ID: 976078615

View in Genome Browser
Species Human (GRCh38)
Location 4:81328606-81328628
Sequence CCCCATTTAAAAATGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976078612_976078615 26 Left 976078612 4:81328557-81328579 CCAGGATATACAAATAACTAGTA No data
Right 976078615 4:81328606-81328628 CCCCATTTAAAAATGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976078615 Original CRISPR CCCCATTTAAAAATGGACCA AGG Intergenic
No off target data available for this crispr