ID: 976074719

View in Genome Browser
Species Human (GRCh38)
Location 4:81284741-81284763
Sequence CGGCTGGAGCAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976074719_976074723 -10 Left 976074719 4:81284741-81284763 CCCAGCTCCCTCTGCTCCAGCCG No data
Right 976074723 4:81284754-81284776 GCTCCAGCCGCAGAGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976074719 Original CRISPR CGGCTGGAGCAGAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr