ID: 976077675

View in Genome Browser
Species Human (GRCh38)
Location 4:81317991-81318013
Sequence CTGGACGAATGGTATGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976077675_976077678 -6 Left 976077675 4:81317991-81318013 CCTATTTCATACCATTCGTCCAG No data
Right 976077678 4:81318008-81318030 GTCCAGGTCCATGTAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976077675 Original CRISPR CTGGACGAATGGTATGAAAT AGG (reversed) Intergenic
No off target data available for this crispr