ID: 976071683

View in Genome Browser
Species Human (GRCh38)
Location 4:81247868-81247890
Sequence TATGATTGTGTATATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976071683_976071687 1 Left 976071683 4:81247868-81247890 CCTTGCCCATATACACAATCATA No data
Right 976071687 4:81247892-81247914 AACTCACTGTCTGTTCTGGCTGG No data
976071683_976071688 9 Left 976071683 4:81247868-81247890 CCTTGCCCATATACACAATCATA No data
Right 976071688 4:81247900-81247922 GTCTGTTCTGGCTGGTTTAGTGG No data
976071683_976071686 -3 Left 976071683 4:81247868-81247890 CCTTGCCCATATACACAATCATA No data
Right 976071686 4:81247888-81247910 ATACAACTCACTGTCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976071683 Original CRISPR TATGATTGTGTATATGGGCA AGG (reversed) Intergenic
No off target data available for this crispr