACTGCTTCAGG + Intergenic
1012424717 6:99101237-99101259 CAAGTGTCTTAGAATGATTCTGG + Intergenic
1014334521 6:120116277-120116299 CAAGTGTCTCCCATAGTTTCTGG - Intergenic
1017979879 6:159391901-159391923 CAAGTTTCCAGCAATGATTCAGG + Intergenic
1022021719 7:26406096-26406118 CATCTGTCCCACATTGATATTGG + Intergenic
1023485870 7:40686102-40686124 CAACTGTACCACATTTACTCAGG - Intronic
1024527940 7:50364700-50364722 CAATATTCCCACATTGCTTCTGG - Intronic
1027620247 7:80475792-80475814 CAAGTGTCCCAAAGGGATTTCGG + Intronic
1028377652 7:90162998-90163020 CAAGGATCCCAGAGTGATTCTGG - Intronic
1033973107 7:147067572-147067594 CACCTGTCCGACATTAATTCAGG + Intronic
1041328828 8:56700316-56700338 CAAATGCCCCTCATTGATCCAGG - Intergenic
1042905649 8:73769131-73769153 CAAGTGTACCACACTGATGGAGG - Intronic
1046316147 8:112504744-112504766 CAATTGTCCCACAATGATCATGG + Intronic
1048135721 8:131744742-131744764 TAATTCTCCCACATTGATCCTGG + Intergenic
1048704923 8:137142966-137142988 CATGTGTCCCATATTCACTCTGG - Intergenic
1057957868 9:99425315-99425337 CAAGTGTGACAGATTGATTAGGG - Intergenic
1059116263 9:111602634-111602656 GCAGTGTCCCACATATATTCAGG - Intergenic
1059565273 9:115378065-115378087 GAAATGTCCCCCACTGATTCAGG - Intronic
1185801192 X:3012827-3012849 TAAGTGTCCCGTATTTATTCTGG + Intronic
1186889284 X:13944295-13944317 CAACTGTCCCACTCTGATGCAGG + Intergenic
1187789688 X:22936315-22936337 CAAGTATCACACATAGAGTCAGG + Intergenic
1187951663 X:24476631-24476653 CAAATGTCCCACACTGGTGCAGG - Intronic
1194760683 X:97792850-97792872 CAAGTGACTCACAGTGAATCAGG - Intergenic
1199022485 X:142898182-142898204 TATGTGTCACACATTGTTTCGGG + Intergenic