ID: 976076350

View in Genome Browser
Species Human (GRCh38)
Location 4:81303490-81303512
Sequence GTGGAGCAGGAGGTTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976076350_976076355 -2 Left 976076350 4:81303490-81303512 CCTGTGTGAACCTCCTGCTCCAC No data
Right 976076355 4:81303511-81303533 ACATCCACAGAAGGTCCTCTAGG No data
976076350_976076356 -1 Left 976076350 4:81303490-81303512 CCTGTGTGAACCTCCTGCTCCAC No data
Right 976076356 4:81303512-81303534 CATCCACAGAAGGTCCTCTAGGG No data
976076350_976076358 7 Left 976076350 4:81303490-81303512 CCTGTGTGAACCTCCTGCTCCAC No data
Right 976076358 4:81303520-81303542 GAAGGTCCTCTAGGGTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976076350 Original CRISPR GTGGAGCAGGAGGTTCACAC AGG (reversed) Intergenic
No off target data available for this crispr