ID: 976072357

View in Genome Browser
Species Human (GRCh38)
Location 4:81256383-81256405
Sequence CAGTGTGAGTCGGGGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976072357_976072373 27 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072373 4:81256433-81256455 TCCATCTGGGTGGTCTTCAGGGG No data
976072357_976072366 14 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072366 4:81256420-81256442 CTTGCACCACCCATCCATCTGGG No data
976072357_976072367 17 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072367 4:81256423-81256445 GCACCACCCATCCATCTGGGTGG No data
976072357_976072365 13 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072365 4:81256419-81256441 TCTTGCACCACCCATCCATCTGG No data
976072357_976072371 25 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072371 4:81256431-81256453 CATCCATCTGGGTGGTCTTCAGG No data
976072357_976072372 26 Left 976072357 4:81256383-81256405 CCATGTGCCCCCGACTCACACTG No data
Right 976072372 4:81256432-81256454 ATCCATCTGGGTGGTCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976072357 Original CRISPR CAGTGTGAGTCGGGGGCACA TGG (reversed) Intergenic
No off target data available for this crispr